Mercurial > repos > devteam > fastq_to_fasta

changeset 2:44ed3f74ea7a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
author iuc
date Tue, 08 May 2018 12:50:22 -0400
parents 3f358f73d45e
children 4498e994e31b
files fastq_to_fasta.xml macros.xml test-data/fastq_to_fasta-in2.fastq test-data/fastq_to_fasta-out2.out tool_dependencies.xml
diffstat 5 files changed, 167 insertions(+), 56 deletions(-) [+]
line wrap: on
line diff
--- a/fastq_to_fasta.xml	Tue Oct 13 12:40:10 2015 -0400
+++ b/fastq_to_fasta.xml	Tue May 08 12:50:22 2018 -0400
@@ -1,52 +1,54 @@
-<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="1.0.0">
-	<description>converter</description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-	<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
-#if $input.ext == "fastqsanger":
--Q 33
-#end if
-	</command>
-
-	<inputs>
-		<param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />
-
-		<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
-			<option value="">yes</option>
-			<option value="-n">no</option>
-		</param>
-
-		<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
-			<option value="-r">yes</option>
-			<option value="">no</option>
-		</param>
-
-	</inputs>
-
-	<tests>
-		<test>
-			<!-- FASTQ-To-FASTA, keep N, don't rename -->
-			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
-			<param name="SKIPN" value=""/>
-			<param name="RENAMESEQ" value=""/>
-			<output name="output" file="fastq_to_fasta1a.out" />
-		</test>
-		<test>
-			<!-- FASTQ-To-FASTA, discard N, rename -->
-			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
-			<param name="SKIPN" value="no"/>
-			<param name="RENAMESEQ" value="yes"/>
-			<output name="output" file="fastq_to_fasta1b.out" />
-		</test>
-	</tests>
-
-	<outputs>
-		<data format="fasta" name="output" metadata_source="input" />
-	</outputs>
-
-<help>
-
+<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="1.0.1">
+    <description>converter from FASTX-toolkit</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command detect_errors="exit_code"><![CDATA[
+@CATS@ fastq_to_fasta
+$SKIPN
+$RENAMESEQ
+-o '$output'
+-v @FQQUAL@
+    ]]></command>
+    <inputs>
+        <expand macro="fastq_input" />
+        <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
+            <option value="">yes</option>
+            <option value="-n">no</option>
+        </param>
+        <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
+            <option value="-r">yes</option>
+            <option value="">no</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="output" format="fasta" metadata_source="input" />
+    </outputs>
+    <tests>
+        <test>
+            <!-- FASTQ-To-FASTA, keep N, don't rename -->
+            <param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
+            <param name="SKIPN" value=""/>
+            <param name="RENAMESEQ" value=""/>
+            <output name="output" file="fastq_to_fasta1a.out" />
+        </test>
+        <test>
+            <!-- FASTQ-To-FASTA, discard N, rename -->
+            <param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
+            <param name="SKIPN" value="no"/>
+            <param name="RENAMESEQ" value="yes"/>
+            <output name="output" file="fastq_to_fasta1b.out" />
+        </test>
+        <test>
+            <!-- FASTQ-To-FASTA, discard N, rename -->
+            <param name="input" value="fastq_to_fasta-in2.fastq" ftype="fastqsanger" />
+            <param name="SKIPN" value="no"/>
+            <param name="RENAMESEQ" value="yes"/>
+            <output name="output" file="fastq_to_fasta-out2.out" />
+        </test>
+    </tests>
+    <help><![CDATA[
 **What it does**
 
 This tool converts data from Solexa format to FASTA format (scroll down for format description).
