Mercurial > repos > devteam > samtools_sort
changeset 9:17bed26ad17e draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools/samtools_sort commit 9f6dd28ae31897068c9f8b5d842750d5d7cd600c
| author | iuc |
|---|---|
| date | Wed, 19 Sep 2018 09:53:20 -0400 |
| parents | 71d5c34fef4e |
| children | c15c63771494 |
| files | macros.xml samtools_sort.xml test-data/name.sort.expected.bam test-data/name.sort.expected.sam test-data/pos.sort.expected.bam test-data/pos.sort.expected.sam test-data/tag.as.sort.expected.bam test-data/tag.as.sort.expected.sam test-data/tag.fi.sort.expected.bam test-data/tag.fi.sort.expected.sam test-data/tag.rg.n.sort.expected.bam test-data/tag.rg.n.sort.expected.sam test-data/tag.rg.sort.expected.bam test-data/tag.rg.sort.expected.sam test-data/test_input_1_a.bam |
| diffstat | 15 files changed, 382 insertions(+), 33 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Tue May 09 11:16:15 2017 -0400 +++ b/macros.xml Wed Sep 19 09:53:20 2018 -0400 @@ -1,11 +1,93 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="1.3.1">samtools</requirement> + <requirement type="package" version="@TOOL_VERSION@">samtools</requirement> <yield/> </requirements> </xml> - <token name="@TOOL_VERSION@">1.3.1</token> + <token name="@TOOL_VERSION@">1.9</token> + <token name="@FLAGS@">#set $flags = sum(map(int, str($filter).split(',')))</token> + <token name="@PREPARE_IDX@"><![CDATA[ + ##prepare input and indices + ln -s '$input' infile && + #if $input.is_of_type('bam'): + #if str( $input.metadata.bam_index ) != "None": + ln -s '${input.metadata.bam_index}' infile.bai && + #else: + samtools index infile infile.bai && + #end if + #elif $input.is_of_type('cram'): + #if str( $input.metadata.cram_index ) != "None": + ln -s '${input.metadata.cram_index}' infile.crai && + #else: + samtools index infile infile.crai && + #end if + #end if + ]]></token> + <token name="@PREPARE_IDX_MULTIPLE@"><![CDATA[ + ##prepare input and indices + #for $i, $bam in enumerate( $input_bams ): + ln -s '$bam' '${i}' && + #if $bam.is_of_type('bam'): + #if str( $bam.metadata.bam_index ) != "None": + ln -s '${bam.metadata.bam_index}' '${i}.bai' && + #else: + samtools index '${i}' '${i}.bai' && + #end if + #elif $bam.is_of_type('cram'): + #if str( $bam.metadata.cram_index ) != "None": + ln -s '${bam.metadata.cram_index}' '${i}.crai' && + #else: + samtools index '${i}' '${i}.crai' && + #end if + #end if + #end for + ]]></token> + <token name="@PREPARE_FASTA_IDX@"><![CDATA[ + ##checks for reference data ($addref_cond.addref_select=="history" or =="cached") + ##and sets the -t/-T parameters accordingly: + ##- in case of history a symbolic link is used because samtools (view) will generate + ## the index which might not be possible in the directory containing the fasta file + ##- in case of cached the absolute path is used which allows to read the cram file + ## without specifying the reference + #if $addref_cond.addref_select == "history": + ln -s '${addref_cond.ref}' reference.fa && + samtools faidx reference.fa && + #set reffa=str($addref_cond.ref) + #set reffai="reference.fa.fai" + #elif $addref_cond.addref_select == "cached": + #set reffa=str($addref_cond.ref.fields.path) + #set reffai=str($addref_cond.ref.fields.path) + #else + #set reffa=None + #set reffai=None + #end if + ]]></token> + <token name="@ADDTHREADS@"><![CDATA[ + ##compute the number of ADDITIONAL threads to be used by samtools (-@) + addthreads=\${GALAXY_SLOTS:-1} && (( addthreads-- )) && + ]]></token> + + <token name="@ADDMEMORY@"><![CDATA[ + ##compute the number of memory available to samtools sort (-m) + ##use only 75% of available: https://github.com/samtools/samtools/issues/831 + addmemory=\${GALAXY_MEMORY_MB_PER_SLOT:-768} && + ((addmemory=addmemory*75/100)) && + ]]></token> + <xml name="flag_options"> + <option value="1">read is paired</option> + <option value="2">read is mapped in a proper pair</option> + <option value="4">read is unmapped</option> + <option value="8">mate is unmapped</option> + <option value="16">read reverse strand</option> + <option value="32">mate reverse strand</option> + <option value="64">read is the first in a pair</option> + <option value="128">read is the second in a pair</option> + <option value="256">alignment or read is not primary</option> + <option value="512">read fails platform/vendor quality checks</option> + <option value="1024">read is a PCR or optical duplicate</option> + <option value="2048">supplementary