Mercurial > repos > drosofff > bowtie_for_smallrna

changeset 0:324c3142ca0f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author drosofff
date Mon, 19 May 2014 17:33:06 -0400
parents
children f7b9ce3a5470
files sRbowtie/sRbowtie.py sRbowtie/sRbowtie.xml sRbowtie/test-data/sRbowtie.fa sRbowtie/test-data/sRbowtie.out
diffstat 4 files changed, 346 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sRbowtie/sRbowtie.py	Mon May 19 17:33:06 2014 -0400
@@ -0,0 +1,109 @@
+#!/usr/bin/env python
+# small RNA oriented bowtie wrapper
+# version 1 19-5-2014
+# Usage sRbowtie.py <1 input_fasta_file> <2 alignment method> <3 -v mismatches> <4 out_type> <5 buildIndexIfHistory> <6 fasta/bowtie index> <7 bowtie output> <8 ali_fasta> <9 unali_fasta> <10 --num-threads \${GALAXY_SLOTS:-4}>
+# To Do:
+# implement number of bowtie processes as a Galaxy env variable
+# implement an arg parser
+# Christophe Antoniewski <drosofff@gmail.com>
+
+import sys, os, subprocess, tempfile, shutil
+
+def stop_err( msg ):
+    sys.stderr.write( '%s\n' % msg )
+    sys.exit()
+
+def bowtieCommandLiner (alignment_method, v_mis, out_type, aligned, unaligned, input, index, output, pslots="12"):
+    if alignment_method=="RNA":
+        x = "-v %s -M 1 --best --strata -p %s --norc --suppress 2,6,7,8" % (v_mis, pslots)
+    elif alignment_method=="unique":
+        x =  "-v %s -m 1 -p %s --suppress 6,7,8" % (v_mis, pslots)
+    elif  alignment_method=="multiple":
+        x = "-v %s -M 1 --best --strata -p %s --suppress 6,7,8" % (v_mis, pslots)
+    elif alignment_method=="k_option":
+        x = "-v %s -k 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots)
+    elif alignment_method=="n_option":
+        x = "-n %s -M 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots)
+    elif alignment_method=="a_option":
+        x = "-v %s -a --best -p %s --suppress 6,7,8" % (v_mis, pslots)
+    if aligned == "None" and unaligned == "None": fasta_command = ""
+    elif aligned != "None" and unaligned == "None": fasta_command= " --al %s" % aligned
+    elif aligned == "None" and unaligned != "None": fasta_command = " --un %s" % unaligned
+    else: fasta_command = " --al %s --un %s" % (aligned, unaligned)
+    x = x + fasta_command
+    if out_type == "tabular":
+        return "bowtie %s %s -f %s > %s" % (x, index, input, output)
+    elif out_type=="sam":
+        return "bowtie %s -S %s -f %s > %s" % (x, index, input, output)
+    elif out_type=="bam":
+        return "bowtie %s -S %s -f %s |samtools view -bS - > %s" % (x, index, input, output)
+
+def bowtie_squash(fasta):
+  tmp_index_dir = tempfile.mkdtemp() # make temp directory for bowtie indexes
+  ref_file = tempfile.NamedTemporaryFile( dir=tmp_index_dir )
+  ref_file_name = ref_file.name
+  ref_file.close() # by default, delete the temporary file, but ref_file.name is now stored in ref_file_name
+  os.symlink( fasta, ref_file_name ) # symlink between the fasta source file and the deleted ref_file name
+  cmd1 = 'bowtie-build -f %s %s' % (ref_file_name, ref_file_name ) # bowtie command line, which will work after changing dir (cwd=tmp_index_dir)
+  try:
+    FNULL = open(os.devnull, 'w')
+    tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name # a path string for a temp file in tmp_index_dir. Just a string
+    tmp_stderr = open( tmp, 'wb' ) # creates and open a file handler pointing to the temp file
+    proc = subprocess.Popen( args=cmd1, shell=True, cwd=tmp_index_dir, stderr=FNULL, stdout=FNULL ) # both stderr and stdout of bowtie-build are redirected in  dev/null
+    returncode = proc.wait()
+    tmp_stderr.close()
+    FNULL.close()
+    sys.stdout.write(cmd1 + "\n")
+  except Exception, e:
+    # clean up temp dir
+    if os.path.exists( tmp_index_dir ):
+      shutil.rmtree( tmp_index_dir )
+      stop_err( 'Error indexing reference sequence\n' + str( e ) )
+  # no Cleaning if no Exception, tmp_index_dir has to be cleaned after bowtie_alignment()
+  index_full_path = os.path.join(tmp_index_dir, ref_file_name) # bowtie fashion path without extention
+  return tmp_index_dir, index_full_path  
+  
+def bowtie_alignment(command_line, flyPreIndexed=''):
+  # make temp directory just for stderr
+  tmp_index_dir = tempfile.mkdtemp()
+  tmp = tempfile.NamedTemporaryFile( dir=tmp_index_dir ).name
+  tmp_stderr = open( tmp, 'wb' )
