Mercurial > repos > devteam > freebayes
changeset 2:14f952d2a9db draft
Uploaded
| author | devteam |
|---|---|
| date | Thu, 11 Dec 2014 18:38:34 -0500 |
| parents | ef435b7b0420 |
| children | 9f3d6c3098ac |
| files | freebayes.xml sam_fa_indices.loc.sample test-data/fake_phiX_reads_1.bam test-data/freebayes-phix174-test1.vcf test-data/freebayes-phix174.bam test-data/freebayes-phix174.fasta test-data/freebayes_out_1.output_trace test-data/freebayes_out_1.vcf.contains test-data/left-align-input.bam test-data/left-align-output.bam test-data/leftalign.fa test-data/phiX.fasta tool-data/fasta_indexes.loc.sample tool-data/tool_data_table_conf.xml.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 16 files changed, 670 insertions(+), 549 deletions(-) [+] |
line wrap: on
line diff
--- a/freebayes.xml Mon Dec 16 13:29:20 2013 -0500 +++ b/freebayes.xml Thu Dec 11 18:38:34 2014 -0500 @@ -1,475 +1,604 @@ <?xml version="1.0"?> -<tool id="freebayes" name="FreeBayes" version="0.0.3"> +<tool id="freebayes" name="FreeBayes" version="0.3"> <requirements> - <requirement type="package" version="0.9.6_9608597d12e127c847ae03aa03440ab63992fedf">freebayes</requirement> + <requirement type="package" version="0.9.18_0059bdf">freebayes</requirement> <requirement type="package" version="0.1.18">samtools</requirement> </requirements> - <description> - Bayesian genetic variant detector</description> + <description> - bayesian genetic variant detector</description> <command> ##set up input files + #set $reference_fasta_filename = "localref.fa" + #if str( $reference_source.reference_source_selector ) == "history": ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && samtools faidx "${reference_fasta_filename}" 2>&1 || echo "Error running samtools faidx for FreeBayes" >&2 && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if + #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): ln -s "${input_bam.input_bam}" "localbam_${bam_count}.bam" && ln -s "${input_bam.input_bam.metadata.bam_index}" "localbam_${bam_count}.bam.bai" && #end for + + ## Tabixize optional input_varinat_vcf file (for --variant-input option) + + #if ( str( $options_type.options_type_selector ) == 'cline' or str( $options_type.options_type_selector ) == 'full' ) and $options_type.optional_inputs.optional_inputs_selector and str( $options_type.optional_inputs.input_variant_type.input_variant_type_selector ) == "provide_vcf": + ln -s "${options_type.optional_inputs.input_variant_type.input_variant_vcf}" "input_variant_vcf.vcf.gz" && + ln -s "${Tabixized_input}" "input_variant_vcf.vcf.gz.tbi" && + #end if + ##finished setting up inputs - ##start FreeBayes commandline + ##COMMAND LINE STARTS HERE + freebayes #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): --bam "localbam_${bam_count}.bam" #end for - --fasta-reference "${reference_fasta_filename}" + --fasta-reference "${reference_fasta_filename}" ##outputs --vcf "${output_vcf}" + #if str( $target_limit_type.target_limit_type_selector ) == "limit_by_target_file": + --targets "${target_limit_type.input_target_bed}" + #elif str( $target_limit_type.target_limit_type_selector ) == "limit_by_region": + --region "${target_limit_type.region_chromosome}:${target_limit_type.region_start}..${target_limit_type.region_end}" + #end if + ##advanced options - #if str( $options_type.options_type_selector ) == "advanced": - ##additional outputs - #if $options_type.output_trace_option: - --trace "${output_trace}" - #end if - #if $options_type.output_failed_alleles_option: - --failed-alleles "${output_failed_alleles_bed}" + #if str( $options_type.options_type_selector ) == "simple": + ##do nothing as command like build up to this point is sufficinet for simple diploid calling + + #elif str( $options_type.options_type_selector ) == "simple_w_filters": + + --standard-filters + --min-coverage "${options_type.min_coverage}" + + #elif str( $options_type.options_type_selector ) == "naive": + + --haplotype-length 0 + --min-alternate-count 1 + --min-alternate-fraction 0 + --pooled-continuous + --report-monomorphic + + #elif str( $options_type.options_type_selector ) == "naive_w_filters": + + --haplotype-length 0 + --min-alternate-count 1 + --min-alternate-fraction 0 + --pooled-continuous + --report-monomorphic + --standard-filters + --min-coverage "${options_type.min_coverage}" + +## Command line direct text entry is not allowed at this time for security reasons + +## #elif str( $options_type.options_type_selector ) == "cline": + +## ${options_type.cline} + +## @optional_inputs_outputs@ + + #elif str( $options_type.options_type_selector ) == "full": + +##optional inputs and outputs + + @optional_inputs_outputs@ + +## REPORTING + + #if str( $options_type.reporting.reporting_selector ) == "True": + --pvar ${options_type.reporting.pvar} #end if - ##additional inputs - #if str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_target_file": - --targets "${options_type.target_limit_type.input_target_bed}" - #elif str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_region": - --region "${options_type.target_limit_type.region_chromosome}:${options_type.target_limit_type.region_start}..${options_type.target_limit_type.region_end}" - #end if - #if $options_type.input_sample_file: - --samples "${options_type.input_sample_file}" +## POPULATION MODEL + + #if str( $options_type.population_model.population_model_selector ) == "True": + --theta "${options_type.population_model.T}" + --ploidy "${options_type.population_model.P}" + ${options_type.population_model.J} + ${options_type.population_model.K} + #end if - #if $options_type.input_populations_file: - --populations "${options_type.input_populations_file}" - #end if - #if $options_type.input_cnv_map_bed: - --cnv-map "${options_type.input_cnv_map_bed}" - #end if - #if str( $options_type.input_variant_type.input_variant_type_selector ) == "provide_vcf": - --variant-input "${options_type.input_variant_type.input_variant_vcf}" - ${options_type.input_variant_type.only_use_input_alleles} - #end if - #if $options_type.haplotype_basis_alleles: - --haplotype-basis-alleles "${options_type.haplotype_basis_alleles}" + +## REFERENCE ALLELE + + #if str( $options_type.reference_allele.reference_allele_selector ) == "True": + ${options_type.reference_allele.Z} + --reference-quality "${options_type.reference_allele.reference_quality}" #end if +## ALLELE SCOPE - ##reporting - #if str( $options_type.section_reporting_type.section_reporting_type_selector ) == "set": - --pvar "${options_type.section_reporting_type.pvar}" - ${options_type.section_reporting_type.show_reference_repeats} - #end if - - ##population model - #if str( $options_type.section_population_model_type.section_population_model_type_selector ) == "set": - --theta "${options_type.section_population_model_type.theta}" - --ploidy "${options_type.section_population_model_type.ploidy}" - ${options_type.section_population_model_type.pooled} + #if str( $options_type.allele_scope.allele_scope_selector ) == "True": + ${options_type.allele_scope.I} + ${options_type.allele_scope.i} + ${options_type.allele_scope.X} + ${options_type.allele_scope.u} + -n "${options_type.allele_scope.n}" + --haplotype-length "${options_type.allele_scope.haplotype_length}" + --min-repeat-size "${options_type.allele_scope.min_repeat_length}" + --min-repeat-entropy "${options_type.allele_scope.min_repeat_entropy}" + ${options_type.allele_scope.no_partial_observations} #end if - ##reference allele - #if str( $options_type.use_reference_allele_type.use_reference_allele_type_selector ) == "include_reference_allele": - --use-reference-allele - ${options_type.use_reference_allele_type.diploid_reference} - --reference-quality "${options_type.use_reference_allele_type.reference_quality_mq},${options_type.use_reference_allele_type.reference_quality_bq}" - #end if +## REALIGNMENT + + ${options_type.O} - ##allele scope - #if str( $options_type.section_allele_scope_type.section_allele_scope_type_selector ) == "set": - ${options_type.section_allele_scope_type.no_snps} - ${options_type.section_allele_scope_type.no_indels} - ${options_type.section_allele_scope_type.no_mnps} - ${options_type.section_allele_scope_type.no_complex} - --use-best-n-alleles "${options_type.section_allele_scope_type.use_best_n_alleles}" - #if $options_type.section_allele_scope_type.max_complex_gap: - --max-complex-gap "${options_type.section_allele_scope_type.max_complex_gap}" +##INPUT FILTERS + + #if str( $options_type.input_filters.input_filters_selector ) == "True": + ${options_type.input_filters.use_duplicate_reads} + -m "${options_type.input_filters.m}" + -q "${options_type.input_filters.q}" + -R "${options_type.input_filters.R}" + -Y "${options_type.input_filters.Y}" + + #if str( $options_type.input_filters.mismatch_filters.mismatch_filters_selector ) == "True": + -Q "${options_type.input_filters.mismatch_filters.Q}" + -U "${options_type.input_filters.mismatch_filters.U}" + -z "${options_type.input_filters.mismatch_filters.z}" + --read-snp-limit "${options_type.input_filters.mismatch_filters.read_snp_limit}" #end if + + -e "${options_type.input_filters.e}" + -F "${options_type.input_filters.F}" + -C "${options_type.input_filters.C}" + --min-alternate-qsum "${options_type.input_filters.min_alternate_qsum}" + -G "${options_type.input_filters.G}" + --min-coverage "${options_type.input_filters.min_coverage}" #end if - ##indel realignment - ${options_type.left_align_indels} +## POPULATION AND MAPPABILITY PRIORS - ##input filters - #if str( $options_type.section_input_filters_type.section_input_filters_type_selector ) == "set": - ${options_type.section_input_filters_type.use_duplicate_reads} - #if str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "apply_filters": - --min-mapping-quality "${options_type.section_input_filters_type.quality_filter_type.min_mapping_quality}" - --min-base-quality "${options_type.section_input_filters_type.quality_filter_type.min_base_quality}" - --min-supporting-quality "${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_mq},${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_bq}" - #elif str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "standard_filters": - --standard-filters - #end if - --mismatch-base-quality-threshold "${options_type.section_input_filters_type.mismatch_base_quality_threshold}" - #if $options_type.section_input_filters_type.read_mismatch_limit: - --read-mismatch-limit "${options_type.section_input_filters_type.read_mismatch_limit}" - #end if - --read-max-mismatch-fraction "${options_type.section_input_filters_type.read_max_mismatch_fraction}" - #if $options_type.section_input_filters_type.read_snp_limit: - --read-snp-limit "${options_type.section_input_filters_type.read_snp_limit}" - #end if - #if $options_type.section_input_filters_type.read_indel_limit: - --read-indel-limit "${options_type.section_input_filters_type.read_indel_limit}" - #end if - --indel-exclusion-window "${options_type.section_input_filters_type.indel_exclusion_window}" - --min-alternate-fraction "${options_type.section_input_filters_type.min_alternate_fraction}" - --min-alternate-count "${options_type.section_input_filters_type.min_alternate_count}" - --min-alternate-qsum "${options_type.section_input_filters_type.min_alternate_qsum}" - --min-alternate-total "${options_type.section_input_filters_type.min_alternate_total}" - --min-coverage "${options_type.section_input_filters_type.min_coverage}" + #if str( $options_type.population_mappability_priors.population_mappability_priors_selector ) == "True": + ${options_type.population_mappability_priors.k} + ${options_type.population_mappability_priors.w} + ${options_type.population_mappability_priors.V} + ${options_type.population_mappability_priors.a} + #end if + +## GENOTYPE LIKELIHOODS + + #if str( $options_type.genotype_likelihoods.genotype_likelihoods_selector ) == "True": + --base-quality-cap "${$options_type.genotype_likelihoods.base_quality_cap}" + ${$options_type.genotype_likelihoods.experimental_gls} + --prob-contamination "${$options_type.genotype_likelihoods.prob_contamination}" #end if - ##bayesian priors - #if str( $options_type.section_bayesian_priors_type.section_bayesian_priors_type_selector ) == "set": - ${options_type.section_bayesian_priors_type.no_ewens_priors} - ${options_type.section_bayesian_priors_type.no_population_priors} - ${options_type.section_bayesian_priors_type.hwe_priors} +## ALGORITHMIC FEATURES + + #if str( $options_type.algorithmic_features.algorithmic_features_selector ) == "True": + ${options_type.algorithmic_features.report_genotype_likelihood_max} + -B "${options_type.algorithmic_features.B}" + --genotyping-max-banddepth "${options_type.algorithmic_features.genotyping_max_banddepth}" + -W "${options_type.algorithmic_features.W}" + ${options_type.algorithmic_features.N} + + #if str( $options_type.algorithmic_features.genotype_variant_threshold.genotype_variant_threshold_selector ) == "True": + -S "${options_type.algorithmic_features.genotype_variant_threshold.S}" + #end if + + ${options_type.algorithmic_features.j} + ${options_type.algorithmic_features.H} + -D "${options_type.algorithmic_features.D}" + ${options_type.algorithmic_features.genotype_qualities} #end if - - ##observation prior expectations - #if str( $options_type.section_observation_prior_expectations_type.section_observation_prior_expectations_type_selector ) == "set": - ${options_type.section_observation_prior_expectations_type.binomial_obs_priors} - ${options_type.section_observation_prior_expectations_type.allele_balance_priors} - #end if + #end if + + </command> + + <macros> + <token name="@optional_inputs_outputs@"> + ## This token gets injected in commane in two instances: when options_type.options_type_selector == "full" and "cline" ( cline is not supported at this time ) + + #if $options_type.optional_inputs.optional_inputs_selector: - ##algorithmic features - #if str( $options_type.section_algorithmic_features_type.section_algorithmic_features_type_selector ) == "set": - --site-selection-max-iterations "${options_type.section_algorithmic_features_type.site_selection_max_iterations}" - --genotyping-max-iterations "${options_type.section_algorithmic_features_type.genotyping_max_iterations}" - --genotyping-max-banddepth "${options_type.section_algorithmic_features_type.genotyping_max_banddepth}" - --posterior-integration-limits "${options_type.section_algorithmic_features_type.posterior_integration_limits_n},${options_type.section_algorithmic_features_type.posterior_integration_limits_m}" - ${options_type.section_algorithmic_features_type.no_permute} - ${options_type.section_algorithmic_features_type.exclude_unobserved_genotypes} - #if $options_type.section_algorithmic_features_type.genotype_variant_threshold: - --genotype-variant-threshold "${options_type.section_algorithmic_features_type.genotype_variant_threshold}" - #end if - ${options_type.section_algorithmic_features_type.use_mapping_quality} - --read-dependence-factor "${options_type.section_algorithmic_features_type.read_dependence_factor}" - ${options_type.section_algorithmic_features_type.no_marginals} + #if $options_type.optional_inputs.output_trace_option: + --trace "${output_trace}" + #end if + + #if $options_type.optional_inputs.output_failed_alleles_option: + --failed-alleles "${output_failed_alleles_bed}" + #end if + + #if $options_type.optional_inputs.samples: + --samples "${options_type.optional_inputs.samples}" + #end if + + #if $options_type.optional_inputs.populations: + --populations "${options_type.optional_inputs.populations}" + #end if + + #if $options_type.optional_inputs.A: + --cnv-map "${options_type.optional_inputs.A}" + #end if + + #if str( $options_type.optional_inputs.input_variant_type.input_variant_type_selector ) == "provide_vcf": + --variant-input "input_variant_vcf.vcf.gz" ## input_variant_vcf.vcf.gz is symlinked to a galaxy-generated dataset in "Tabixize optional input_varinat_vcf file" section of the command line above + ${options_type.optional_inputs.input_variant_type.only_use_input_alleles} + #end if + + #if $options_type.optional_inputs.haplotype_basis_alleles: + --haplotype-basis-alleles "${options_type.optional_inputs.haplotype_basis_alleles}" + #end if + + #if $options_type.optional_inputs.observation_bias: + --observation-bias "${options_type.optional_inputs.observation_bias}" + #end if + + #if $options_type.optional_inputs.contamination_estimates: + --contamination-estimates "${options_type.optional_inputs.contamination_estimates}" + #end if + #end if - - #end if - </command> + </token> + <xml name="optional_file_inputs"> + <conditional name="optional_inputs"> + <param name="optional_inputs_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Do you want to provide additional inputs?" help="Sets --samples, --populations, --cnv-map, --trace, --failed-alleles, --varinat-input, --only-use-input-alleles, --haplotype-basis-alleles, --report-all-haplotype-alleles, --report-monomorphic options, --observation-bias, and --contamination-estimates" /> + <when value="set"> + <param name="output_failed_alleles_option" type="boolean" truevalue="--failed-alleles" falsevalue="" checked="False" label="Write out failed alleles file" help="--failed-alleles" /> + <param name="output_trace_option" type="boolean" truevalue="--trace" falsevalue="" checked="False" label="Write out algorithm trace file" help="--trace"/> + <param name="samples" type="data" format="txt" label="Limit analysis to samples listed (one per line) in the FILE" optional="True" help="-s --samples; default=By default FreeBayes will analyze all samples in its input BAM files"/> + <param name="populations" type="data" format="txt" label="Populations File" optional="True" help="--populations; default=False. Each line of FILE should list a sample and a population which it is part of. The population-based bayesian inference model will then be partitioned on the basis of the populations" /> + <param name="A" type="data" format="bed" label="Read a copy number map from the BED file FILE" optional="True" help="-A --cnv-map; default=copy number is set to as specified by --ploidy. Read a copy number map from the BED file FILE, which has the format: reference sequence, start, end, sample name, copy number ... for each region in each sample which does not have the default copy number as set by --ploidy."/> + <conditional name="input_variant_type"> + <param name="input_variant_type_selector" type="select" label="Provide variants file"> + <option value="do_not_provide" selected="True">Do not provide</option> + <option value="provide_vcf">Provide VCF file</option> + </param> + <when value="do_not_provide"> + <!-- Do nothing here --> + </when> + <when value="provide_vcf"> + <param name="input_variant_vcf" type="data" format="vcf_bgzip" label="Use variants reported in VCF file as input to the algorithm"> + <conversion name="Tabixized_input" type="tabix" /> + </param> + <param name="only_use_input_alleles" type="boolean" truevalue="--only-use-input-alleles" falsevalue="" checked="False" label="Only provide variant calls and genotype likelihoods for sites in VCF" /> + </when> + </conditional> + <param name="haplotype_basis_alleles" type="data" format="vcf" label="Only use variant alleles provided in this input VCF for the construction of complex or haplotype alleles" optional="True" help="--haplotype-basis-alleles" /> + <param name="report_monomorphic" type="boolean" truevalue="--report-monomorphic" falsevalue="" checked="False" label="Report even loci which appear to be monomorphic, and report all considered alleles, even those which are not in called genotypes." help="--report-monomorphic " /> + <param name="observation_bias" optional="True" type="data" format="tabular" label="Load read length-dependent allele observation biases from" help="--observation-bias; The format is [length] [alignment efficiency relative to reference] where the efficiency is 1 if there is no relative observation bias" /> + <param name="contamination_estimates" optional="True" type="data" format="tabular" label="Upload per-sample estimates of contamination from" help="--contamination-estimates; The format should be: sample p(read=R|genotype=AR) p(read=A|genotype=AA) Sample '*' can be used to set default contamination estimates." /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + </xml> + </macros> + <inputs> <conditional name="reference_source"> - <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> - <option value="cached">Locally cached</option> + <param name="reference_source_selector" type="select" label="Load reference genome from"> + <option value="cached">Local cache</option> <option value="history">History</option> </param> <when value="cached"> <repeat name="input_bams" title="Sample BAM file" min="1"> <param name="input_bam" type="data" format="bam" label="BAM file"> <validator type="unspecified_build" /> - <validator type="dataset_metadata_in_data_table" table_name="sam_fa_indexes" metadata_name="dbkey" metadata_column="value" message="Sequences are not currently available for the specified build." /> + <validator type="dataset_metadata_in_data_table" table_name="fasta_indexes" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." /> </param> </repeat> + <param name="ref_file" type="select" label="Using reference genome"> - <options from_data_table="sam_fa_indexes"> - <!-- <filter type="sam_fa_indexes" key="dbkey" ref="input_bam" column="value"/> does not yet work in a repeat...--> - </options> + <options from_data_table="fasta_indexes"></options> <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> </param> </when> <when value="history"> <!-- FIX ME!!!! --> <repeat name="input_bams" title="Sample BAM file" min="1"> - <param name="input_bam" type="data" format="bam" label="BAM file" /> + <param name="input_bam" type="data" format="bam" label="BAM file" /> </repeat> - <param name="ref_file" type="data" format="fasta" label="Using reference file" /> + <param name="ref_file" type="data" format="fasta" label="Use the following dataset as the reference sequence" help="You can upload a FASTA sequence to the history and use it as reference" /> + </when> + </conditional> + + <conditional name="target_limit_type"> + <param name="target_limit_type_selector" type="select" label="Limit variant calling to a set of regions?" help="Sets --targets or --region options"> + <option value="do_not_limit" selected="True">Do not limit</option> + <option value="limit_by_target_file">Limit by target file</option> + <option value="limit_by_region">Limit to region</option> + </param> + <when value="do_not_limit"> + <!-- Do nothing here --> + </when> + <when value="limit_by_target_file"> + <param name="input_target_bed" type="data" format="bed" label="Limit analysis to targets listed in the BED-format FILE." help="-t --targets"/> + </when> + <when value="limit_by_region"> + <param name="region_chromosome" type="text" label="Region Chromosome" value="" help="-r --region"/> <!