Mercurial > repos > iuc > gatk2

changeset 6:b80301676614 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author iuc
date Wed, 18 Feb 2015 11:36:59 -0500
parents c2645201ffae
children 702c603e625e
files base_recalibrator.xml depth_of_coverage.xml gatk2_annotations.txt.sample gatk2_macros.xml haplotype_caller.xml indel_realigner.xml print_reads.xml readme.rst realigner_target_creator.xml reduce_reads.xml test-data/phiX.fasta tool_dependencies.xml unified_genotyper.xml variant_annotator.xml variant_apply_recalibration.xml variant_combine.xml variant_eval.xml variant_filtration.xml variant_recalibrator.xml variant_select.xml variant_validate.xml
diffstat 21 files changed, 207 insertions(+), 120 deletions(-) [+]
line wrap: on
line diff
--- a/base_recalibrator.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/base_recalibrator.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_base_recalibrator" name="Base Recalibrator" version="0.0.7">
+<tool id="gatk2_base_recalibrator" name="Base Recalibrator" version="@VERSION@.0">
   <description>calculates covariates used to recalibrate base quality scores of reads</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -302,4 +303,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/depth_of_coverage.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/depth_of_coverage.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_depth_of_coverage" name="Depth of Coverage" version="0.0.7">
+<tool id="gatk2_depth_of_coverage" name="Depth of Coverage" version="@VERSION@.0">
   <description>on BAM files</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -692,7 +693,7 @@
 
 DepthOfCoverage processes a set of bam files to determine coverage at different levels of partitioning and aggregation. Coverage can be analyzed per locus, per interval, per gene, or in total; can be partitioned by sample, by read group, by technology, by center, or by library; and can be summarized by mean, median, quartiles, and/or percentage of bases covered to or beyond a threshold. Additionally, reads and bases can be filtered by mapping or base quality score. 
 
-For more information on the GATK Depth of Coverage, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_annotator_DepthOfCoverage.html&gt;`_.
+For more information on the GATK Depth of Coverage, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_coverage_DepthOfCoverage.html&gt;`_.
 
 To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
 
@@ -738,4 +739,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/gatk2_annotations.txt.sample	Tue Mar 11 07:42:09 2014 -0400
+++ b/gatk2_annotations.txt.sample	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,5 @@
 #unique_id	name	gatk_value	tools_valid_for
-#http://gatkforums.broadinstitute.org/discussion/1268/how-should-i-interpret-vcf-files-produced-by-the-gatk
-AlleleBalance	AlleleBalance	AB	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
+AlleleBalance	AlleleBalance	AlleleBalance	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 AlleleBalanceBySample	AlleleBalanceBySample	AlleleBalanceBySample	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 BaseCounts	BaseCounts	BaseCounts	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 BaseQualityRankSumTest	BaseQualityRankSumTest	BaseQualityRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
@@ -13,7 +12,6 @@
 HardyWeinberg	HardyWeinberg	HardyWeinberg	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 HomopolymerRun	HomopolymerRun	HomopolymerRun	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 InbreedingCoeff	InbreedingCoeff	InbreedingCoeff	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-IndelType	IndelType	IndelType	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator
 LowMQ	LowMQ	LowMQ	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 MVLikelihoodRatio	MVLikelihoodRatio	MVLikelihoodRatio	VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 MappingQualityRankSumTest	MappingQualityRankSumTest	MappingQualityRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
@@ -26,20 +24,3 @@
 SampleList	SampleList	SampleList	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 SnpEff	SnpEff	SnpEff	VariantAnnotator,VariantRecalibrator,HaplotypeCaller
 SpanningDeletions	SpanningDeletions	SpanningDeletions	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-VariantType	VariantType	VariantType	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-AlleleCount	Allele count in genotypes, for each ALT allele (AC)	AC	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-AlleleFrequency	Allele Frequency, for each ALT allele (AF)	AF	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-AlleleNumber	Total number of alleles in called genotypes (AN)	AN	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-Coverage	Unfiltered depth over all samples (DP)	DP	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-Dels	Dels	Dels	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator
-MQ	RMS Mapping Quality	MQ	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-MQ0	Mapping Quality Zero	MQ0	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-BaseQualityRankSumTest	BaseQualityRankSumTest	BaseQualityRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-MappingQualityRankSumTest	MappingQualityRankSumTest	MappingQualityRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-ReadPosRankSumTest	ReadPosRankSumTest	ReadPosRankSumTest	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-HaplotypeScore	HaplotypeScore	HaplotypeScore	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-QualByDepth	QualByDepth	QD	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-VQSLOD	Variant quality score recalibration	VQSLOD	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-FisherStrand	FisherStrand	FS	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-StrandBias	Strand Bias evidence (higher SB, more bias, more false positive calls)	SB	UnifiedGenotyper,VariantAnnotator,VariantRecalibrator,HaplotypeCaller
-
--- a/gatk2_macros.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/gatk2_macros.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -6,11 +6,16 @@
       <requirement type="package" version="1.56.0">picard</requirement>
       <requirement type="set_environment">GATK2_PATH</requirement>
       <requirement type="set_environment">GATK2_SITE_OPTIONS</requirement>
+      <yield />
     </requirements>
   </xml>
+  <xml name="version_command">
+    <version_command>java -jar "$GATK2_PATH/GenomeAnalysisTK.jar" --help|grep '^The Genome'</version_command>
+  </xml>
   <token name="@THREADS@">
     --num_threads \${GALAXY_SLOTS:-4}
   </token>
+  <token name="@VERSION@">2.8</token>
   <token name="@JAR_PATH@">
     java -jar "\$GATK2_PATH/GenomeAnalysisTK.jar"
   </token>
@@ -55,7 +60,7 @@
         #end for
 
