Mercurial > repos > erinija > dnp_subset_dinuc_profile
view dnp_subset_dinuc_profile.xml @ 0:7515ecc808b5 draft default tip
"planemo upload commit 1a32efb8343938e8d49190003f251c78b5a58225-dirty"
author | erinija |
---|---|
date | Fri, 01 May 2020 12:11:00 +0000 |
parents | |
children |
line wrap: on
line source
<tool id="dnp_subset_dinuc_profile" name="Dinucleotide frequencies" version="0.1.0"> <requirements> <requirement type="package" version="1.0">dnp-diprofile</requirement> </requirements> <command detect_errors="exit_code" interpreter="sh"><![CDATA[ dnp-subset-dinuc-profile.sh "$input1" "$input2" "$output1" ]]></command> <inputs> <param type="data" name="input1" format="fasta" label="From fasta" /> <param type="text" name="input2" value="AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT" label="Dinucleotides" /> </inputs> <outputs> <data name="output1" format="tabular" /> </outputs> <tests> <test> <param name="input1" value="diprofile-input.fasta"/> <param name="input2" value="AA AC AG AT CA CC CG CT GA GC GG GT TA TC TG TT"/> <output name="output1" file="diprofile-output.tabular"/> </test> </tests> <help><![CDATA[ Description:: Compute positional profiles of dinucleotide frequency of occurrences on forward and its complementary sequences in a batch of aligned fasta sequences. Output columns are labeled by AA.f, AA.r ... where .f extension means forward and .r means complementary. Example:: Input fasta lines: >chr9:42475963-42476182 CCAGGCAGACCCCATATTCAAGCTGCTGCCCCAGGGTGGTGTACAGATCTGGGGAGAAGAAGGATGA >chr9:42476175-42476394 TCTGCACTCCAGCATGCCTGAGGAGAGGAGGGAATGCAGGATCCTAGTGGAAAGAGTACCAAGCTGG Output tabular: AA.f AA.r AC.f AC.r ... 0.076000 0.059000 0.065000 0.078000 ... 0.082000 0.060000 0.057000 0.076000 ... 0.067000 0.075000 0.049000 0.071000 ... ]]></help> <citations> <citation type="bibtex"> @article{pranckeviciene2020nucleosome, title={Nucleosome positioning sequence patterns as packing or regulatory. S1 Appendix}, author={Pranckeviciene, Erinija and Hosid, Sergey and Liang, Nathan and Ioshikhes, Ilya}, journal={PLoS computational biology}, volume={16}, number={1}, pages={e1007365}, year={2020}, publisher={Public Library of Science}, url = {https://doi.org/10.1371/journal.pcbi.1007365} }</citation> </citations> </tool>