--only once? --> + <param name="region_start" type="integer" label="Region Start" value="" /> + <param name="region_end" type="integer" label="Region End" value="" /> </when> </conditional> <conditional name="options_type"> - <param name="options_type_selector" type="select" label="Basic or Advanced options"> - <option value="basic" selected="True">Basic</option> - <option value="advanced">Advanced</option> + <param name="options_type_selector" type="select" label="Choose parameter selection level" help="Select how much control over the freebayes run you need" > + <option value="simple" selected="True">1:Simple diploid calling</option> + <option value="simple_w_filters">2:Simple diploid calling with filtering and coverage</option> + <option value="naive">3:Frequency-based pooled calling</option> + <option value="naive_w_filters">4:Frequency-based pooled calling with filtering and coverage</option> + <option value="full">5:Complete list of all options</option> + <!-- We will not alloow command line text boxes at this time + <option value="cline">6:Input parameters on the command line</option> + --> </param> - <when value="basic"> - <!-- Do nothing here --> - </when> - <when value="advanced"> - - <!-- output --> - <param name="output_failed_alleles_option" type="boolean" truevalue="--failed-alleles" falsevalue="" checked="False" label="Write out failed alleles file" /> - <param name="output_trace_option" type="boolean" truevalue="--trace" falsevalue="" checked="False" label="Write out algorithm trace file" /> - - - <!-- input --> - <conditional name="target_limit_type"> - <param name="target_limit_type_selector" type="select" label="Limit analysis to listed targets"> - <option value="do_not_limit" selected="True">Do not limit</option> - <option value="limit_by_target_file">Limit by target file</option> - <option value="limit_by_region">Limit to region</option> - </param> - <when value="do_not_limit"> - <!-- Do nothing here --> - </when> - <when value="limit_by_target_file"> - <param name="input_target_bed" type="data" format="bed" label="Limit analysis to targets listed in the BED-format FILE." /> - </when> - <when value="limit_by_region"> - <param name="region_chromosome" type="text" label="Region Chromosome" value="" /> <!--only once? --> - <param name="region_start" type="integer" label="Region Start" value="" /> - <param name="region_end" type="integer" label="Region End" value="" /> - </when> - </conditional> - <param name="input_sample_file" type="data" format="txt" label="Limit analysis to samples listed (one per line) in the FILE" optional="True" /> - <param name="input_populations_file" type="data" format="txt" label="Populations File" optional="True" /> - <param name="input_cnv_map_bed" type="data" format="bed" label="Read a copy number map from the BED file FILE" optional="True" /> - <conditional name="input_variant_type"> - <param name="input_variant_type_selector" type="select" label="Provide variants file"> - <option value="do_not_provide" selected="True">Do not provide</option> - <option value="provide_vcf">Provide VCF file</option> - </param> - <when value="do_not_provide"> - <!-- Do nothing here --> - </when> - <when value="provide_vcf"> - <param name="input_variant_vcf" type="data" format="vcf" label="Use variants reported in VCF file as input to the algorithm" /> - <param name="only_use_input_alleles" type="boolean" truevalue="--only-use-input-alleles" falsevalue="" checked="False" label="Only provide variant calls and genotype likelihoods for sites in VCF" /> - </when> - </conditional> - <param name="haplotype_basis_alleles" type="data" format="vcf" label="Only use variant alleles provided in this input VCF for the construction of complex or haplotype alleles" optional="True" /> + <when value="full"> + + <expand macro="optional_file_inputs" /> <!-- see macros section --> <!-- reporting --> - <conditional name="section_reporting_type"> - <param name="section_reporting_type_selector" type="select" label="Set Reporting options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> + + <conditional name="reporting"> + <param name="reporting_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Set reporting option?" help="Sets -P --pvar option" /> <when value="set"> - <param name="pvar" type="float" label="Report sites if the probability that there is a polymorphism at the site is greater" value="0.0001" /> - <param name="show_reference_repeats" type="boolean" truevalue="--show-reference-repeats" falsevalue="" checked="False" label="Calculate and show information about reference repeats" /> + <param name="pvar" type="float" value="0.0" label="Report sites if the probability that there is a polymorphism at the site is greater than" help="-P --pvar; default=0.0. Note that post-filtering is generally recommended over the use of this parameter. " /> </when> - </conditional> - - - <!-- population model --> - <conditional name="section_population_model_type"> - <param name="section_population_model_type_selector" type="select" label="Set population model options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="theta" type="float" label="expected mutation rate or pairwise nucleotide diversity among the population" value="0.001" help="This serves as the single parameter to the Ewens Sampling Formula prior model"/> - <param name="ploidy" type="integer" label="default ploidy for the analysis" value="2" /> - <param name="pooled" type="boolean" truevalue="--pooled" falsevalue="" checked="False" label="Assume that samples result from pooled sequencing" help="When using this flag, set --ploidy to the number of alleles in each sample." /> + <!-- do nothing --> </when> </conditional> - <!-- reference allele --> - <conditional name="use_reference_allele_type"> - <param name="use_reference_allele_type_selector" type="select" label="Include the reference allele in the analysis"> - <option value="do_not_include_reference_allele" selected="True">Do not include</option> - <option value="include_reference_allele">Include</option> - </param> - <when value="do_not_include_reference_allele"> - <!-- Do nothing here --> - </when> - <when value="include_reference_allele"> - <param name="diploid_reference" type="boolean" truevalue="--diploid-reference" falsevalue="" checked="False" label="Treat reference as diploid" /> - <param name="reference_quality_mq" type="integer" label="Assign mapping quality" value="100" /> - <param name="reference_quality_bq" type="integer" label="Assign base quality" value="60" /> - </when> - </conditional> + <!-- population model --> - <!-- allele scope --> - <conditional name="section_allele_scope_type"> - <param name="section_allele_scope_type_selector" type="select" label="Set allele scope options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> + <conditional name="population_model"> + <param name="population_model_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Set population model?" help="Sets --theta, --ploidy, --pooled-discrete, and --pooled-continuous options " /> + <when value="set"> + <param name="T" type="float" value="0.001" label="The expected mutation rate or pairwise nucleotide diversity among the population under analysis" help="-T --theta; default = 0.001. This serves as the single parameter to the Ewens Sampling Formula prior model." /> + <param name="P" type="integer" value="2" label="Set ploidy for the analysis" help="-p --ploidy; default=2" /> + <param name="J" type="boolean" truevalue="-J" falsevalue="" checked="False" label="Assume that samples result from pooled sequencing" help="-J --pooled-discrete; default=False. Model pooled samples using discrete genotypes across pools. When using this flag, set --ploidy to the number of alleles in each sample or use the --cnv-map to define per-sample ploidy." /> + <param name="K" type="boolean" truevalue="-K" falsevalue="" checked="False" label="Output all alleles which pass input filters, regardles of genotyping outcome or model" help="-K, --poled-continuous; default=False. " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + + <!-- reference allele --> + + <conditional name="reference_allele"> + <param name="reference_allele_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Use reference allele?" help="Sets --use-reference-allele and --reference-quality options " /> + <when value="set"> + <param name="Z" type="boolean" truevalue="-Z" falsevalue="" checked="False" label="Include the reference allele in the analysis as if it is another sample from the same population" help="-Z --use-reference-allele; default=False" /> + <param name="reference_quality" type="text" size="8" value="100,60" label="Assign mapping quality of MQ (100) to the reference allele at each site and base quality of BQ (60)" help="--reference-quality; default=100,60 " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + + <!-- allelic scope --> + + <conditional name="allele_scope"> + <param name="allele_scope_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Set allelic scope?" help="Sets -I, i, -X, -u, -n, --haplotype-length, --min-repeat-size, --min-repeat-entropy, and --no-partial-observations options " /> + <when value="set"> + <param name="I" type="boolean" truevalue="-I" falsevalue="" checked="False" label="Ignore SNP alleles" help="-I --no-snps; default=False" /> + <param name="i" type="boolean" truevalue="-i" falsevalue="" checked="False" label="Ignore indels alleles" help="-i --no-indels; default=False" /> + <param name="X" type="boolean" truevalue="-X" falsevalue="" checked="False" label="Ignore multi-nucleotide polymorphisms, MNPs" help="-X --no-mnps; default=False" /> + <param name="u" type="boolean" truevalue="-u" falsevalue="" checked="False" label="Ignore complex events (composites of other classes)." help="-u --no-complex; default=False" /> + <param name="n" type="integer" value="0" label="How many best SNP alleles to evaluate" help="-n --use-best-n-alleles; default=0 (all). Alleles are ranked by the sum of supporting quality scores. Set to 0 to evaluate all" /> + <param name="haplotype_length" type="integer" value="3" label="Allow haplotype calls with contiguous embedded matches of up to (nucleotides)" help="-E --max-complex-gap --haplotype-length; default=3." /> + <param name="min_repeat_length" type="integer" value="5" label="When assembling observations across repeats, require the total repeat length at least this many bp" help="--min-repeat-size; default=5." /> + <param name="min_repeat_entropy" type="integer" value="0" label="To detect interrupted repeats, build across sequence until it has entropy > (bits per bp)" help="--min-repeat-entropy; default=0 (off)." /> + <param name="no_partial_observations" type="boolean" truevalue="--no-partial-observations" falsevalue="" checked="False" label="Exclude observations which do not fully span the dynamically-determined detection window" help="--no-partial-observations; default=use all observations, dividing partial support across matching haplotypes when generating haplotypes. " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + + <!-- indel realignment --> + + <param name="O" type="boolean" truevalue="-O" falsevalue="" checked="False" label="Turn off left-alignment of indels?" help="-O --dont-left-align-indels; default=False (do left align). " /> + + <!