+  # conditional statement for sorted bam generation viewable in Trackster
+  if "samtools" in command_line:
+    target_file = command_line.split()[-1] # recover the final output file name
+    path_to_unsortedBam = os.path.join(tmp_index_dir, "unsorted.bam")
+    path_to_sortedBam = os.path.join(tmp_index_dir, "unsorted.bam.sorted")
+    first_command_line = " ".join(command_line.split()[:-3]) + " -o " + path_to_unsortedBam + " - "
+    # example: bowtie -v 0 -M 1 --best --strata -p 12 --suppress 6,7,8 -S /home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49 -f /home/galaxy/galaxy-dist/database/files/003/dataset_3460.dat |samtools view -bS -o /tmp/tmp_PgMT0/unsorted.bam -
+    second_command_line = "samtools sort  %s %s" % (path_to_unsortedBam, path_to_sortedBam) # generates an "unsorted.bam.sorted.bam file", NOT an "unsorted.bam.sorted" file
+    p = subprocess.Popen(args=first_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) # fileno() method return the file descriptor number of tmp_stderr
+    returncode = p.wait()
+    sys.stdout.write("%s\n" % first_command_line + str(returncode))
+    p = subprocess.Popen(args=second_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno())
+    returncode = p.wait()
+    sys.stdout.write("\n%s\n" % second_command_line + str(returncode))
+    if os.path.isfile(path_to_sortedBam + ".bam"):
+      shutil.copy2(path_to_sortedBam + ".bam", target_file)
+  else:
+    p = subprocess.Popen(args=command_line, shell=True, stderr=tmp_stderr.fileno())
+    returncode = p.wait()
+    sys.stdout.write(command_line + "\n")
+  tmp_stderr.close()
+  ## cleaning if the index was created in the fly
+  if os.path.exists( flyPreIndexed ):
+    shutil.rmtree( flyPreIndexed )
+  # cleaning tmp files and directories
+  if os.path.exists( tmp_index_dir ):
+    shutil.rmtree( tmp_index_dir )
+  return
+
+def __main__():
+  F = open (sys.argv[7], "w")
+  if sys.argv[5] == "history":
+    tmp_dir, index_path = bowtie_squash(sys.argv[6])
+  else:
+    tmp_dir, index_path = "dummy/dymmy", sys.argv[6]
+  command_line = bowtieCommandLiner(sys.argv[2], sys.argv[3], sys.argv[4], sys.argv[8], sys.argv[9], sys.argv[1], index_path, sys.argv[7], sys.argv[10])
+  bowtie_alignment(command_line, flyPreIndexed=tmp_dir)
+  F.close()
+if __name__=="__main__": __main__()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sRbowtie/sRbowtie.xml	Mon May 19 17:33:06 2014 -0400
@@ -0,0 +1,192 @@
+<tool id="bowtieForSmallRNA" name="sRbowtie" version="1.0.0">
+  <description>for FASTA small reads</description>
+  <requirements>
+	<requirement type='package'>bowtie</requirement>
+  </requirements>
+  <parallelism method="basic"></parallelism>
+  <command interpreter="python"> sRbowtie.py $input
+                                                    $method
+                                                    $v_mismatches
+                                                    $output_type
+                                                    $refGenomeSource.genomeSource
+                                                    ## the very source of the index (indexed or fasta file)
+                                                    #if $refGenomeSource.genomeSource == "history":
+                                                        $refGenomeSource.ownFile
+                                                    #else:
+                                                        $refGenomeSource.index.fields.path
+                                                    #end if
+                                                    $output
+                                                    $aligned
+                                                    $unaligned
+						    \${GALAXY_SLOTS:-4} ## number of processors to be handled by bowtie
+  </command>
+  <inputs>
+      <param name="input" type="data" format="fasta" label="Input fasta file: reads clipped from their adapter" help="Only with clipped, raw fasta files"/>
+<!-- which method will be used --> 
+      <param name="method" type="select" label="What kind of matching do you want to do?" help="bowtie parameters adjusted to the type of matching. RNA option match to only one strand">
+        <option value="RNA">Match on sense strand RNA reference index, multiple mappers randomly matched at a single position</option>