alignment</option> + </xml> <xml name="citations"> <citations> <citation type="bibtex"> @@ -49,21 +131,4 @@ <exit_code range="1:" level="fatal" description="Error" /> </stdio> </xml> - <token name="@no-chrom-options@"> ------ - -.. class:: warningmark - -**No options available? How to re-detect metadata** - -If you see a "No options available" within the "**Select references (chromosomes and contigs) you would like to restrict bam to**" drop down, you need to re-detect metadata for the dataset you are trying to process. To do this follow these steps: - -1. Click on the **pencil** icon adjacent to the dataset in the history -2. A new menu will appear in the center pane of the interface -3. Click **Datatype** tab -4. Set **New Type** to **BAM** -5. Click **Save** - -The medatada will be re-detected and you will be able to see the list of reference sequences in the "**Select references (chromosomes and contigs) you would like to restrict bam to**" drop-down. - </token> </macros>
--- a/samtools_sort.xml Tue May 09 11:16:15 2017 -0400 +++ b/samtools_sort.xml Wed Sep 19 09:53:20 2018 -0400 @@ -1,4 +1,4 @@ -<tool id="samtools_sort" name="Sort" version="2.0.1"> +<tool id="samtools_sort" name="Samtools sort" version="2.0.2"> <description>order of storing aligned sequences</description> <macros> <import>macros.xml</import> @@ -7,39 +7,163 @@ <expand macro="stdio"/> <expand macro="version_command"/> <command><![CDATA[ + @ADDTHREADS@ + @ADDMEMORY@ samtools sort - $sort_mode - -@ \${GALAXY_SLOTS:-1} - -o '${output1}' + -@ \$addthreads + -m \$addmemory"M" + ###if str(compression): + ## -l '$compression' + ###end if + $prim_key_cond.prim_key_select + #if $prim_key_cond.prim_key_select == '-t': + $prim_key_cond.tag + $prim_key_cond.sec_key_select + #end if -O bam - -T dataset + -T sorttmp '${input1}' + > '${output1}' ]]></command> <inputs> - <param name="input1" type="data" format="bam" label="BAM File" /> - <param name="sort_mode" type="select" label="Sort by "> - <option value="" selected="True">Chromosomal coordinates</option> - <option value="-n">Read names (-n)</option> - </param> + <param name="input1" type="data" format="sam,bam,cram" label="BAM File" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" type="select" label="Primary sort key"> + <option value="">coordinate</option> + <option value="-n">name (-n)</option> + <option value="-t">tag (-t)</option> + </param> + <when value=""/> + <when value="-n"/> + <when value="-t"> + <param name="tag" type="text" optional="false" argument="-t" label="Alignment tag"/> + <param name="sec_key_select" type="select" label="Secondary sort key"> + <option value="">coordinate</option> + <option value="-n">name (-n)</option> + </param> + </when> + </conditional> + <!--<param name="compression" type="integer" argument="-l" optional="True" min="0" max="9" label="compression level" help="0 (uncompressed) to 9 (best)"/>--> </inputs> <outputs> - <data name="output1" format="bam" /> + <data name="output1" format="bam"> + <change_format> + <when input="prim_key_cond.prim_key_select" value="" format="bam" /> + <when input="prim_key_cond.prim_key_select" value="-n" format="qname_sorted.bam" /> + <when input="prim_key_cond.prim_key_select" value="-t" format="unsorted.bam" /> + </change_format> + </data> </outputs> <tests> + <!-- tests from https://github.com/samtools/samtools/blob/9ce8c64493f7ea3fa69bc5c1ac980b1a8e3dcf1f/test/test.pl#L2464 --> + <!-- # Pos sort --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <output name="output1" file="pos.sort.expected.bam" ftype="bam"/> + </test> + <!-- test_cmd($opts, out=>"sort/pos.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} $$opts{path}/dat/test_input_1_a.bam -O SAM -o -"); --> + + <!-- # Name sort --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-n"/> + </conditional> + <output name="output1" file="name.sort.expected.bam" ftype="qname_sorted.bam"/> + </test> + <!-- test_cmd($opts, out=>"sort/name.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -n $$opts{path}/dat/test_input_1_a.bam -O SAM -o -");--> + + <!-- # Tag sort (RG) (considers output and name sorted) --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="RG"/> + </conditional> + <output name="output1" file="tag.rg.sort.expected.bam" ftype="unsorted.bam"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.rg.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -t RG $$opts{path}/dat/test_input_1_a.bam -O SAM -o -");--> + + <!