-- input filters --> + + <conditional name="input_filters"> + <param name="input_filters_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Set input filters?" help="Sets -4, -m, -q, -R, -Y, -Q, -U, -z, -$, -e, -0, -F, -C, -3, -G, and -! options " /> + <when value="set"> + <param name="use_duplicate_reads" type="boolean" truevalue="--use-duplicate-reads" falsevalue="" checked="False" label="Include duplicate-marked alignments in the analysis." help="-4 --use-duplicate-reads; default=False (exclude duplicates marked as such in alignments)." /> + <param name="m" type="integer" value="1" label="Exclude alignments from analysis if they have a mapping quality less than" help="-m --min-mapping-quality; default=1" /> + <param name="q" type="integer" value="0" label="Exclude alleles from analysis if their supporting base quality less than" help="-q --min-base-quality; default=0" /> + <param name="R" type="integer" value="0" label="Consider any allele in which the sum of qualities of supporting observations is at least" help="-R --min-supporting-allele-qsum; default=0" /> + <param name="Y" type="integer" value="0" label="Consider any allele in which and the sum of mapping qualities of supporting reads is at least" help="-Y --min-supporting-mapping-qsum; default=0" /> + <conditional name="mismatch_filters"> + <param name="mismatch_filters_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Perform mismatch filtering?" help="Sets -Q, -U, -z, and $ options" /> + <when value="set"> + <param name="Q" type="integer" value="10" label="Count mismatches toward -U (option below) if the base quality of the mismatch is >=" help="-Q --mismatch-base-quality-threshold; default=10" /> + <param name="U" type="integer" value="1000" optional="True" label="Exclude reads with more than N mismatches where each mismatch has base quality >= Q (option above)" help="-U --read-mismatch-limit; default=~unbound" /> + <param name="z" type="float" value="1.0" min="0.0" max="1.0" label="Exclude reads with more than N [0,1] fraction of mismatches where each mismatch has base quality >= Q (second option above)" help="-z --read-max-mismatch-fraction; default=1.0" /> + <param name="read_snp_limit" type="integer" value="1000" label="Exclude reads with more than N base mismatches, ignoring gaps with quality >= Q (third option abobe)" help="-$amp; --read-snp-limit N " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + <param name="e" type="integer" value="1000" label="Exclude reads with more than this number of separate gaps" help="-e --read-snp-limit; default=~unbounded" /> + <param name="standard_filters" type="boolean" truevalue="-0" falsevalue="" checked="False" label="Use stringent input base and mapping quality filters" help="-0 --standard-filters; default=False. Equivalent to -m 30 -q 20 -R 0 -S 0" /> + <param name="F" type="float" value="0.2" label="Require at least this fraction of observations supporting an alternate allele within a single individual in the in order to evaluate the position" help="-F --min-alternate-fraction; default=0.2" /> + <param name="C" type="integer" value="2" label="Require at least this count of observations supporting an alternate allele within a single individual in order to evaluate the position" help="-C --min-alternate-count; default=2" /> + <param name="min_alternate_qsum" type="integer" value="0" label="Require at least this sum of quality of observations supporting an alternate allele within a single individual in order to evaluate the position" help="-3 --min-alternate-qsum; default=0" /> + <param name="G" type="integer" value="1" label="Require at least this count of observations supporting an alternate allele within the total population in order to use the allele in analysis" help="-G --min-alternate-total N; default=1" /> + <param name="min_coverage" type="integer" value="0" label="Require at least this coverage to process a site" help="-! --min-coverage; default=0 " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + + <!-- population and mappability priors --> + + <conditional name="population_mappability_priors"> + <param name="population_mappability_priors_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Set population and mappability priors?" help="Sets -k, -w, -V, and -a options " /> + <when value="set"> + <param name="k" type="boolean" truevalue="-k" falsevalue="" checked="False" label="No population priors" help="-k --no-population-priors; default=False. Equivalent to --pooled-discrete --hwe-priors-off and removal of Ewens Sampling Formula component of priors." /> + <param name="w" type="boolean" truevalue="-w" falsevalue="" checked="False" label="Disable estimation of the probability of the combination arising under HWE given the allele frequency as estimated by observation frequency" help="-w --hwe-priors-off; default=False" /> + <param name="V" type="boolean" truevalue="-V" falsevalue="" checked="False" label="Disable incorporation of prior expectations about observations" help="-V --binomial-obs-priors-off; default=False. Uses read placement probability, strand balance probability, and read position (5''-3'') probability." /> + <param name="a" type="boolean" truevalue="-a" falsevalue="" checked="False" label="isable use of aggregate probability of observation balance between alleles as a component of the priors" help="-a --allele-balance-priors-off; default=False " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + + <!-- genotype likelihoods --> + + <conditional name="genotype_likelihoods"> + <param name="genotype_likelihoods_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Tweak genotype likelihoods?" help="Sets --base-quality-cap, --experimental-gls, and --prob-contamination options. " /> + <when value="set"> + <param name="base_quality_cap" type="integer" value="0" label="Limit estimated observation quality by capping base quality at" help="--base-quality-cap" /> + <param name="experimental_gls" type="boolean" truevalue="--experimental-gls" falsevalue="" checked="False" label="Generate genotype likelihoods using 'effective base depth' metric qual = 1-BaseQual * 1-MapQual" help="--experimental-gls; Incorporate partial observations. This is the default when contamination estimates are provided. Optimized for diploid samples." /> + <param name="prob_contamination" type="float" value="10e-9" label="An estimate of contamination to use for all samples. " help="--prob-contamination; default=10e-9." /> + </when> + <when value="do_not_set"> + <!-- do nothing --> + </when> + </conditional> + + <!-- algorithmic features --> + + <conditional name="algorithmic_features"> + <param name="algorithmic_features_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Tweak algorithmic features?" help="Sets --report-genotypes-likelihood-max, -B, --genotyping-max-banddepth, -W, -N, S, -j, -H, -D, -= options " /> + <when value="set"> + <param name="report_genotype_likelihood_max" type="boolean" truevalue="--report-genotype-likelihood-max" falsevalue="" checked="False" label="Report genotypes using the maximum-likelihood estimate provided from genotype likelihoods." help="--report-genotype-likelihood-max; default=False" /> + <param name="B" type="integer" value="1000" label="Iterate no more than N times during genotyping step" help="-B --genotyping-max-iterations; default=1000." /> + <param name="genotyping_max_banddepth" type="integer" value="6" label="Integrate no deeper than the Nth best genotype by likelihood when genotyping" help="--genotyping-max-banddepth; default=6" /> + <param name="W" type="text" size="8" value="1,3" label="Integrate all genotype combinations in our posterior space which include no more than N (1) samples with their Mth (3) best data likelihood" help="-W --posterior-integration-limits; default=1,3" /> + <param name="N" type="boolean" truevalue="--exclude-unobserved-genotypes" falsevalue="" checked="False" label="Skip sample genotypings for which the sample has no supporting reads" help="-N --exclude-unobserved-genotypes; default=False" /> + <conditional name="genotype_variant_threshold"> + <param name="genotype_variant_threshold_selector" type="boolean" truevalue="set" falsevalue="do_not_set" label="Do you want to to limit posterior integration" help="-S --genotype-variant-threshold" /> <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="no_snps" type="boolean" truevalue="--no-snps" falsevalue="" checked="False" label="Ignore SNP alleles" /> - <param name="no_indels" type="boolean" truevalue="--no-indels" falsevalue="" checked="False" label="Ignore insertion and deletion alleles" /> - <param name="no_mnps" type="boolean" truevalue="--no-mnps" falsevalue="" checked="False" label="Ignore multi-nuceotide polymorphisms, MNPs" /> - <param name="no_complex" type="boolean" truevalue="--no-complex" falsevalue="" checked="False" label="Ignore complex events (composites of other classes)" /> - <param name="use_best_n_alleles" type="integer" label="Evaluate only the best N SNP alleles" value="0" min="0" help="Ranked by sum of supporting quality scores; Set to 0 to use all" /> - <param name="max_complex_gap" type="integer" label="Allow complex alleles with contiguous embedded matches of up to this length" value="" optional="True"/> - </when> - </conditional> - - <!-- indel realignment --> - <param name="left_align_indels" type="boolean" truevalue="--left-align-indels" falsevalue="" checked="False" label="Left-realign and merge gaps embedded in reads" /> - - <!-- input filters --> - <conditional name="section_input_filters_type"> - <param name="section_input_filters_type_selector" type="select" label="Set input filters options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> + <!-- do nothing --> </when> <when value="set"> - <param name="use_duplicate_reads" type="boolean" truevalue="--use-duplicate-reads" falsevalue="" checked="False" label="Include duplicate-marked alignments in the analysis" /> - <conditional name="quality_filter_type"> - <param name="quality_filter_type_selector" type="select" label="Apply Quality filters"> - <option value="standard_filters" selected="True">Apply standard</option> - <option value="apply_filters">Apply specified</option> - </param> - <when value="standard_filters"> - <!-- Do nothing here --> <!-- standard-filters --> - </when> - <when value="apply_filters"> - <param name="min_mapping_quality" type="integer" label="Exclude alignments from analysis if they have a mapping quality less than" value="0" /> - <param name="min_base_quality" type="integer" label="Exclude alleles from analysis if their supporting base quality less than" value="0" /> - <param name="min_supporting_quality_mq" type="integer" label="In order to consider an alternate allele, at least one supporting alignment must have mapping quality" value="0" /> - <param name="min_supporting_quality_bq" type="integer" label="In order to consider an alternate allele, at least one supporting alignment must have base quality" value="0" /> - </when> - </conditional> - <param name="mismatch_base_quality_threshold" type="integer" label="Count mismatches toward read-mismatch-limit if the base quality of the mismatch is >=" value="10" /> - <param name="read_mismatch_limit" type="integer" label="Exclude reads with more than N mismatches where each mismatch has base quality >= mismatch-base-quality-threshold" value="" optional="True" /> - <param name="read_max_mismatch_fraction" type="float" label="Exclude reads with more than N [0,1] fraction of mismatches where each mismatch has base quality >= mismatch-base-quality-threshold" value="1.0" /> - <param name="read_snp_limit" type="integer" label="Exclude reads with more than N base mismatches, ignoring gaps with quality >= mismatch-base-quality-threshold" value="" optional="True" /> - <param name="read_indel_limit" type="integer" label="Exclude reads with more than N separate gaps" value="" optional="True" /> - <param name="indel_exclusion_window" type="integer" label="Ignore portions of alignments this many bases from a putative insertion or deletion allele" value="0" /> - <param name="min_alternate_fraction" type="float" label="Require at least this fraction of observations supporting an alternate allele within a single individual in the in order to evaluate the position" value="0" /> - <param name="min_alternate_count" type="integer" label="Require at least this count of observations supporting an alternate allele within a single individual in order to evaluate the position" value="1" /> - <param name="min_alternate_qsum" type="integer" label="Require at least this sum of quality of observations supporting an alternate allele within a single individual in order to evaluate the position" value="0" /> - <param name="min_alternate_total" type="integer" label="Require at least this count of observations supporting an alternate allele within the total population in order to use the allele in analysis" value="1" /> - <param name="min_coverage" type="integer" label="Require at least this coverage to process a site" value="0" /> - </when> - </conditional> - - - <!