Mercurial > repos > drosofff > yet_another_clipper

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/yac.fastq	Sat May 17 18:41:24 2014 -0400
@@ -0,0 +1,40 @@
+@SRR290479.1 HWI-EAS285:2:1:66:28/1
+TGTAAACATCCCCGACTGGCAGCATNTCGTATGCCG
++
+B@BBCBCCBCBCCC8A<@##################
+@SRR290479.2 HWI-EAS285:2:1:67:348/1
+AAAGTGCTACTACTTTTGAGTCTATNTCGTACGCCG
++
+BAA@7?A@@A@@B<'25?6>59:;7#<?########
+@SRR290479.3 HWI-EAS285:2:1:68:826/1
+TAGCTTATCAGACTGATGTTGACACNTCGTATGCCG
++
+BB@BBCCBCCBBB:%%83/>B7@44#;;324'117?
+@SRR290479.4 HWI-EAS285:2:1:68:65/1
+ACTGGACTTGGAGTCCGAAGGCATCNCGTATTCCGT
++
+BBB@@ABAAB?9B42&9;##################
+@SRR290479.5 HWI-EAS285:2:1:69:594/1
+AAGTGCCGCCAGGTTTTGAGTGGATNTCGTATGGCG
++
+AB?5;3>/=?>=;416481#################
+@SRR290479.6 HWI-EAS285:2:1:70:700/1
+TATTGCACTTGTCCCGGCCTGAATCNCGTATCCCGT
++
+BCB=:ACCBB=>BB8<-###################
+@SRR290479.7 HWI-EAS285:2:1:70:1679/1
+TGGTAGACTATGGAACGTAGGATCTNGCATGCCGCC
++
+BCBBCCBCCCBCCA?AB>:B@><>############
+@SRR290479.8 HWI-EAS285:2:1:71:1400/1
+AGTGGTAGAGCATTTGAATCTCGTANGCCGTCTTCT
++
+7@BC>>@55CCBCA3CBA14B.A16#*;9359B###
+@SRR290479.9 HWI-EAS285:2:1:71:795/1
+TAGCTTATCAGACTGATGTTGACATNTCGTACGCCG
++
+BBBBBCBBCB;>AA',9=18?1:7:#<;57######
+@SRR290479.10 HWI-EAS285:2:1:71:596/1
+TTTGGCAATGGTAGAACTCCCACACNTCGTAGGCCG
++
+B@B>7>9A@<46B@79972#################
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/yac.out	Sat May 17 18:41:24 2014 -0400
@@ -0,0 +1,12 @@
+>1
+TGTAAACATCCCCGACTGGCAGC
+>2
+AAAGTGCTACTACTTTTGAGTCT
+>3
+ACTGGACTTGGAGTCCGAAGGC
+>4
+AAGTGCCGCCAGGTTTTGAGTGG
+>5
+TATTGCACTTGTCCCGGCCTGAATCNCGT
+>6
+TAGCTTATCAGACTGATGTTGAC
--- a/yac.py	Sat May 17 18:22:46 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,78 +0,0 @@
-#!/usr/bin/python
-# yac = yet another clipper
-# v 0.9.1
-# Usage yac.py  $input $output $adapter_to_clip $min $max $Nmode
-# Christophe Antoniewski <drosofff@gmail.com>
-
-import sys, string
-
-class Clip:
-  def __init__(self, inputfile, outputfile, adapter, minsize, maxsize):
-    self.inputfile = inputfile
-    self.outputfile = outputfile
-    self.adapter = adapter
-    self.minsize = int(minsize)
-    self.maxsize = int(maxsize)
-    def motives (sequence):
-      '''return a list of motives for perfect (6nt) or imperfect (7nt with one mismatch) search on import string module'''
-      sequencevariants = [sequence[0:6]] # initializes the list with the 6mer perfect match
-      dicsubst= {"A":"TGCN", "T":"AGCN", "G":"TACN", "C":"GATN"}
-      for pos in enumerate(sequence[:6]):
-        for subst in dicsubst[pos[1]]:
-          sequencevariants.append(sequence[:pos[0]]+ subst + sequence[pos[0]+1:7])
-      return sequencevariants
-    self.adaptmotifs= motives(self.adapter)
-
-  def scanadapt(self, adaptmotives=[], sequence=""):
-    if sequence.rfind(adaptmotives[0]) != -1:
-      return sequence[:sequence.rfind(adaptmotives[0])]
-    for motif in adaptmotives[1:]:
-      if sequence.rfind(motif) != -1:
-        return sequence[:sequence.rfind(motif)]
-    return sequence
-
-  def clip_with_N (self):
-    iterator = 0
-    id = 0
-    F = open (self.inputfile, "r")
-    O = open (self.outputfile, "w")
-    for line in F:
-      iterator += 1
-      if iterator % 4 == 2:
-        trim = self.scanadapt (self.adaptmotifs, line.rstrip() )
-        if self.minsize <= len(trim) <= self.maxsize:
-          id += 1
-          print >> O, ">%i\n%s" % (id, trim)
-    F.close()
-    O.close()
-  def clip_without_N (self):
-    iterator = 0
-    id = 0
-    F = open (self.inputfile, "r")
-    O = open (self.outputfile, "w")
-    for line in F:
-      iterator += 1
-      if iterator % 4 == 2:
-        trim = self.scanadapt (self.adaptmotifs, line.rstrip() )
-        if "N" in trim: continue
-        if self.minsize <= len(trim) <= self.maxsize:
-          id += 1
-          print >> O, ">%i\n%s" % (id, trim)
-    F.close()
-    O.close()
-
-def __main__ (inputfile, outputfile, adapter, minsize, maxsize, Nmode):
-  instanceClip = Clip (inputfile, outputfile, adapter, minsize, maxsize)
-  if Nmode == "accepted":
-    instanceClip.clip_with_N()
-  else:
-    instanceClip.clip_without_N()
-
-if __name__ == "__main__" :
-  input = sys.argv[1]
-  output = sys.argv[2]
-  adapter = sys.argv[3]
-  minsize = sys.argv[4]
-  maxsize = sys.argv[5]
-  Nmode = sys.argv[6]
-  __main__(input, output, adapter, minsize, maxsize, Nmode)
--- a/yac.xml	Sat May 17 18:22:46 2014 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,58 +0,0 @@
- <tool id="yac" name="Clip adapter">
-  <description></description>
-  <command interpreter="python">yac.py $input $output $clip_source.clip_sequence $min $max $Nmode</command>
-  <inputs>
-    <param format="fastq" name="input" type="data" label="Source file"/>
-    <param name="min" type="integer" size="4" value="15" label="min size"/>
-    <param name="max" type="integer" size="4" value="36" label="max size"/>
-    <param name="Nmode" type="select" label="Reads containing Nst">
-        <option value="accepted" selected="True">Accepted</option>
-        <option value="rejected">Rejected</option>
-    </param>
-    <conditional name="clip_source">
-   	 <param name="clip_source_list" type="select" label="Source" help="Built-in adapters or User-provided">
-         	<option value="prebuilt" selected="True">Use a built-in adapter (select from the list below)</option>
-         	<option value="user">Use custom sequence</option>
-         </param>
-         <when value="prebuilt">
-         	<param name="clip_sequence" type="select" label="Select Adapter to clip" help="if your adapter is not listed, input your own sequence">
-                	<option value="TCGTATGCCGTCTTCTGCTTG">Solexa TCGTATGCCGTCTTCTGCTTG</option>
-                        <option value="ATCTCGTATGCCGTCTTCTGCTT">Illumina ATCTCGTATGCCGTCTTCTGCTT</option>
-                        <option value="TGGAATTCTCGGGTGCCAAG" selected="True">Illumina TruSeq  TGGAATTCTCGGGTGCCAAG</option>
-                        <option value="CTGTAGGCACCATCAATCGT">IdT CTGTAGGCACCATCAATCGT</option>
-		</param>
-	</when>
-        <when value="user">
-		 <param name="clip_sequence" type="text" size="35"  label="Enter your Sequence" value="GAATCC"/>
-	</when>
-    </conditional>
-  </inputs>
-  <outputs>
-    <data format="fasta" name="output"  metadata="input" />
-  </outputs>
-
-  <help>
-<!-- write a decent doc ! -->
-This tool clips adapter sequences from a fastq file and fasta file of clipped reads with renumbered fasta headers.
-
-Clipped sequences with Ns can be discarded.
-
-Min size and max size filter clipped reads on their size.
-
-Note that unclipped reads that satisfy the min and max size conditions are kept.
-  </help>
-
-<!-- write a <test> section -->
-	<tests>
-                <test>
-                        <param name="input" value="yac.fastq" ftype="fastqsanger"/>
-                        <param name="min" value="18" />
-                        <param name="max" value="29" />
-                        <param name="clip_source_list" value="prebuilt" />
-                        <param name="clip_sequence" value="ATCTCGTATGCCGTCTTCTGCTT" />
-                        <param name="Nmode" value="accepted" />
-                        <output name="output" file="yac.out" />
-                </test>
-        </tests>
-
-</tool>