         -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"'
-        
+        -p '--interval_padding "${gatk_param_type.interval_padding}"'
         -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"'
         #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE":
             -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"'
@@ -218,7 +223,9 @@
           <option value="UNION" selected="True">UNION</option>
           <option value="INTERSECTION">INTERSECTION</option>
         </param>
-        
+        <param name="interval_padding" type="integer" value="0" min="0" label="Amount of padding (in bp) to add to each interval"
+            help="This is typically used to add padding around exons when analyzing exomes. (--interval_padding / -ip)"/>
+
         <conditional name="downsampling_type">
           <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &amp;lt;downsampling_type&amp;gt;">
             <option value="NONE" selected="True">NONE</option>
@@ -296,7 +303,7 @@
         <param name="fix_misencoded_quality_scores" type="boolean" truevalue="--fix_misencoded_quality_scores" falsevalue="" label="Fix mis-encoded base quality scores. Q0 == ASCII 33 according to the SAM specification, whereas Illumina encoding starts at Q64. The idea here is simple: we just iterate over all reads and subtract 31 from every quality score." checked="False"  help="-fixMisencodedQuals / --fix_misencoded_quality_scores"/>
 
       </when>
-    </conditional>    
+    </conditional>
   </xml>
   <xml name="analysis_type_conditional">
     <conditional name="analysis_param_type">
@@ -318,6 +325,12 @@
       <option value="history">History</option>
     </param>
   </xml>
+
+  <xml name="allow_n_cigar_reads">
+    <param name="allow_n_cigar_reads" type="boolean" truevalue="-U ALLOW_N_CIGAR_READS" falsevalue="" 
+        label="Allow N in CIGAR strings" help="This is required for RNA-seq data. (-U ALLOW_N_CIGAR_READS)" />
+  </xml>
+
   <xml name="dbsnp_param">
     <conditional name="dbsnp_rod_bind_type">
       <param name="dbsnp_rod_bind_type_selector" type="select" label="Provide a dbSNP Reference-Ordered Data (ROD) file" help="-D,--dbsnp &amp;lt;dbsnp&amp;gt;">
@@ -342,4 +355,11 @@
 If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*
 