-- bayesian priors --> - <conditional name="section_bayesian_priors_type"> - <param name="section_bayesian_priors_type_selector" type="select" label="Set bayesian priors options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="no_ewens_priors" type="boolean" truevalue="--no-ewens-priors" falsevalue="" checked="False" label="Turns off the Ewens' Sampling Formula component of the priors" /> - <param name="no_population_priors" type="boolean" truevalue="--no-population-priors" falsevalue="" checked="False" label="No population priors" help="Equivalent to --pooled --no-ewens-priors" /> - <param name="hwe_priors" type="boolean" truevalue="--hwe-priors" falsevalue="" checked="False" label="Use the probability of the combination arising under HWE given the allele frequency as estimated by observation frequency" /> + <param name="S" value="" type="integer" label="Limit posterior integration to samples where the second-best genotype likelihood is no more than log(N) from the highest genotype likelihood for the sample." help="-S --genotype-variant-threshold; default=~unbounded" /> </when> </conditional> - - <!-- observation prior expectations --> - <conditional name="section_observation_prior_expectations_type"> - <param name="section_observation_prior_expectations_type_selector" type="select" label="Set observation prior expectations options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="binomial_obs_priors" type="boolean" truevalue="--binomial-obs-priors" falsevalue="" checked="False" label="Incorporate expectations about osbervations into the priors, Uses read placement probability, strand balance probability, and read position (5'-3') probability" /> - <param name="allele_balance_priors" type="boolean" truevalue="--allele-balance-priors" falsevalue="" checked="False" label="Use aggregate probability of observation balance between alleles as a component of the priors. Best for observations with minimal inherent reference bias" /> - </when> - </conditional> - - - <!-- algorithmic features --> - <conditional name="section_algorithmic_features_type"> - <param name="section_algorithmic_features_type_selector" type="select" label="Set algorithmic features options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="site_selection_max_iterations" type="integer" label="Uses hill-climbing algorithm to search posterior space for N iterations to determine if the site should be evaluated." value="5" help="Set to 0 to prevent use of this algorithm for site selection, and to a low integer for improvide site selection at a slight performance penalty" /> - <param name="genotyping_max_iterations" type="integer" label="Iterate no more than N times during genotyping step" value="25" /> - <param name="genotyping_max_banddepth" type="integer" label="Integrate no deeper than the Nth best genotype by likelihood when genotyping" value="6" /> - <param name="posterior_integration_limits_n" type="integer" label="Posteriror integration limit N" help="Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood." value="1" /> - <param name="posterior_integration_limits_m" type="integer" label="Posteriror integration limit M" help="Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood." value="3" /> - <param name="no_permute" type="boolean" truevalue="--no-permute" falsevalue="" checked="False" label="Do not scale prior probability of genotype combination given allele frequency by the number of permutations of included genotypes" /> - <param name="exclude_unobserved_genotypes" type="boolean" truevalue="--exclude-unobserved-genotypes" falsevalue="" checked="False" label="Skip sample genotypings for which the sample has no supporting reads" /> - <param name="genotype_variant_threshold" type="integer" label="Limit posterior integration to samples where the second-best genotype likelihood is no more than log(N) from the highest genotype likelihood for the sample" value="" optional="True" /> - <param name="use_mapping_quality" type="boolean" truevalue="--use-mapping-quality" falsevalue="" checked="False" label="Use mapping quality of alleles when calculating data likelihoods" /> - <param name="read_dependence_factor" type="float" label="Incorporate non-independence of reads by scaling successive observations by this factor during data likelihood calculations" value="0.9" /> - <param name="no_marginals" type="boolean" truevalue="--no-marginals" falsevalue="" checked="False" label="Do not calculate the marginal probability of genotypes. Saves time and improves scaling performance in large populations" /> - </when> - </conditional> - - + <param name="j" type="boolean" truevalue="-j" falsevalue="" checked="False" label="Use mapping quality of alleles when calculating data likelihoods" help="-j --use-mapping-quality; default=False" /> + <param name="H" type="boolean" truevalue="-H" falsevalue="" checked="False" label="Use a weighted sum of base qualities around an indel, scaled by the distance from the indel" help="-H --harmonic-indel-quality; default=use a minimum Base Quality in flanking sequence." /> + <param name="D" type="float" value="0.9" label="Incorporate non-independence of reads by scaling successive observations by this factor during data likelihood calculations" help="-D --read-dependence-factor; default=0.9." /> + <param name="genotype_qualities" type="boolean" truevalue="--genotype-qualities" falsevalue="" checked="False" label="Calculate the marginal probability of genotypes and report as GQ in each sample field in the VCF output" help="-= --genotype-qualities; default=False " /> + </when> + <when value="do_not_set"> + <!-- do nothing --> </when> </conditional> + </when> + <when value="simple"> + <!-- do nothing --> + </when> + <when value="simple_w_filters"> + <!-- add standard-filters to command line --> + <param name="min_coverage" type="integer" value="0" label="Require at least this coverage to process a site" help="-! --min-coverage; default=0 " /> + </when> + <when value="naive"> + <!-- do nothing build command line using haplotype-length 0 min-alternate-count 1 min-alternate-fraction 0 pooled-continuous report-monomorphic --> + </when> + <when value="naive_w_filters"> + <!-- do nothing build command line using haplotype-length 0 min-alternate-count 1 min-alternate-fraction 0 pooled-continuous report-monomorphic standard-filters--> + <param name="min_coverage" type="integer" value="0" label="Require at least this coverage to process a site" help="-! --min-coverage; default=0 " /> + </when> + + <!-- We will not allow command line textboxes at this time + <when value="cline"> + <expand macro="optional_file_inputs" /> + + <param name="cline" size="60" type="text" value="-m 20 -q 30" label="Type command line tags here" help="All paremeters that DO NOT involve filenames can be typed here. Use "Do you want to provide additional inputs?" section above to control input and output files. For full syntax check help section below"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + <mapping initial="none"> + <add source="'" target="__sq__"/> + </mapping> + </sanitizer> + </param> + </when> + --> + +</conditional> + </inputs> <outputs> <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (variants)" /> <data format="bed" name="output_failed_alleles_bed" label="${tool.name} on ${on_string} (failed alleles)"> - <filter>options_type['options_type_selector'] == "advanced" and options_type['output_failed_alleles_option'] is True</filter> + <filter>( options_type['options_type_selector'] == 'cline' or options_type['options_type_selector'] == 'full' ) and options_type['optional_inputs']['optional_inputs_selector'] is True and options_type['optional_inputs']['output_failed_alleles_option'] is True</filter> </data> <data format="txt" name="output_trace" label="${tool.name} on ${on_string} (trace)"> - <filter>options_type['options_type_selector'] == "advanced" and options_type['output_trace_option'] is True</filter> + <filter>( options_type['options_type_selector'] == 'cline' or options_type['options_type_selector'] == 'full' ) and options_type['optional_inputs']['optional_inputs_selector'] is True and options_type['optional_inputs']['output_trace_option'] is True</filter> </data> </outputs> <tests> <test> <param name="reference_source_selector" value="history" /> - <param name="ref_file" ftype="fasta" value="phiX.fasta"/> - <param name="input_bam" ftype="bam" value="fake_phiX_reads_1.bam"/> - <param name="options_type_selector" value="basic"/> - <output name="output_vcf" file="freebayes_out_1.vcf.contains" compare="contains"/> + <param name="ref_file" ftype="fasta" value="freebayes-phix174.fasta"/> + <param name="input_bam" ftype="bam" value="freebayes-phix174.bam"/> + <param name="options_type_selector" value="simple"/> + <output name="output_vcf" file="freebayes-phix174-test1.vcf" compare="contains"/> </test> </tests> + <stdio> + <exit_code range="1:" /> + </stdio> <help> **What it does** -This tool uses FreeBayes to call SNPS given a reference sequence and a BAM alignment file. - -FreeBayes is a high-performance, flexible, and open-source Bayesian genetic variant detector. It operates on BAM alignment files, which are produced by most contemporary short-read aligners. +FreeBayes is a Bayesian genetic variant detector designed to find small polymorphisms, specifically SNPs (single-nucleotide polymorphisms), indels (insertions and deletions), MNPs (multi-nucleotide polymorphisms), and complex events (composite insertion and substitution events) smaller than the length of a short-read sequencing alignment. -In addition to substantial performance improvements over its predecessors (PolyBayes, GigaBayes, and BamBayes), it expands the scope of SNP and small-indel variant calling to populations of individuals with heterogeneous copy number. FreeBayes is currently under active development. +See https://github.com/ekg/freebayes for details on FreeBayes. -Go `here <http://bioinformatics.bc.edu/marthlab/FreeBayes>`_ for details on FreeBayes. +This Galaxy instance of FreeBayes corresponds to release 0.9.18 ------ -**Inputs** +**Description** -FreeBayes accepts an input aligned BAM file. +Privided BAM file(s) and a reference. FreeBayes will provide VCF output on standard out describing SNPs, indels, and complex variants in samples in the input alignments. + +By default, FreeBayes will consider variants supported by at least 2 observations in a single sample (-C) and