+        <option value="unique">Match unique mappers on DNA reference index</option>
+        <option value="multiple" selected="true">Match on DNA, multiple mappers randomly matched at a single position</option>
+        <option value="k_option">Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)</option>
+        <option value="n_option">Match on DNA - RNAseq mode (-n bowtie option)</option>
+        <option value="a_option">Match and report all valid alignments</option>
+      </param>
+<!-- END of which method will be used -->
+    <param name="v_mismatches" type="select" label="Number of mismatches allowed" help="specify the -v bowtie option">
+        <option value="0">0</option>
+        <option value="1" selected="true">1</option>
+        <option value="2">2</option>
+        <option value="3">3</option>
+    </param>
+<!-- bowtie index selection -->
+    <conditional name="refGenomeSource">
+      <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+        <option value="indexed">Use a built-in index</option>
+        <option value="history">Use one from the history</option>
+      </param>
+      <when value="indexed">
+        <param name="index" type="select" label="Select a DNA reference index" help="if your genome of interest is not listed - contact GED team">
+          <options from_data_table="bowtie_indexes">
+      <!--      <filter type="sort_by" column="2" />
+            <validator type="no_options" message="No indexes are available" /> -->
+          </options>
+        </param>
+      </when>
+      <when value="history">
+        <param name="ownFile" type="data" format="fasta" label="Select a fasta file, to serve as index reference" />
+      </when>
+    </conditional>
+<!-- END bowtie index selection -->
+       <param name="output_type" type="select" label="Select output format" help="Note that the BAM will be viewable in trackster only if you choose a full genome referenced for Trackster usage. see the doc below">
+          <option value="tabular" select="true">tabular</option>
+          <option value="sam">sam</option>
+          <option value="bam">bam</option>
+       </param>
+       <param name="additional_fasta" type="select" label="additional fasta output" help="to get aligned and unaligned reads in fasta format">
+          <option value="No" select="true">No</option>
+          <option value="al">aligned</option>
+          <option value="unal">unaligned</option>
+          <option value="al_and_unal">both aligned and unaligned</option>
+       </param>
+   </inputs>
+   <outputs>
+   <data format="tabular" name="output" label="Bowtie Output">
+        <change_format>
+            <when input="output_type" value="sam" format="sam" />
+            <when input="output_type" value="bam" format="bam" />
+        </change_format>
+   </data>
+   <data format="fasta" name="aligned" label="Matched reads">
+	<filter>additional_fasta == "al" or additional_fasta == "al_and_unal"</filter>
+   </data>
+   <data format="fasta" name="unaligned" label ="Unmatched reads">
+        <filter>additional_fasta == "unal" or additional_fasta == "al_and_unal"</filter>
+   </data>
+   </outputs>
+
+    <test>
+      <param name="genomeSource" value="indexed" />
+      <param name="index" value="/home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49" />
+      <param name="method" value="multiple" />
+      <param name="input" ftype="fasta" value="sRbowtie.fa" />
+      <param name="v_mismatches" value="1" />
+      <param name="output_type" value="tabular" />
+      <output name="output" ftype="tabular" value="sRbowtie.out" />
+      <output name="aligned" value="None" />
+      <output name="unaligned" value="None" />
+    </test>
+
+  <help>
+
+**What it does**
+
+Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. Please cite: Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25.
+
+.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml
+
+A generic "Map with Bowtie for Illumina" Galaxy tool is available in the main Galaxy distribution.
+
+However, this Bowtie wrapper tool only takes FASTQ files as inputs.
+
+The sRbowtie wrapper specifically works with short reads FASTA inputs (-v bowtie mode)
+
+------
+
+**OPTIONS**
+
+.. class:: infomark
+
+This script uses Bowtie to match reads on a reference index.