   </token>
+  <xml name="citations">
+    <citations>
+      <citation type="doi">10.1038/ng.806</citation>
+      <citation type="doi">10.1101/gr.107524.110</citation>
+      <citation type="doi">10.1002/0471250953.bi1110s43</citation>
+    </citations>
+  </xml>
 </macros>
--- a/haplotype_caller.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/haplotype_caller.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_haplotype_caller" name="Haplotype Caller" version="0.0.7">
+<tool id="gatk2_haplotype_caller" name="Haplotype Caller" version="@VERSION@.1">
   <description>Call SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -30,6 +31,7 @@
     #end if
    '
     @DBSNP_OPTIONS@
+    $allow_n_cigar_reads
     #include source=$standard_gatk_options#
     
     ##start analysis specific options
@@ -138,7 +140,8 @@
       </when>
     </conditional>
     <expand macro="dbsnp_param" />
-    
+
+    <expand macro="allow_n_cigar_reads" />
     <expand macro="gatk_param_type_conditional" />
 
     <conditional name="analysis_param_type">
@@ -320,4 +323,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/indel_realigner.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/indel_realigner.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_indel_realigner" name="Indel Realigner" version="0.0.7">
+<tool id="gatk2_indel_realigner" name="Indel Realigner" version="@VERSION@.1">
   <description>- perform local realignment</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -38,7 +39,8 @@
         #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
         -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
     #end for
-   
+
+    $allow_n_cigar_reads
     #include source=$standard_gatk_options#
     ##start analysis specific options
     -d "-targetIntervals" "${target_intervals}" "${target_intervals.ext}" "gatk_target_intervals"
@@ -110,7 +112,8 @@
     </repeat>
     <param name="lod_threshold" type="float" value="5.0" label="LOD threshold above which the realigner will proceed to realign" help="-LOD,--LODThresholdForCleaning &amp;lt;LODThresholdForCleaning&amp;gt;" />
     <param name="knowns_only" type="boolean" checked="False" truevalue="-knownsOnly" falsevalue="" label="Use only known indels provided as RODs" help="-knownsOnly"/>
-    
+
+    <expand macro="allow_n_cigar_reads" />
     <expand macro="gatk_param_type_conditional" />
     
     <expand macro="analysis_type_conditional">
@@ -206,4 +209,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/print_reads.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/print_reads.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_print_reads" name="Print Reads" version="0.0.7">
+<tool id="gatk2_print_reads" name="Print Reads" version="@VERSION@.0">
   <description>on BAM files</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -32,11 +33,6 @@
    
     #include source=$standard_gatk_options#
     
-    #if str( $reference_source.reference_source_selector ) == "history":
-        -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input"
-    #end if
-    ##end standard gatk options
-    
     ##start analysis specific options
     #if $analysis_param_type.analysis_param_type_selector == "advanced":
         -p '
@@ -202,7 +198,7 @@
 
 This walker is designed to work as the second pass in a two-pass processing step, doing a by-read traversal.  For each base in each read this walker calculates various user-specified covariates (such as read group, reported quality score, cycle, and dinuc) Using these values as a key in a large hashmap the walker calculates an empirical base quality score and overwrites the quality score currently in the read. This walker then outputs a new bam file with these updated (recalibrated) reads.  Note: This walker expects as input the recalibration table file generated previously by CovariateCounterWalker. Note: This walker is designed to be used in conjunction with CovariateCounterWalker.
 
-For more information on base quality score recalibration using the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_PrintReads.html&gt;`_.
+For more information on base quality score recalibration using the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_readutils_PrintReads.html&gt;`_.
 
 To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
 
@@ -247,4 +243,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/readme.rst	Tue Mar 11 07:42:09 2014 -0400
+++ b/readme.rst	Wed Feb 18 11:36:59 2015 -0500
@@ -63,7 +63,8 @@
 History
 =======
 
-v0.1 - Initial public release
+* v0.1      - Initial public release
+* v2.8.0    - Bugfix release, increase version number to reflect the underlying GATK version
 
