changeset 0:9246516d9dd5

Uploaded
author devteam
date Tue, 20 Aug 2013 10:47:58 -0400
parents
children 460c78dbadf8
files fastx_collapser.xml test-data/fasta_collapser1.fasta test-data/fasta_collapser1.out tool_dependencies.xml
diffstat 4 files changed, 204 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_collapser.xml	Tue Aug 20 10:47:58 2013 -0400
@@ -0,0 +1,90 @@
+<tool id="cshl_fastx_collapser" version="1.0.0" name="Collapse">
+	<description>sequences</description>
+    <requirements>
+        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
+    </requirements>
+	<command>zcat -f '$input' | fastx_collapser -v -o '$output' 
+#if $input.ext == "fastqsanger":
+-Q 33
+#end if
+	</command>
+
+	<inputs>
+		<param format="fasta,fastqsanger,fastqsolexa" version="1.0.0" name="input" type="data" label="Library to collapse" />
+	</inputs>
+
+    <!-- The order of sequences in the test output differ between 32 bit and 64 bit machines. 
+	<tests>
+		<test>
+			<param version="1.0.0" name="input" value="fasta_collapser1.fasta" />
+			<output version="1.0.0" name="output" file="fasta_collapser1.out" />
+		</test>
+	</tests>
+    -->
+	<outputs>
+		<data format="fasta" version="1.0.0" name="output" metadata_source="input" />
+	</outputs>
+  <help>
+
+**What it does**
+
+This tool collapses identical sequences in a FASTA file into a single sequence.
+
+--------
+
+**Example**
+
+Example Input File (Sequence "ATAT" appears multiple times):: 
+
+    >CSHL_2_FC0042AGLLOO_1_1_605_414
+    TGCG
+    >CSHL_2_FC0042AGLLOO_1_1_537_759
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_774_520
+    TGGC
+    >CSHL_2_FC0042AGLLOO_1_1_742_502
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_781_514
+    TGAG
+    >CSHL_2_FC0042AGLLOO_1_1_757_487
+    TTCA
+    >CSHL_2_FC0042AGLLOO_1_1_903_769
+    ATAT
+    >CSHL_2_FC0042AGLLOO_1_1_724_499
+    ATAT
+
+Example Output file::
+
+    >1-1
+    TGCG
+    >2-4
+    ATAT
+    >3-1
+    TGGC
+    >4-1
+    TGAG
+    >5-1
+    TTCA
+    
+.. class:: infomark
+
+Original Sequence Names / Lane descriptions (e.g. "CSHL_2_FC0042AGLLOO_1_1_742_502") are discarded. 
+
+The output sequence name is composed of two numbers: the first is the sequence's number, the second is the multiplicity value.
+
+The following output::
+
+    >2-4
+    ATAT
+
+means that the sequence "ATAT" is the second sequence in the file, and it appeared 4 times in the input FASTA file.
+
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+ 
+</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_collapser1.fasta	Tue Aug 20 10:47:58 2013 -0400
@@ -0,0 +1,84 @@
+>1
+TGTATTTACAATGACTAGAAA
+>2
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>3
+AGTACAAGGACATGC
+>4
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>5
+AGTACAAGGACATGC
+>6
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>7
+AGTACAAGGACATGC
+>8
+AGTACAAGGACATGC
+>9
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>10
+AGTACAAGGACATGC
+>11
+AGTACAAGGACATGC
+>12
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>13
+CGATTGCCGAAGTCTACCA
+>14
+AGTACAAGGACATGC
+>15
+CCTTGTAGTGGATTCTGATGA
+>16
+AGTACAAGGACATGC
+>17
+AGTACAAGGACATGC
+>18
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>19
+AGTACAAGGACATGC
+>20
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>21
+AGTACAAGGACATGC
+>22
+AGTACAAGGACATGC
+>23
+CTGCTGCGATCGGTGTGC
+>24
+AGTACAAGGACATGC
+>25
+ACCATTCGAGCATAC
+>26
+AGTACAAGGACATGC
+>27
+TCAAATTCTAGATTTTTACGG
+>28
+AGTACAAGGACATGC
+>29
+TGATTTCCAGAGCCAAT
+>30
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>31
+TTACCTCACGATATTGTAATA
+>32
+ATGACTTCATCGTCCACCCTTTAGAACT
+>33
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>34
+TTCAACGCCGCCGTGAAC
+>35
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>36
+CTGCTGCGATCGGTGTGC
+>37
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>38
+TTCAACGCCGCCGTGAAC
+>39
+TTCAACGCCGCCGTGAAC
+>40
+CTGCTGCGATCGGTGTGC
+>41
+TTCAACGCCGCCGTGAAC
+>42
+TTCAACGCCGCCGTGAAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_collapser1.out	Tue Aug 20 10:47:58 2013 -0400
@@ -0,0 +1,24 @@
+>1-15
+AGTACAAGGACATGC
+>2-11
+ATTGCTGCTCGGATGGTCCGGCTGTGCACAC
+>3-5
+TTCAACGCCGCCGTGAAC
+>4-3
+CTGCTGCGATCGGTGTGC
+>5-1
+TCAAATTCTAGATTTTTACGG
+>6-1
+ACCATTCGAGCATAC
+>7-1
+TGATTTCCAGAGCCAAT
+>8-1
+TTACCTCACGATATTGTAATA
+>9-1
+TGTATTTACAATGACTAGAAA
+>10-1
+CCTTGTAGTGGATTCTGATGA
+>11-1
+CGATTGCCGAAGTCTACCA
+>12-1
+ATGACTTCATCGTCCACCCTTTAGAACT
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Tue Aug 20 10:47:58 2013 -0400
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="fastx_toolkit" version="0.0.13">
+        <repository changeset_revision="1cd326991d32" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>