-- # Tag sort (RG); secondary by name --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="RG"/> + <param name="sec_key_select" value="-n"/> + </conditional> + <output name="output1" file="tag.rg.n.sort.expected.bam" ftype="unsorted.bam"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.rg.n.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -n -t RG $$opts{path}/dat/test_input_1_a.bam -O SAM -o -");--> + + <!-- # Tag sort (AS) --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="AS"/> + <param name="sec_key_select" value=""/> + </conditional> + <output name="output1" file="tag.as.sort.expected.bam" ftype="unsorted.bam"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.as.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -t AS $$opts{path}/dat/test_input_1_d.sam -O SAM -o -");--> + + <!-- # Tag sort (FI) --> + <test> + <param name="input1" value="test_input_1_a.bam" ftype="bam" /> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-t"/> + <param name="tag" value="FI"/> + </conditional> + <output name="output1" file="tag.fi.sort.expected.bam" ftype="unsorted.bam"/> + </test> + <!--test_cmd($opts, out=>"sort/tag.fi.sort.expected.sam", cmd=>"$$opts{bin}/samtools sort${threads} -t FI $$opts{path}/dat/test_input_1_d.sam -O SAM -o -");--> + + <!-- tests from old version --> <test> <param name="input1" value="1.bam" ftype="bam" /> <output name="output1" file="1_sort.bam" ftype="bam" sort="True"/> </test> <test> <param name="input1" value="1.bam" ftype="bam" /> - <param name="sort_mode" value="-n"/> - <output name="output1" file="1_sort_read_names.bam" ftype="bam" sort="True"/> + <conditional name="prim_key_cond"> + <param name="prim_key_select" value="-n"/> + </conditional> + <output name="output1" file="1_sort_read_names.bam" ftype="qname_sorted.bam"/> </test> </tests> <help> **What it does** -This tool uses ``samtools sort`` command to sort BAM datasets in coordinate or read name order. +Sort alignments by leftmost coordinates, or by read name when -n is used. +An appropriate @HD-SO sort order header tag will be added or an existing +one updated if necessary. + +**Ordering Rules** + +The following rules are used for ordering records. + +If option -t is in use, records are first sorted by the value of the given +alignment tag, and then by position or name (if using -n). For example, “-t RG” +will make read group the primary sort key. The rules for ordering by tag are: + +- Records that do not have the tag are sorted before ones that do. +- If the types of the tags are different, they will be sorted so that single + character tags (type A) come before array tags (type B), then string tags + (types H and Z), then numeric tags (types f and i). +- Numeric tags (types f and i) are compared by value. Note that comparisons of + floating-point values are subject to issues of rounding and precision. +- String tags (types H and Z) are compared based on the binary contents of the + tag using the C strcmp(3) function. +- Character tags (type A) are compared by binary character value. +- No attempt is made to compare tags of other types — notably type B array values will not be compared. + +When the -n option is present, records are sorted by name. Names are compared so as to give a “natural” ordering — i.e. sections consisting of digits are compared numerically while all other sections are compared based on their binary representation. This means “a1” will come before “b1” and “a9” will come before “a10”. Records with the same name will be ordered according to the values of the READ1 and READ2 flags (see flags). + +When the -n option is not present, reads are sorted by reference (according to the order of the @SQ header records), then by position in the reference, and then by the REVERSE flag. + +This has now been removed. The previous out.prefix argument (and -f option, if any) should be changed to an appropriate combination of -T PREFIX and -o FILE. The previous -o option should be removed, as output defaults to standard output. + </help> <expand macro="citations"/> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/name.sort.expected.sam Wed Sep 19 09:53:20 2018 -0400 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:queryname +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/pos.sort.expected.sam Wed Sep 19 09:53:20 2018 -0400 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:coordinate +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ???????????????????????