 
 Licence (MIT)
--- a/realigner_target_creator.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/realigner_target_creator.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_realigner_target_creator" name="Realigner Target Creator" version="0.0.7">
+<tool id="gatk2_realigner_target_creator" name="Realigner Target Creator" version="@VERSION@.1">
   <description>for use in local realignment</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -37,7 +38,8 @@
         #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
         -d "-known:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
     #end for
-   
+
+    $allow_n_cigar_reads
     #include source=$standard_gatk_options#
     ##start analysis specific options
     #if $analysis_param_type.analysis_param_type_selector == "advanced":
@@ -97,13 +99,17 @@
           </when>
         </conditional>
     </repeat>
-    
+
+    <expand macro="allow_n_cigar_reads" />
     <expand macro="gatk_param_type_conditional" />
-    
+
     <expand macro="analysis_type_conditional">
-        <param name="windowSize" type="integer" value="10" label="Window size for calculating entropy or SNP clusters (windowSize)" help="-window,--windowSize &amp;lt;windowSize&amp;gt;" />
-        <param name="mismatchFraction" type="float" value="0.15" label="Fraction of base qualities needing to mismatch for a position to have high entropy (mismatchFraction)" help="to disable set to &lt;= 0 or &gt; 1 (-mismatch,--mismatchFraction &amp;lt;mismatchFraction&amp;gt;)"/>
-        <param name="minReadsAtLocus" type="integer" value="4" label="Minimum reads at a locus to enable using the entropy calculation (minReadsAtLocus)" help="-minReads,--minReadsAtLocus &amp;lt;minReadsAtLocus&amp;gt;" />
+        <param name="windowSize" type="integer" value="10" label="Window size for calculating entropy or SNP clusters (windowSize)" 
+            help="-window,--windowSize &amp;lt;windowSize&amp;gt;" />
+        <param name="mismatchFraction" type="float" value="0.15" label="Fraction of base qualities needing to mismatch for a position to have high entropy (mismatchFraction)" 
+            help="to disable set to &lt;= 0 or &gt; 1 (-mismatch,--mismatchFraction &amp;lt;mismatchFraction&amp;gt;)"/>
+        <param name="minReadsAtLocus" type="integer" value="4" label="Minimum reads at a locus to enable using the entropy calculation (minReadsAtLocus)" 
+            help="-minReads,--minReadsAtLocus &amp;lt;minReadsAtLocus&amp;gt;" />
         <param name="maxIntervalSize" type="integer" value="500" label="Maximum interval size" help="-maxInterval,--maxIntervalSize &amp;lt;maxIntervalSize&amp;gt;" />
     </expand>
   </inputs>
@@ -164,4 +170,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/reduce_reads.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/reduce_reads.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_reduce_reads" name="Reduce Reads" version="0.0.7">
+<tool id="gatk2_reduce_reads" name="Reduce Reads" version="@VERSION@.0">
   <description>in BAM files</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -154,7 +155,7 @@
 
 This walker will generated reduced versions of the BAM files that still follow the BAM spec and contain all the information necessary for the GSA variant calling pipeline. Some options allow you to tune in how much compression you want to achieve. The default values have been shown to reduce a typical whole exome BAM file 100x. The higher the coverage, the bigger the savings in file size and performance of the downstream tools.
 
-For more information on using read based compression in the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_compression_reducereads_ReduceReads.html&gt;`_.
+.. For more information on using read based compression in the GATK, see this `tool specific page &lt;http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_gatk_walkers_compression_reducereads_ReduceReads.html&gt;`_.
 
 To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gatk/guide/topic?name=best-practices&gt;`_.
 
@@ -223,4 +224,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Wed Feb 18 11:36:59 2015 -0500
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
--- a/tool_dependencies.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/tool_dependencies.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -15,38 +15,12 @@
     </set_environment>
 