@@ -77,6 +79,7 @@
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
  .. __: http://hannonlab.cshl.edu/fastx_toolkit/
-</help>
+    ]]></help>
+    <expand macro="citations" />
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
 </tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Tue May 08 12:50:22 2018 -0400
@@ -0,0 +1,54 @@
+<?xml version="1.0"?>
+<macros>
+    <token name="@CATS@">
+        #if $input.is_of_type('fasta.gz', 'fastqsanger.gz', 'fastqsolexa.gz', 'fastqillumina.gz'):
+            zcat -f '$input' |
+        #elif $input.is_of_type('fastqsanger.bz2', 'fastqsolexa.bz2', 'fastqillumina.bz2'):
+            bzcat -f '$input' |
+        #else:
+            cat '$input' |
+        #end if
+    </token>
+    <token name="@FQQUAL@">
+        <![CDATA[
+            #if $input.is_of_type('fastqsanger', 'fastqsanger.gz', 'fastqsanger.bz2'):
+                -Q 33
+            #elif $input.is_of_type('fastqsolexa', 'fastqsolexa.gz', 'fastqsolexa.bz2', 'fastqillumina', 'fastqillumina.gz', 'fastqillumina.bz2'):
+                -Q 64
+            #end if
+        ]]>
+    </token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@VERSION@">fastx_toolkit</requirement>
+            <yield />
+        </requirements>
+    </xml>
+    <token name="@VERSION@">0.0.14</token>
+    <token name="@SANGER@">fastqsanger,fastqsanger.gz,fastqsanger.bz2</token>
+    <token name="@SOLEXA@">fastqsolexa,fastqsolexa.gz,fastqsolexa.bz2</token>
+    <token name="@ILLUMINA@">fastqillumina,fastqillumina.gz,fastqillumina.bz2</token>
+    <token name="@FASTQS@">@SANGER@,@SOLEXA@,@ILLUMINA@</token>
+    <token name="@FASTAS@">fasta,fasta.gz</token>
+    <xml name="citations">
+        <citations>
+            <citation type="bibtex">
+                @UNPUBLISHED{agordon,
+                    author = "Assaf Gordon",
+                    title = "FASTQ/A short-reads pre-processing tools",
+                    year = "2010",
+                    note = "http://hannonlab.cshl.edu/fastx_toolkit/",
+                    url = "http://hannonlab.cshl.edu/fastx_toolkit/"}
+            </citation>
+        </citations>
+    </xml>
+    <xml name="fasta_input">
+        <param name="input" type="data" format="@FASTAS@" label="Input FASTA file" />
+    </xml>
+    <xml name="fastq_input">
+        <param name="input" type="data" format="@FASTQS@" label="Input FASTQ file" />
+    </xml>
+    <xml name="fastx_input">
+        <param name="input" type="data" format="@FASTAS@,@FASTQS@" label="Input file in FASTA or FASTQ format" />
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_fasta-in2.fastq	Tue May 08 12:50:22 2018 -0400
@@ -0,0 +1,40 @@
+@CSHL_3_FC0420AGLLKK:2:1:233:1674
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:233:1674
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 32 40 40 40 40 16 20 25 9 21 37 40 40 16 29 26 30
+@CSHL_3_FC0420AGLLKK:2:1:136:448
+GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA
++CSHL_3_FC0420AGLLKK:2:1:136:448
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -5 13 17 28 40 40 8 17 27 8 13 10
+@CSHL_3_FC0420AGLLKK:2:1:237:1037
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:237:1037
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 26 35 40 38 40 6 40 40 0 3 26 32 27 14 11 26 11
+@CSHL_3_FC0420AGLLKK:2:1:1805:1464
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1805:1464
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 28 40 21 40 9 37 13 20 21 7 11 14 14 6 23 10
+@CSHL_3_FC0420AGLLKK:2:1:126:1087
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
++CSHL_3_FC0420AGLLKK:2:1:126:1087
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 40 40 40 40 40 31 40 40 11 10 23 40 13 12 17 37 17 22
+@CSHL_3_FC0420AGLLKK:2:1:1488:1323
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:1488:1323
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 22 31 40 40 12 29 22 0 7 12 8 18 7 3 18 9
+@CSHL_3_FC0420AGLLKK:2:1:913:199
+GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:913:199
+40 40 39 40 40 40 40 40 40 40 40 40 4 40 40 24 34 20 33 21 36 32 40 -5 40 13 21 21 26 17 18 25 14 25 21
+@CSHL_3_FC0420AGLLKK:2:1:928:765
+GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC
++CSHL_3_FC0420AGLLKK:2:1:928:765
+40 40 40 40 40 40 40 40 40 40 40 40 40 25 27 40 37 35 27 40 40 17 40 -5 36 11 19 15 19 16 11 12 12 23 11
+@CSHL_3_FC0420AGLLKK:2:1:727:1020
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
++CSHL_3_FC0420AGLLKK:2:1:727:1020
+40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 30 40 40 24 18 38 33 26 16 23 22 16 18
+@CSHL_3_FC0420AGLLKK:2:1:758:1799
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
++CSHL_3_FC0420AGLLKK:2:1:758:1799
+40 40 40 40 40 40 40 40 35 40 39 40 40 27 20 40 17 34 15 40 40 40 40 15 28 17 4 12 10 10 18 14 3 14 11
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_fasta-out2.out	Tue May 08 12:50:22 2018 -0400
@@ -0,0 +1,20 @@
+>1
+GTTAGAGGGAATACACCCACTCTGTAGGCACCATC
+>2
+GTTCTCAGGACCCCTTCAGTAGTNGGCACCATCAA
+>3
+GTGATAGATTGTCTTGTTGTTCTGTAGGCACCATC
+>4
+GATGCGTTCGAGATGGGTGCGCTGTAGGCACCATC
+>5
+GAGATATTCGAATGCATCATCAGATGGCACCATCA
+>6
+GTTTTTTCCCCTAATCTGAGTCTGTAGGCACCATC
+>7
+GTTCAGTGTTGGTGCACTGTGTTNTAGGCACCATC
+>8
+GTTTTCAGTTCGAGGTTCGTGCTNTAGGCATTATC
+>9
+GTAATATAGTTGATAAGAATCTGCAGAGAGAATCA
+>10
+GTAGAGACCCCCTAATAGAGTCTGTAGGCACCATC
--- a/tool_dependencies.xml	Tue Oct 13 12:40:10 2015 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="e76e81b3eccf" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" />
-    </package>
-</tool_dependency>