also by at least 20% of the reads from a single sample (-F). These settings are suitable to low to high depth sequencing in haploid and diploid samples, but users working with polyploid or pooled samples may wish to adjust them depending on the characteristics of their sequencing data. +FreeBayes is capable of calling variant haplotypes shorter than a read length where multiple polymorphisms segregate on the same read. The maximum distance between polymorphisms phased in this way is determined by the --max-complex-gap, which defaults to 3bp. In practice, this can comfortably be set to half the read length. -**Outputs** +Ploidy may be set to any level (-p), but by default all samples are assumed to be diploid. FreeBayes can model per-sample and per-region variation in copy-number (-A) using a copy-number variation map. -The output is in the VCF format. +FreeBayes can act as a frequency-based pooled caller and describe variants and haplotypes in terms of observation frequency rather than called genotypes. To do so, use --pooled-continuous and set input filters to a suitable level. Allele observation counts will be described by AO and RO fields in the VCF output. ------- -**Settings**:: +**Galaxy-specific options** + +Galaxy allows six levels of control over FreeBayes options provided by **Choose parameter selection level** menu option. These are: - input and output: + 1. *Simple diploid calling*: The simples possible FreeBayes application. Equvalent of using FreeBayes with only a BAM input and no other parameter options. + 2. *Simple diploid calling with filtering and coverage*: Same as #1 plus two additional options: -0 (standard filters: --min-mapping-quality 30 --min-base-quality 20 --min-supporting-allele-qsum 0 --genotype-varinat-threshold 0) and --min-coverage. + 3. *Frequency-based pooled calling*: This is equivalent to using FreeBayes with the following options: --haplotype-length 0 --min-alternate-count 1 --min-alternate-fraction 0 --pooled-continuous --report-monomorphic. This is the best choice for calling varinats in mixtures such as viral, bacterial, or organellar genomes. + 4. *Frequency-based pooled calling with filtering and coverage*: Same as #3 but adds -0 and --min-coverage like in #2. + 5. *Complete list of all options*: Gives you full control by exposing all FreeBayes options as Galaxy widgets. - -b --bam FILE Add FILE to the set of BAM files to be analyzed. - -c --stdin Read BAM input on stdin. - -v --vcf FILE Output VCF-format results to FILE. - -f --fasta-reference FILE - Use FILE as the reference sequence for analysis. - An index file (FILE.fai) will be created if none exists. - If neither --targets nor --region are specified, FreeBayes - will analyze every position in this reference. +----- + +**FreeBayes options** + +.. class:: infomark + +Note that each Galaxy parameter widget corresponding to command line flags listed below: + +Input and output:: + -t --targets FILE Limit analysis to targets listed in the BED-format FILE. - -r --region <chrom>:<start_position>..<end_position> + -r --region chrom:start_position-end_position Limit analysis to the specified region, 0-base coordinates, - end_position not included (same as BED format). + end_position included. Either '-' or '..' maybe used as a separator. -s --samples FILE Limit analysis to samples listed (one per line) in the FILE. By default FreeBayes will analyze all samples in its input @@ -484,13 +613,15 @@ reference sequence, start, end, sample name, copy number ... for each region in each sample which does not have the default copy number as set by --ploidy. - -L --trace FILE Output an algorithmic trace to FILE. + --trace FILE Output an algorithmic trace to FILE. --failed-alleles FILE Write a BED file of the analyzed positions which do not pass --pvar to FILE. -@ --variant-input VCF Use variants reported in VCF file as input to the algorithm. - A report will be generated for every record in the VCF file. + Variants in this file will be treated as putative variants + even if there is not enough support in the data to pass + input filters. -l --only-use-input-alleles Only provide variant calls and genotype likelihoods for sites and alleles which are provided in the VCF input, and provide @@ -500,39 +631,48 @@ When specified, only variant alleles provided in this input VCF will be used for the construction of complex or haplotype alleles. + --report-all-haplotype-alleles + At sites where genotypes are made over haplotype alleles, + provide information about all alleles in output, not only + those which are called. + --report-monomorphic + Report even loci which appear to be monomorphic, and report all + considered alleles, even those which are not in called genotypes. + Loci which do not have any potential alternates have '.' for ALT. - reporting: +Reporting:: -P --pvar N Report sites if the probability that there is a polymorphism - at the site is greater than N. default: 0.0001 - -_ --show-reference-repeats - Calculate and show information about reference repeats in - the VCF output. + at the site is greater than N. default: 0.0. Note that post- + filtering is generally recommended over the use of this parameter. - population model: +Population model:: -T --theta N The expected mutation rate or pairwise nucleotide diversity among the population under analysis. This serves as the single parameter to the Ewens Sampling Formula prior model default: 0.001 -p --ploidy N Sets the default ploidy for the analysis to N. default: 2 - -J --pooled Assume that samples result from pooled sequencing. + -J --pooled-discrete + Assume that samples result from pooled sequencing. + Model pooled samples using discrete genotypes across pools. When using this flag, set --ploidy to the number of - alleles in each sample. + alleles in each sample or use the --cnv-map to define + per-sample ploidy. + -K --pooled-continuous + Output all alleles which pass input filters, regardles of + genotyping outcome or model. - reference allele: +Reference allele:: -Z --use-reference-allele This flag includes the reference allele in the analysis as if it is another sample from the same population. - -H --diploid-reference - If using the reference sequence as a sample (-Z), - treat it as diploid. default: false (reference is haploid) --reference-quality MQ,BQ Assign mapping quality of MQ to the reference allele at each site and base quality of BQ. default: 100,60 - allele scope: +Allele scope:: -I --no-snps Ignore SNP alleles. -i --no-indels Ignore insertion and deletion alleles. @@ -542,60 +682,70 @@ Evaluate only the best N SNP alleles, ranked by sum of supporting quality scores. (Set to 0 to use all; default: all) -E --max-complex-gap N - Allow complex alleles with contiguous embedded matches of up - to this length. - - indel realignment: + --haplotype-length N + Allow haplotype calls with contiguous embedded matches of up + to this length. (default: 3) + --min-repeat-size N + When assembling observations across repeats, require the total repeat + length at least this many bp. (default: 5) + --min-repeat-entropy N + To detect interrupted repeats, build across sequence until it has + entropy > N bits per bp. (default: 0, off) + --no-partial-observations + Exclude observations which do not fully span the dynamically-determined + detection window. (default, use all observations, dividing partial + support across matching haplotypes when generating haplotypes.) - -O --left-align-indels - Left-realign and merge gaps embedded in reads. default: false +Indel realignment:: - input filters: + -O --dont-left-align-indels + Turn off left-alignment of indels, which is enabled by default. + +Input filters:: -4 --use-duplicate-reads Include duplicate-marked alignments in the analysis. - default: exclude duplicates + default: exclude duplicates marked as such in alignments -m --min-mapping-quality Q Exclude alignments from analysis if they have a mapping - quality less than Q. default: 30 + quality less than Q. default: 1 -q --min-base-quality Q Exclude alleles from analysis if their supporting base - quality is less than Q. default: 20 - -R --min-supporting-quality MQ,BQ - In order to consider an alternate allele, at least one supporting - alignment must have mapping quality MQ, and one supporting - allele must have base quality BQ. default: 0,0, unset + quality is less than Q. default: 0 + -R --min-supporting-allele-qsum Q + Consider any allele in which the sum of qualities of supporting + observations is at least Q. default: 0 + -Y --min-supporting-mapping-qsum Q + Consider any allele in which and the sum of mapping qualities of + supporting reads is at least Q. default: 0 -Q --mismatch-base-quality-threshold Q Count mismatches toward --read-mismatch-limit if the base - quality of the mismatch is >= Q. default: 10 + quality of the mismatch is >= Q. default: 10 -U --read-mismatch-limit N Exclude reads with more than N mismatches where each mismatch - has base quality >= mismatch-base-quality-threshold. + has base quality >= mismatch-base-quality-threshold. default: ~unbounded -z --read-max-mismatch-fraction N Exclude reads with more than N [0,1] fraction of mismatches where - each mismatch has base quality >= mismatch-base-quality-threshold + each mismatch has base quality >= mismatch-base-quality-threshold default: 1.0 -$ --read-snp-limit N Exclude reads with more than N base mismatches, ignoring gaps - with quality >= mismatch-base-quality-threshold. + with quality >= mismatch-base-quality-threshold. default: ~unbounded -e --read-indel-limit N Exclude reads with more than N separate gaps. default: ~unbounded -0 --standard-filters Use stringent input base and mapping quality filters Equivalent to -m 30 -q 20 -R 0 -S 0 - -x --indel-exclusion-window - Ignore portions of alignments this many bases from a - putative insertion or deletion allele. default: 0 -F --min-alternate-fraction N Require at least this fraction of observations supporting an alternate allele within a single individual in the - in order to evaluate the position. default: 0.0 + in order to evaluate the position. default: 0.2 -C --min-alternate-count N Require at least this count of observations supporting an alternate allele within a single individual in order - to evaluate the position. default: 1 + to evaluate the position. default: 2 -3 --min-alternate-qsum N Require at least this sum of quality of observations supporting an alternate allele within a single individual in order @@ -607,36 +757,54 @@ -! --min-coverage N Require at least this coverage to process a site. default: 0 - bayesian priors: +Population priors:: - -Y --no-ewens-priors - Turns off the Ewens' Sampling Formula component of the priors. -k --no-population-priors - Equivalent to --pooled --no-ewens-priors - -w --hwe-priors Use the probability of the combination arising under HWE given - the allele frequency as estimated by observation frequency. + Equivalent to --pooled-discrete --hwe-priors-off and removal of + Ewens Sampling Formula component of priors. + +Mappability priors:: - observation prior expectations: - - -V --binomial-obs-priors - Incorporate expectations about osbervations into the priors, + -w --hwe-priors-off + Disable estimation of the probability of the combination + arising under HWE given the allele frequency as estimated + by observation frequency. + -V --binomial-obs-priors-off + Disable incorporation of prior expectations about observations. Uses read placement probability, strand balance probability, and read position (5'-3') probability. - -a --allele-balance-priors - Use aggregate probability of observation balance between alleles - as a component of the priors. Best for observations with minimal - inherent reference bias. + -a --allele-balance-priors-off + Disable use of aggregate probability of observation balance between alleles + as a component of the priors. - algorithmic features: +Genotype likelihoods:: - -M --site-selection-max-iterations N - Uses hill-climbing algorithm to search posterior space for N - iterations to determine if the site should be evaluated. Set to 0 - to prevent use of this algorithm for site selection, and - to a low integer for improvide site selection at a slight - performance penalty. default: 5. + --observation-bias FILE + Read length-dependent allele observation biases from FILE. + The format is [length] [alignment efficiency relative to reference] + where the efficiency is 1 if there is no relative observation bias. + --base-quality-cap Q + Limit estimated observation quality by capping base quality at Q. + --experimental-gls + Generate genotype likelihoods using 'effective base depth' metric + qual = 1-BaseQual * 1-MapQual. Incorporate partial observations. + This is the default when contamination estimates are provided. + Optimized for diploid samples. + --prob-contamination F + An estimate of contamination to use for all samples. default: 10e-9 + --contamination-estimates FILE + A file containing per-sample estimates of contamination, such as + those generated by VerifyBamID. The format should be: + sample p(read=R|genotype=AR) p(read=A|genotype=AA) + Sample '*' can be used to set default contamination estimates. + +Algorithmic features:: + + --report-genotype-likelihood-max + Report genotypes using the maximum-likelihood estimate provided + from genotype likelihoods. -B --genotyping-max-iterations N - Iterate no more than N times during genotyping step. default: 25. + Iterate no more than N times during genotyping step. default: 1000. --genotyping-max-banddepth N Integrate no deeper than the Nth best genotype by likelihood when genotyping. default: 6. @@ -644,9 +812,6 @@ Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood. default: 1,3. - -K --no-permute - Do not scale prior probability of genotype combination given allele - frequency by the number of permutations of included genotypes. -N --exclude-unobserved-genotypes Skip sample genotypings for which the sample has no supporting reads. -S --genotype-variant-threshold N @@ -655,13 +820,16 @@ genotype likelihood for the sample. default: ~unbounded -j --use-mapping-quality Use mapping quality of alleles when calculating data likelihoods. + -H --harmonic-indel-quality + Use a weighted sum of base qualities around an indel, scaled by the + distance from the indel. By default use a minimum BQ in flanking sequence. -D --read-dependence-factor N Incorporate non-independence of reads by scaling successive observations by this factor during data likelihood calculations. default: 0.9 - -= --no-marginals - Do not calculate the marginal probability of genotypes. Saves - time and improves scaling performance in large populations. + -= --genotype-qualities + Calculate the marginal probability of genotypes and report as GQ in + each sample field in the VCF output. ------ @@ -670,7 +838,17 @@ For the underlying tool, please cite `Erik Garrison and Gabor Marth. Haplotype-based variant detection from short-read sequencing <http://arxiv.org/abs/1207.3907>`_. -If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* +The initial version of the wrapper was produced by Dan Blankenberg and upgraded by Anton Nekrutenko. </help> + + <citations> + <citation type="bibtex">@misc{1207.3907, +Author = {Erik Garrison}, +Title = {Haplotype-based variant detection from short-read sequencing}, +Year = {2012}, +Eprint = {arXiv:1207.3907}, +url = {http://arxiv.org/abs/1207.3907}, +}</citation> + </citations> </tool>
--- a/sam_fa_indices.loc.sample Mon Dec 16 13:29:20 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,28 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of Samtools indexed sequences data files. You will need -#to create these data files and then create a sam_fa_indices.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The sam_fa_indices.loc -#file has this format (white space characters are TAB characters): -# -#index <seq> <location> -# -#So, for example, if you had hg18 indexed stored in -#/depot/data2/galaxy/sam/, -#then the sam_fa_indices.loc entry would look like this: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -# -#and your /depot/data2/galaxy/sam/ directory -#would contain hg18.fa and hg18.fa.fai files: -# -#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa -#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai -# -#Your sam_fa_indices.loc file should include an entry per line for -#each index set you have stored. The file in the path does actually -#exist, but it should never be directly used. Instead, the name serves -#as a prefix for the index file. For example: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -#index hg19 /depot/data2/galaxy/sam/hg19.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/freebayes-phix174-test1.vcf Thu Dec 11 18:38:34 2014 -0500 @@ -0,0 +1,27 @@ +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT unknown +phiX174 311 . A G 6.48411 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=7.35324;EPPR=5.80219;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=33.5714;NS=1;NUMALT=1;ODDS=1.23853;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=478;RO=7;RPP=7.35324;RPPR=3.32051;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=5;SRP=5.80219;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:478:2:70:-5.49703,0,-10 +phiX174 374 . T G 30.6931 . AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=37;MQMR=25;NS=1;NUMALT=1;ODDS=7.0665;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=75;QR=141;RO=2;RPP=3.0103;RPPR=7.35324;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=7.35324;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:4:2:141:2:75:-6.69903,0,-10 +phiX174 913 . A C 13.1703 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.0103;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=29;NS=1;NUMALT=1;ODDS=2.98318;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=58;QR=171;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=3;SRP=9.52472;SRR=0;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:171:2:58:-5.00485,0,-10 +phiX174 1205 . A C 2.30262 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=34;NS=1;NUMALT=1;ODDS=0.357718;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=456;RO=8;RPP=7.35324;RPPR=7.35324;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=7.35324;SRR=6;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:456:2:67:-5.00791,0,-10 +phiX174 1245 . G T 6.48411 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=7.35324;EPPR=3.32051;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=28.4286;NS=1;NUMALT=1;ODDS=1.23853;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=389;RO=7;RPP=7.35324;RPPR=3.32051;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=18.2106;SRR=7;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:389:2:70:-5.49703,0,-10 +phiX174 1249 . T G 15.3287 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=3.0103;EPPR=3.32051;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=30.1429;NS=1;NUMALT=1;ODDS=3.4998;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=74;QR=464;RO=7;RPP=3.0103;RPPR=5.80219;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=5.80219;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:464:2:74:-5.87703,0,-10 +phiX174 1445 . C A 24.4745 . AB=0.285714;ABP=5.80219;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=7.35324;EPPR=6.91895;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=32.2;NS=1;NUMALT=1;ODDS=5.63189;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=273;RO=5;RPP=3.0103;RPPR=6.91895;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=2;SRP=3.44459;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:7:5:273:2:76:-6.43501,0,-10 +phiX174 1577 . A C 4.06305 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=7.35324;EPPR=3.32051;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=35.2857;NS=1;NUMALT=1;ODDS=0.437365;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=60;QR=460;RO=7;RPP=3.0103;RPPR=10.7656;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=4;SRP=3.32051;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:460:2:60:-4.54703,0,-10 +phiX174 1631 . T G 2.719 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=4.09604;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=28;NS=1;NUMALT=1;ODDS=0.138972;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=500;RO=8;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=3;SRP=4.09604;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:500:2:68:-5.10291,0,-10 +phiX174 1772 . T G 2.16317 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=3.0103;EPPR=3.32051;GTI=0;LEN=1;MEANALT=2;MQM=31;MQMR=31.8571;NS=1;NUMALT=1;ODDS=0.437618;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=59;QR=425;RO=7;RPP=3.0103;RPPR=3.32051;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=10.7656;SRR=6;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:7:425:2:59:-4.16703,0,-10 +phiX174 1945 . T G 11.7103 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=37;NS=1;NUMALT=1;ODDS=2.62656;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=59;QR=263;RO=4;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=3.0103;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:263:2:59:-4.97491,0,-10 +phiX174 2230 . T G 1.61813 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=35.5;NS=1;NUMALT=1;ODDS=0.795209;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=65;QR=491;RO=8;RPP=7.35324;RPPR=4.09604;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=3;SRP=4.09604;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:491:2:65:-4.81791,0,-10 +phiX174 2699 . C A 31.6424 . AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=37;NS=1;NUMALT=1;ODDS=7.28525;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=109;RO=2;RPP=3.0103;RPPR=3.0103;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=7.35324;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:4:2:109:2:76:-6.79403,0,-9.92903 +phiX174 2722 . T G 21.5364 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=7.35324;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=33;NS=1;NUMALT=1;ODDS=4.95189;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=150;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=9.52472;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:150:2:67:-5.85985,0,-10 +phiX174 2814 . T G 8.81714 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.0103;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=33;NS=1;NUMALT=1;ODDS=1.88946;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=53;QR=135;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=9.52472;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:135:2:53:-4.52985,0,-10 +phiX174 2828 . T G 37.7173 . AB=0.25;ABP=7.35324;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=31;NS=1;NUMALT=1;ODDS=8.68456;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=100;QR=348;RO=6;RPP=7.35324;RPPR=4.45795;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=8.80089;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:8:6:348:2:100:-8.53892,0,-10 +phiX174 2983 . T G 12.2712 