     <package name="samtools" version="0.1.19">
-        <repository changeset_revision="9f412e12b103" name="package_samtools_0_1_19" owner="iuc" toolshed="http://testtoolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="8b98841b6b2f" name="package_samtools_0_1_19" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
     </package>
     <package name="picard" version="1.56.0">
-        <repository changeset_revision="7206dbf34dcd" name="package_picard_1_56_0" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="7206dbf34dcd" name="package_picard_1_56_0" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
     </package>
-
-    <package name="gatk2_r_dependencies" version="2.8">
-        <install version="1.0">
-            <actions>
-                <action type="setup_r_environment">
-
-                    <repository changeset_revision="2c0a13200a73" name="package_r_2_11_0" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu">
-                        <package name="R" version="2.11.0" />
-                    </repository>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/colorspace_1.2-4.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/stringr_0.6.2.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/RColorBrewer_1.0-5.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/dichromat_2.0-0.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/munsell_0.4.2.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/labeling_0.2.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/plyr_1.8.1.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/digest_0.6.4.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/gtable_0.1.2.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/reshape2_1.2.2.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/scales_0.2.3.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/proto_0.3-10.tar.gz</package>
-                        <package>https://github.com/bgruening/download_store/raw/master/gatk2_R_deps/ggplot2_0.9.3.1.tar.gz</package>
-                </action>
-            </actions>
-        </install>
-        <readme>
-            R depencies for GATK2.
-        </readme>
+    <package name="ggplot2" version="0.9.3">
+        <repository changeset_revision="ade406d47752" name="package_r_ggplot2_0_9_3" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>
--- a/unified_genotyper.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/unified_genotyper.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_unified_genotyper" name="Unified Genotyper" version="0.0.7">
+<tool id="gatk2_unified_genotyper" name="Unified Genotyper" version="@VERSION@.1">
   <description>SNP and indel caller</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -32,7 +33,7 @@
     --standard_min_confidence_threshold_for_emitting "${standard_min_confidence_threshold_for_emitting}"
    '
     @DBSNP_OPTIONS@
-
+    $allow_n_cigar_reads
     #include source=$standard_gatk_options#
     ##start analysis specific options
     #if $analysis_param_type.analysis_param_type_selector == "advanced":
@@ -72,7 +73,6 @@
                 --excludeAnnotation "${annotation}"
             #end for
         #end if
-        ${analysis_param_type.multiallelic}
         #if str( $analysis_param_type.sample_ploidy ) != '':
           --sample_ploidy "$analysis_param_type.sample_ploidy"
         #end if
@@ -121,12 +121,14 @@
     <param name="standard_min_confidence_threshold_for_calling" type="float" value="30.0" label="The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be called" help="-stand_call_conf,--standard_min_confidence_threshold_for_calling &amp;lt;standard_min_confidence_threshold_for_calling&amp;gt;" />
     <param name="standard_min_confidence_threshold_for_emitting" type="float" value="30.0" label="The minimum phred-scaled confidence threshold at which variants not at 'trigger' track sites should be emitted (and filtered if less than the calling threshold)" help="-stand_emit_conf,--standard_min_confidence_threshold_for_emitting &amp;lt;standard_min_confidence_threshold_for_emitting&amp;gt;" />
 
-    
+    <expand macro="allow_n_cigar_reads" />
     <expand macro="gatk_param_type_conditional" />
     