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tag.as.sort.expected.sam Wed Sep 19 09:53:20 2018 -0400 @@ -0,0 +1,24 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@PG ID:llama +@RG ID:fish PG:llama +@RG ID:cow PU:13_&^&&*(:332 PG:donkey +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@CO Do you know? +r006 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:colt PG:Z:donkey FI:i:3 +x11 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:cow PG:Z:bull FI:Z:a +r007 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:donkey AS:i:-5 FI:f:3.5 +x10 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:cow PG:Z:bull AS:i:0 FI:A:b +r007 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:colt PG:Z:donkey AS:i:1 FI:i:4 +r005 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:colt PG:Z:donkey AS:i:10 FI:i:5 +x8 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:cow PG:Z:bull AS:i:10 FI:f:1.5 +r006 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 RG:Z:colt PG:Z:donkey AS:i:20 FI:f:4.5 +x9 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:cow PG:Z:bull AS:i:20 FI:i:1 +x7 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:cow PG:Z:bull AS:i:50 FI:i:2 +r005 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:colt PG:Z:donkey AS:i:100 FI:f:2.5 +x12 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow PG:Z:bull AS:i:65100
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tag.fi.sort.expected.sam Wed Sep 19 09:53:20 2018 -0400 @@ -0,0 +1,24 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@PG ID:llama +@RG ID:fish PG:llama +@RG ID:cow PU:13_&^&&*(:332 PG:donkey +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@CO Do you know? +x12 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow PG:Z:bull AS:i:65100 +x10 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:cow PG:Z:bull AS:i:0 FI:A:b +x11 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:cow PG:Z:bull FI:Z:a +x9 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:cow PG:Z:bull AS:i:20 FI:i:1 +x8 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:cow PG:Z:bull AS:i:10 FI:f:1.5 +x7 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:cow PG:Z:bull AS:i:50 FI:i:2 +r005 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:colt PG:Z:donkey AS:i:100 FI:f:2.5 +r006 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:colt PG:Z:donkey FI:i:3 +r007 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:donkey AS:i:-5 FI:f:3.5 +r007 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:colt PG:Z:donkey AS:i:1 FI:i:4 +r006 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 RG:Z:colt PG:Z:donkey AS:i:20 FI:f:4.5 +r005 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:colt PG:Z:donkey AS:i:10 FI:i:5
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tag.rg.n.sort.expected.sam Wed Sep 19 09:53:20 2018 -0400 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tag.rg.sort.expected.sam Wed Sep 19 09:53:20 2018 -0400 @@ -0,0 +1,28 @@ +@HD VN:1.4 SO:unknown +@SQ SN:insert LN:599 +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +@SQ SN:ref3 LN:4 +@RG ID:fish PG:donkey +@RG ID:cow PU:13_&^&&*(:332 +@RG PU:*9u8jkjjkjd: ID:colt +@PG ID:bull PP:donkey +@PG ID:donkey +@PG ID:moose +@PG PP:moose ID:cow +@CO +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 PG:Z:colt +u1 4 * 0 30 23M * 0 0 TAATTAAGTCTACAGAAAAAAAA ??????????????????????? +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * RG:Z:colt PG:Z:colt +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * RG:Z:colt PG:Z:bull +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? RG:Z:colt PG:Z:bull +r000 99 insert 50 30 10M = 80 30 ATTTAGCTAC AAAAAAAAAA RG:Z:cow PG:Z:bull +r000 211 insert 80 30 10M = 50 -30 CCCAATCATT AAAAAAAAAA RG:Z:cow PG:Z:bull +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * RG:Z:cow +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * RG:Z:cow PG:Z:colt +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? RG:Z:cow +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 RG:Z:fish PG:Z:colt +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * RG:Z:fish PG:Z:colt +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? RG:Z:fish PG:Z:bull +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? RG:Z:fish PG:Z:bull +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? RG:Z:fish PG:Z:bull