+
+Depending on the type of matching, different bowtie options are used:
+
+**Match on sense strand RNA reference index, multiple mappers randomly matched at a single position**
+
+Match on RNA reference, SENSE strand, randomly attributing multiple mapper to target with least mismatches, the polarity column is suppressed in the bowtie tabular report:
+
+*-v [0,1,2,3] -M 1 --best --strata -p 12 --norc --suppress 2,6,7,8*
+
+**Match unique mappers on DNA reference index**
+
+Match ONLY unique mappers on DNA reference index
+
+*-v [0,1,2,3] -m 1 -p 12 --suppress 6,7,8*
+
+Note that using this option with -v values other than 0 is questionnable...
+
+**Match on DNA, multiple mappers randomly matched at a single position**
+
+Match multiple mappers, randomly attributing multiple mapper to target with least mismatches, number of mismatch allowed specified by -v option:
+
+*-v [0,1,2,3] -M 1 --best --strata -p 12 --suppress 6,7,8*
+
+**Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)**
+
+Match with highest speed, not guaranteeing best hit for speed gain:
+
+*-v [0,1,2,3] -k 1 --best -p 12 --suppress 6,7,8*
+
+
+-----
+
+**Input formats**
+
+.. class:: warningmark
+
+*The only accepted format for the script is a raw fasta list of reads, clipped from their adapter*
+
+-----
+
+**OUTPUTS**
+
+If you choose tabular as the output format, you will obtain the matched reads in standard bowtie output format, having the following columns::
+
+    Column    Description
+  --------    --------------------------------------------------------
+   1 FastaID  fasta identifier
+   2 polarity + or - depending whether the match was reported on the forward or reverse strand
+   3 target     name of the matched target
+   4 Offset   O-based coordinate of the miR on the miRBase pre-miR sequence
+   5 Seq      sequence of the matched Read
+
+If you choose SAM, you will get the output in unordered SAM format.
+
+.. class:: warningmark
+
+if you choose BAM, the output will be in sorted BAM format.
+To be viewable in Trackster, several condition must be fulfilled:
+
+.. class:: infomark
+
+Reads must have been matched to a genome whose chromosome names are compatible with Trackster genome indexes
+
+.. class:: infomark
+
+the database/Build (dbkey) which is indicated for the dataset (Pencil - Database/Build field) must match a Trackster genome index.
+
+Please contact the Galaxy instance administrator if your genome is not referenced
+
+**Matched and unmatched fasta reads can be retrieved, for further analyses**
+
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sRbowtie/test-data/sRbowtie.fa	Mon May 19 17:33:06 2014 -0400
@@ -0,0 +1,40 @@
+>1
+GTATTGTAAGTGGCAGAGTGGC
+>2
+TGGAATGTAAAGAAGTATGGAG
+>3
+GTGGGGAGTTTGGATGGGGCGGCA
+>4
+AATGGCACTGGAAGAATTCACGG
+>5
+GTACGGACAAGGGGAATC
+>6
+TTGGGTTCTGGGGGGAGTATGG
+>7
+GTGGGGAGTTTCGCTGGGGCGGCA
+>8
+TAAGGGTCGGGTAGTGAGGGC
+>9
+AGCTGGGACTGAGGACTG
+>10
+AGCTGGGACTGAGGACTGC
+>11
+AAGGGTCGGGTAGTGAGG
+>12
+GTCGGGTAGTGAGGGCCTT
+>13
+TGGTGGGGCTTGGAACAATTGGAGGGC
+>14
+TGACGGAAGGGCACCACC
+>15
+TGGAATGTAAAGAAGTATGGAG
+>16
+TTGGGTTCTGGGGGGAGT
+>17
+TCAGGTGGGGAGTTTGGCTGGGGCGGCACA
+>18
+TTGGGTATAGGGGCGAAAGA
+>19
+AGCGGGCGTGCTTGTGGAC
+>20
+GTCGAATTTGGGTATAGGGGC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sRbowtie/test-data/sRbowtie.out	Mon May 19 17:33:06 2014 -0400
@@ -0,0 +1,5 @@
+2	+	2L	20487495	TGGAATGTAAAGAAGTATGGAG
+4	-	2L	11953463	CCGTGAATTCTTCCAGTGCCATT
+15	+	2L	20487495	TGGAATGTAAAGAAGTATGGAG
+14	-	Uextra	7115665	GGTGGTGCCCTTCCGTCA
+18	+	Uextra	7726410	TTGGGTATAGGGGCGAAAGA