     <expand macro="analysis_type_conditional">
-        <param name="heterozygosity" type="float" value="1e-3" label="Heterozygosity value used to compute prior likelihoods for any locus" help="-hets,--heterozygosity &amp;lt;heterozygosity&amp;gt;" />
-        <param name="pcr_error_rate" type="float" value="1e-4" label="The PCR error rate to be used for computing fragment-based likelihoods" help="-pcr_error,--pcr_error_rate &amp;lt;pcr_error_rate&amp;gt;" />
+        <param name="heterozygosity" type="float" value="1e-3" label="Heterozygosity value used to compute prior likelihoods for any locus" 
+            help="-hets,--heterozygosity &amp;lt;heterozygosity&amp;gt;" />
+        <param name="pcr_error_rate" type="float" value="1e-4" label="The PCR error rate to be used for computing fragment-based likelihoods" 
+            help="-pcr_error,--pcr_error_rate &amp;lt;pcr_error_rate&amp;gt;" />
         <conditional name="genotyping_mode_type">
           <param name="genotyping_mode" type="select" label="How to determine the alternate allele to use for genotyping" help="-gt_mode,--genotyping_mode &amp;lt;genotyping_mode&amp;gt;">
             <option value="DISCOVERY" selected="True">DISCOVERY</option>
@@ -192,14 +194,16 @@
             <!-- <option value="none">none</option> -->
         </param>
     <!--     <param name="family_string" type="text" value="" label="Family String"/> -->
-        <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" help="-XA,--excludeAnnotation &amp;lt;excludeAnnotation&amp;gt;" >
+        <param name="exclude_annotations" type="select" multiple="True" display="checkboxes" label="Annotations to exclude" 
+            help="-XA,--excludeAnnotation &amp;lt;excludeAnnotation&amp;gt;" >
           <!-- load the available annotations from an external configuration file, since additional ones can be added to local installs -->
           <options from_data_table="gatk2_annotations">
             <filter type="multiple_splitter" column="tools_valid_for" separator=","/>
             <filter type="static_value" value="UnifiedGenotyper" column="tools_valid_for"/>
           </options>
         </param>
-        <param name="multiallelic" type="boolean" truevalue="--multiallelic" falsevalue="" label="Allow the discovery of multiple alleles (SNPs only)" help="--multiallelic" />
+        <param name="sample_ploidy" type="integer" value="2" 
+            label="Ploidy (number of chromosomes) per sample. For pooled data, set to (Number of samples in each pool * Sample Ploidy)" help="-ploidy,--sample_ploidy" />
     </expand>
   </inputs>
   <outputs>
@@ -294,4 +298,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_annotator.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_annotator.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_annotator" name="Variant Annotator" version="0.0.7">
+<tool id="gatk2_variant_annotator" name="Variant Annotator" version="@VERSION@.0">
   <description></description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -244,4 +245,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_apply_recalibration.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_apply_recalibration.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_apply_recalibration" name="Apply Variant Recalibration" version="0.0.7">
+<tool id="gatk2_variant_apply_recalibration" name="Apply Variant Recalibration" version="@VERSION@.0">
   <description></description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -135,4 +136,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_combine.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_combine.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_combine" name="Combine Variants" version="0.0.7">
+<tool id="gatk2_variant_combine" name="Combine Variants" version="@VERSION@.0">
   <description></description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -167,4 +168,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_eval.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_eval.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_eval" name="Eval Variants" version="0.0.7">
+<tool id="gatk2_variant_eval" name="Eval Variants" version="@VERSION@.0">
   <description></description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -80,10 +81,6 @@
         
         --minPhaseQuality "${analysis_param_type.min_phase_quality}"
         
-        #if str( $analysis_param_type.family ):
-            --family_structure "${analysis_param_type.family}"
-        #end if
-        
         --mendelianViolationQualThreshold "${analysis_param_type.mendelian_violation_qual_threshold}"
         
         #if str( $analysis_param_type.ancestral_alignments ) != "None":
@@ -165,9 +162,8 @@
         </repeat>
         
         <param name="stratification_modules" type="select" multiple="True" display="checkboxes" label="Stratification modules to apply to the eval track(s)" help="-ST,--stratificationModule &amp;lt;stratificationModule&amp;gt;" >
-          <!-- do these need individual options also? gatk wiki has little info -->
+          <option value="AlleleCount" />
           <option value="AlleleFrequency" />
-          <option value="AlleleCount" />
           <option value="CompRod" />
           <option value="Contig" />
           <option value="CpG" />
@@ -175,9 +171,15 @@
           <option value="EvalRod" />
           <option value="Filter" />
           <option value="FunctionalClass" />
+          <option value="IndelSize" />
+          <option value="IntervalStratification" />
           <option value="JexlExpression" />
+          <option value="Novelty" />
+          <option value="OneBPIndel" />
           <option value="Sample" />
-          <option value="IntervalStratification" />
+          <option value="SnpEffPositionModifier" />
+          <option value="TandemRepeat" />
+          <option value="VariantType" />
         </param>
         <param name="do_not_use_all_standard_stratifications" checked="false" type="boolean" truevalue="--doNotUseAllStandardStratifications" falsevalue="" label="Do not use the standard stratification modules by default" help="-noST,--doNotUseAllStandardStratifications" />
         
