Mercurial > repos > iuc > bedtools
changeset 38:3f852f713d24 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bedtools commit 0346e504b5f0aa94215279203beb09b767ada32c
author | iuc |
---|---|
date | Sun, 21 Jan 2018 07:16:59 -0500 |
parents | 7f4f9bb165c9 |
children | da6d7bc0a8b0 |
files | nucBed.xml test-data/nucBed_result3.bed |
diffstat | 2 files changed, 24 insertions(+), 12 deletions(-) [+] |
line wrap: on
line diff
--- a/nucBed.xml Wed Jan 10 19:30:34 2018 -0500 +++ b/nucBed.xml Sun Jan 21 07:16:59 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_nucbed" name="NucBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_nucbed" name="NucBed" version="@WRAPPER_VERSION@.1"> <description>profile the nucleotide content of intervals in a FASTA file</description> <macros> <import>macros.xml</import> @@ -8,10 +8,12 @@ <command> <![CDATA[ bedtools nuc - $strand + $s $seq - $pattern - $case + #if str($pattern): + -pattern '$pattern' + $C + #end if -fi '$fasta' -bed '$input' > '$output' @@ -21,14 +23,15 @@ <param format="bed,vcf,gff,gff3" name="input" type="data" label="BED/VCF/GFF file"/> <param format="fasta" name="fasta" type="data" label="FASTA file"/> - <param name="strand" type="boolean" checked="false" truevalue="-s" falsevalue="" - label="Profile the sequence according to strand" help="(-s)"/> - <param name="seq" type="boolean" checked="false" truevalue="-seq" falsevalue="" - label="Print the extracted sequence" help="(-seq)"/> - <param name="pattern" type="boolean" checked="false" truevalue="-pattern" falsevalue="" - label="Report the number of times a user-defined sequence is observed" help="case-sensitive (-pattern)" /> - <param name="case" type="boolean" checked="false" truevalue="-C" falsevalue="" - label="Ignore case when matching -pattern" help="(-C)"/> + <param argument="-s" type="boolean" checked="false" truevalue="-s" falsevalue="" + label="Profile the sequence according to strand" /> + <param argument="-seq" type="boolean" checked="false" truevalue="-seq" falsevalue="" + label="Print the extracted sequence" /> + <param argument="-pattern" type="text" label="Report the number of times a user-defined sequence is observed" help="Case-sensitive by default"> + <validator type="regex" message="Sequence should only contain letters.">^[A-Za-z]*$</validator> + </param> + <param argument="-C" type="boolean" checked="false" truevalue="-C" falsevalue="" + label="Ignore case when matching -pattern"/> </inputs> <outputs> <data format="tabular" name="output" /> @@ -45,6 +48,13 @@ <param name="seq" value="True" /> <output name="output" file="nucBed_result2.bed" ftype="tabular" /> </test> + <test> + <param name="input" value="nucBed1.bed" ftype="bed" /> + <param name="fasta" value="nucBed1.fasta" ftype="fasta" /> + <param name="seq" value="True" /> + <param name="pattern" value="TAC" /> + <output name="output" file="nucBed_result3.bed" ftype="tabular" /> + </test> </tests> <help> <![CDATA[
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/nucBed_result3.bed Sun Jan 21 07:16:59 2018 -0500 @@ -0,0 +1,2 @@ +#1_usercol 2_usercol 3_usercol 4_pct_at 5_pct_gc 6_num_A 7_num_C 8_num_G 9_num_T 10_num_N 11_num_oth 12_seq_len 13_seq 14_user_patt_count +chr1 10 100 0.588889 0.411111 19 16 21 34 0 0 90 TTCTTACCTATTAGTGGTTGAACATCGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTTGTTGTCGATAGAACTTCATGTGCCTGTA 1