Mercurial > repos > devteam > fastq_paired_end_joiner
view fastq_paired_end_joiner.xml @ 1:ce853b881881 draft
Uploaded version 2.0.0 of tool.
author | devteam |
---|---|
date | Mon, 07 Jul 2014 15:17:40 -0400 |
parents | d86b8db06e05 |
children | ab37758348d0 |
line wrap: on
line source
<tool id="fastq_paired_end_joiner" name="FASTQ joiner" version="2.0.0"> <description>on paired end reads</description> <requirements> <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement> </requirements> <command interpreter="python">fastq_paired_end_joiner.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$output_file' '$style'</command> <inputs> <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand Reads" /> <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand Reads" /> <param name="style" type="select" label="FASTQ Header Style"> <option value="old" selected="true">old</option> <option value="new">new</option> </param> </inputs> <outputs> <data name="output_file" format="input" /> </outputs> <tests> <test> <param name="input1_file" value="split_pair_reads_1.fastqsanger" ftype="fastqsanger" /> <param name="input2_file" value="split_pair_reads_2.fastqsanger" ftype="fastqsanger" /> <output name="output_file" file="3.fastqsanger" /> </test> </tests> <help> **What it does** This tool joins paired end FASTQ reads from two separate files into a single read in one file. The join is performed using sequence identifiers, allowing the two files to contain differing ordering. If a sequence identifier does not appear in both files, it is excluded from the output. ----- **Input formats** Both old and new (from recent Illumina software) style FASTQ headers are supported. The following example uses the "old" style. Left-hand Read:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Right-hand Read:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR ----- **Output** A multiple-fastq file, for example:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA +HWI-EAS91_1_30788AAXX:7:21:1542:1758 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR ------ **The "new" style** Recent Illumina FASTQ headers are structured as follows:: @COORDS FLAGS COORDS = INSTRUMENT:RUN_#:FLOWCELL_ID:LANE:TILE:X:Y FLAGS = READ:IS_FILTERED:CONTROL_NUMBER:INDEX_SEQUENCE where the whitespace character between COORDS and FLAGS can be either a space or a tab. ------ **Credits** This is an extended version (adds support for "new" style FASTQ headers) of D. Blankenberg's fastq joiner: `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ New style header support added by Simone Leo <simone.leo@crs4.it> </help> </tool>