@@ -186,29 +188,22 @@
         </repeat>
         
         <param name="eval_modules" type="select" multiple="True" display="checkboxes" label="Eval modules to apply to the eval track(s)" help="-EV,--evalModule &amp;lt;evalModule&amp;gt;" >
-          <!-- do these need individual options also? gatk wiki has little info -->
-          <option value="ACTransitionTable" />
-          <option value="AlleleFrequencyComparison" />
-          <option value="AminoAcidTransition" />
           <option value="CompOverlap" />
           <option value="CountVariants" />
-          <option value="GenotypeConcordance" />
-          <option value="GenotypePhasingEvaluator" />
-          <option value="IndelMetricsByAC" />
-          <option value="IndelStatistics" />
+          <option value="IndelLengthHistogram" />
+          <option value="IndelSummary" />
           <option value="MendelianViolationEvaluator" />
+          <option value="MultiallelicSummary" />
           <option value="PrintMissingComp" />
-          <option value="PrivatePermutations" />
-          <option value="SimpleMetricsByAC" />
           <option value="ThetaVariantEvaluator" />
           <option value="TiTvVariantEvaluator" />
-          <option value="VariantQualityScore" />
+          <option value="ValidationReport" />
+          <option value="VariantSummary" />
         </param>
         <param name="do_not_use_all_standard_modules" checked="false" type="boolean" truevalue="--doNotUseAllStandardModules" falsevalue="" label="Do not use the standard eval modules by default" help="-noEV,--doNotUseAllStandardModules" />
         
         <param name="num_samples" type="integer" label="Number of samples (used if no samples are available in the VCF file" value="0" help="-ns,--numSamples &amp;lt;numSamples&amp;gt;"/>
         <param name="min_phase_quality" type="float" label="Minimum phasing quality " value="10.0" help="-mpq,--minPhaseQuality &amp;lt;minPhaseQuality&amp;gt;"/>
-        <param name="family" type="text" value="" label="If provided, genotypes in will be examined for mendelian violations: this argument is a string formatted as dad+mom=child where these parameters determine which sample names are examined" help="--family_structure"/>
         <param name="mendelian_violation_qual_threshold" type="integer" label="Minimum genotype QUAL score for each trio member required to accept a site as a violation" value="50" help="-mvq,--mendelianViolationQualThreshold &amp;lt;mendelianViolationQualThreshold&amp;gt;"/>
         <param name="ancestral_alignments" type="data" format="fasta" optional="True" label="Fasta file with ancestral alleles" help="-aa,--ancestralAlignments &amp;lt;ancestralAlignments&amp;gt;" />
         <param name="known_cnvs" type="data" format="bed,gatk_interval,picard_interval_list" optional="True" label="File containing tribble-readable features describing a known list of copy number variants" help="-knownCNVs,--knownCNVs &amp;lt;knownCNVs&amp;gt;" />
@@ -280,10 +275,10 @@
  doNotUseAllStandardModules            Do not use the standard modules by default (instead, only those that are specified with the -E option)
  numSamples                            Number of samples (used if no samples are available in the VCF file
  minPhaseQuality                       Minimum phasing quality
- family_structure                      If provided, genotypes in will be examined for mendelian violations: this argument is a string formatted as dad+mom=child where these parameters determine which sample names are examined
  mendelianViolationQualThreshold       Minimum genotype QUAL score for each trio member required to accept a site as a violation
  ancestralAlignments                   Fasta file with ancestral alleles
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_filtration.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_filtration.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_filtration" name="Variant Filtration" version="0.0.7">
+<tool id="gatk2_variant_filtration" name="Variant Filtration" version="@VERSION@.0">
   <description>on VCF files</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -177,4 +178,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_recalibrator.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_recalibrator.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,9 @@
-<tool id="gatk2_variant_recalibrator" name="Variant Recalibrator" version="0.0.7">
+<tool id="gatk2_variant_recalibrator" name="Variant Recalibrator" version="@VERSION@.0">
   <description></description>
-  <expand macro="requirements" />
+  <expand macro="requirements">
+    <requirement type="package" version="0.9.3">ggplot2</requirement>
+  </expand>
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -110,7 +113,7 @@
       </when>
     </conditional>
     