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.0103;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=33;NS=1;NUMALT=1;ODDS=2.76444;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=57;QR=150;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=3.73412;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:150:2:57:-4.90985,0,-10 +phiX174 3110 . T C 34.4848 . AB=0.333333;ABP=5.18177;AC=1;AF=0.5;AN=2;AO=3;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=3.73412;EPPR=4.45795;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=35;NS=1;NUMALT=1;ODDS=7.94006;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=94;QR=361;RO=6;RPP=9.52472;RPPR=3.0103;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=1;SRP=8.80089;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:6:361:3:94:-7.98834,0,-10 +phiX174 3155 . T G 23.5283 . AB=0.285714;ABP=5.80219;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=3.0103;EPPR=3.44459;GTI=0;LEN=1;MEANALT=1;MQM=37;MQMR=29.8;NS=1;NUMALT=1;ODDS=5.41314;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=75;QR=299;RO=5;RPP=3.0103;RPPR=3.44459;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=4;SRP=6.91895;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:7:5:299:2:75:-6.34001,0,-10 +phiX174 3325 . A C 5.77196 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=31;NS=1;NUMALT=1;ODDS=1.02152;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=58;QR=284;RO=4;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=3;SRP=5.18177;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:284:2:58:-4.87991,0,-10 +phiX174 3418 . A C 0.61163 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=34;NS=1;NUMALT=1;ODDS=1.88894;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=60;QR=526;RO=8;RPP=7.35324;RPPR=4.09604;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=5;SRP=4.09604;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:526:2:60:-4.34291,0,-10 +phiX174 3729 . C T 8.03017 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=37;NS=1;NUMALT=1;ODDS=1.67776;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=61;QR=232;RO=4;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=11.6962;SRR=4;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:232:2:61:-5.16491,0,-10 +phiX174 4031 . T G 23.4861 . AB=0.25;ABP=7.35324;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=7.35324;EPPR=4.45795;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=27;NS=1;NUMALT=1;ODDS=5.40338;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=85;QR=322;RO=6;RPP=7.35324;RPPR=8.80089;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=3;SRP=3.0103;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:8:6:322:2:85:-7.11392,0,-10 +phiX174 4502 . A C 8.30185 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=37;NS=1;NUMALT=1;ODDS=1.75158;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=55;QR=284;RO=4;RPP=3.0103;RPPR=11.6962;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=3;SRP=5.18177;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:284:2:55:-4.59491,0,-10 +phiX174 4558 . C G 6.48999 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=28;NS=1;NUMALT=1;ODDS=1.24027;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=59;QR=204;RO=4;RPP=7.35324;RPPR=11.6962;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=2;SRP=3.0103;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:204:2:59:-4.97491,0,-10 +phiX174 4655 . T G 21.8853 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=3.0103;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=37;NS=1;NUMALT=1;ODDS=5.03277;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=193;RO=4;RPP=3.0103;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=11.6962;SRR=4;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:193:2:70:-6.01991,0,-10
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/freebayes-phix174.fasta Thu Dec 11 18:38:34 2014 -0500 @@ -0,0 +1,2 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCATCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCgTGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGCCGGGCAATAAtGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGACCAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTaCTATTCAGCGTTTGATGAATGCAATGCGACAGGCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGCCGTCTTCATTTCCATGCGGTGCAtTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
--- a/test-data/freebayes_out_1.output_trace Mon Dec 16 13:29:20 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -phiX174,1411,allele,phiX174,phiX174,A,60,100 -phiX174,1412,allele,phiX174,phiX174,G,60,100 -phiX174,1413,allele,phiX174,phiX174,C,60,100 -phiX174,1414,allele,phiX174,phiX174,G,60,100 -phiX174,1415,allele,phiX174,phiX174,C,60,100 -phiX174,1416,allele,phiX174,phiX174,C,60,100 -phiX174,1417,allele,phiX174,phiX174,G,60,100 -phiX174,1418,allele,phiX174,phiX174,T,60,100
--- a/test-data/freebayes_out_1.vcf.contains Mon Dec 16 13:29:20 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/leftalign.fa Thu Dec 11 18:38:34 2014 -0500 @@ -0,0 +1,2 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCATCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCgTGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGCCGGGCAATAAtGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGACCAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTaCTATTCAGCGTTTGATGAATGCAATGCGACAGGCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGCCGTCTTCATTTCCATGCGGTGCAtTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
--- a/test-data/phiX.fasta Mon Dec 16 13:29:20 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,79 +0,0 @@ ->phiX174 -GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT -GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA -ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG -TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA -GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC -TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT -TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT -CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT -TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG -TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC -GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA -CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG -TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT -AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC -CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA -TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC -TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA -CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA -GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT -GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA -ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC -TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT -TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC -ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC -CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT -GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC -CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC -TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG -TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT -TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA -AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT -TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT -ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC -GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC -TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT -TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA -TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG -TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC -CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG -AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC -CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT -TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG -CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA -AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT -GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG -GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA -TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT -CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG -TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA -GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC -CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA -TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA -AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC -TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT -CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA -TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG -TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT -CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT -TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC -ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG -TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA -ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG -GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC -CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT -GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG -GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT -ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG -CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC -CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC -GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT -CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG -CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA -TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT -TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG -TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC -AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC -TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Thu Dec 11 18:38:34 2014 -0500 @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/tool_data_table_conf.xml.sample Thu Dec 11 18:38:34 2014 -0500 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of SAMTools indexes for FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables>
--- a/tool_data_table_conf.xml.sample Mon Dec 16 13:29:20 2013 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> -<tables> - <!-- Location of SAMTools indexes and other files --> - <table name="sam_fa_indexes" comment_char="#"> - <columns>line_type, value, path</columns> - <file path="tool-data/sam_fa_indices.loc" /> - </table> -</tables>
--- a/tool_dependencies.xml Mon Dec 16 13:29:20 2013 -0500 +++ b/tool_dependencies.xml Thu Dec 11 18:38:34 2014 -0500 @@ -1,9 +1,9 @@ <?xml version="1.0"?> <tool_dependency> - <package name="freebayes" version="0.9.6_9608597d12e127c847ae03aa03440ab63992fedf"> - <repository changeset_revision="102fc9b0884c" name="package_freebayes_0_9_6_9608597d" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + <package name="freebayes" version="0.9.18_0059bdf"> + <repository changeset_revision="0873b583229a" name="package_freebayes_0_9_18_0059bdf" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> </package> <package name="samtools" version="0.1.18"> - <repository changeset_revision="c0f72bdba484" name="package_samtools_0_1_18" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + <repository changeset_revision="c0f72bdba484" name="package_samtools_0_1_18" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> </package> </tool_dependency>