view fastq_paired_end_joiner.xml @ 0:d86b8db06e05 draft

Imported from capsule None

<tool id="fastq_paired_end_joiner" name="FASTQ joiner" version="1.0.0">
  <description>on paired end reads</description>
  <requirements>
    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
  </requirements>
  <command interpreter="python">fastq_paired_end_joiner.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$output_file'</command>
  <inputs>
    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand Reads" />
    <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand Reads" />
  </inputs>
  <outputs>
    <data name="output_file" format="input" />
  </outputs>
  <tests>
    <test>
      <param name="input1_file" value="split_pair_reads_1.fastqsanger" ftype="fastqsanger" />
      <param name="input2_file" value="split_pair_reads_2.fastqsanger" ftype="fastqsanger" />
      <output name="output_file" file="3.fastqsanger" />
    </test>
  </tests>
  <help>
**What it does**

This tool joins paired end FASTQ reads from two separate files into a single read in one file. The join is performed using sequence identifiers, allowing the two files to contain differing ordering. If a sequence identifier does not appear in both files, it is excluded from the output.

Sequence identifiers with /1 and /2 appended override the left-hand and right-hand designation; i.e. if the reads end with /1 and /2, the read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read. Sequences without this designation will follow the left-hand and right-hand settings set by the user.

-----

**Input formats**

Left-hand Read::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
    GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

Right-hand Read::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
    GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
    hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

-----

**Output**

A multiple-fastq file, for example::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758
    GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

------

**Citation**

If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_


  </help>
</tool>