-    <repeat name="rod_bind" title="Binding for reference-ordered data" help="-resource,--resource &amp;lt;resource&amp;gt;" min="1">
+    <repeat name="rod_bind" title="Binding for reference-ordered data" help="-resource,--resource &amp;lt;resource&amp;gt;" min="2">
         <conditional name="rod_bind_type">
           <param name="rod_bind_type_selector" type="select" label="Binding Type">
             <option value="dbsnp" selected="True">dbSNP</option>
@@ -329,8 +332,7 @@
         <param name="prior_counts" type="float" label="number of prior counts to use in variational Bayes algorithm" value="20.0" help="-priorCounts,--priorCounts &amp;lt;priorCounts&amp;gt;"/>
         <!--<param name="trustAllPolymorphic" type="boolean" label="trustAllPolymorphic" truevalue="-/-trustAllPolymorphic=true" falsevalue="-/-trustAllPolymorphic=false"
             help="Trust that all the input training sets' unfiltered records contain only polymorphic sites to drastically speed up the computation. -trustAllPolymorphic" />-->
-
-        <param name="min_num_bad_variants" type="integer" label="minimum amount of worst scoring variants to use when building the Gaussian mixture model of bad variants. Will override -percentBad arugment if necessary" value="1000" help="-minNumBad,--minNumBadVariants &amp;lt;minNumBadVariants&amp;gt;"/>
+        <param name="min_num_bad_variants" type="integer" label="Minimum number of worst scoring variants to use when building the Gaussian mixture model of bad variants" value="1000" help="--minNumBadVariants &amp;lt;minNumBadVariants&amp;gt;"/>
         <param name="target_titv" type="float" label="expected novel Ti/Tv ratio to use when calculating FDR tranches and for display on optimization curve output figures. (approx 2.15 for whole genome experiments). ONLY USED FOR PLOTTING PURPOSES!" value="2.15" help="-titv,--target_titv &amp;lt;target_titv&amp;gt;"/>
         <param name="ts_tranche" type="text" label="levels of novel false discovery rate (FDR, implied by ti/tv) at which to slice the data. (in percent, that is 1.0 for 1 percent)" value="100.0, 99.9, 99.0, 90.0" help="-tranche,--TStranche &amp;lt;TStranche&amp;gt;"/>
         <repeat name="ignore_filters" title="Ignore Filter" help="-ignoreFilter,--ignore_filter &amp;lt;ignore_filter&amp;gt;">
@@ -399,8 +401,7 @@
  shrinkage             The shrinkage parameter in variational Bayes algorithm.
  dirichlet             The dirichlet parameter in variational Bayes algorithm.
  priorCounts           The number of prior counts to use in variational Bayes algorithm.
- percentBadVariants    What percentage of the worst scoring variants to use when building the Gaussian mixture model of bad variants. 0.07 means bottom 7 percent.
- minNumBadVariants     The minimum amount of worst scoring variants to use when building the Gaussian mixture model of bad variants. Will override -percentBad arugment if necessary.
+ minNumBadVariants     The minimum amount of worst scoring variants to use when building the Gaussian mixture model of bad variants.
  recal_file            The output recal file used by ApplyRecalibration
  target_titv           The expected novel Ti/Tv ratio to use when calculating FDR tranches and for display on optimization curve output figures. (approx 2.15 for whole genome experiments). ONLY USED FOR PLOTTING PURPOSES!
  TStranche             The levels of novel false discovery rate (FDR, implied by ti/tv) at which to slice the data. (in percent, that is 1.0 for 1 percent)
@@ -411,4 +412,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_select.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_select.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_select" name="Select Variants" version="0.0.7">
+<tool id="gatk2_variant_select" name="Select Variants" version="@VERSION@.0">
   <description>from VCF files</description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -285,4 +286,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>
--- a/variant_validate.xml	Tue Mar 11 07:42:09 2014 -0400
+++ b/variant_validate.xml	Wed Feb 18 11:36:59 2015 -0500
@@ -1,6 +1,7 @@
-<tool id="gatk2_variant_validate" name="Validate Variants" version="0.0.7">
+<tool id="gatk2_variant_validate" name="Validate Variants" version="@VERSION@.0">
   <description></description>
   <expand macro="requirements" />
+  <expand macro="version_command" />
   <macros>
     <import>gatk2_macros.xml</import>
   </macros>
@@ -101,4 +102,5 @@
 
 @CITATION_SECTION@
   </help>
+  <expand macro="citations" />
 </tool>