Mercurial > repos > devteam > fasta_filter_by_length

changeset 3:70e730a51307 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_filter_by_length commit 66d6c3cbb835114dc80e61216756e90da156f6d6"
author devteam
date Tue, 17 Dec 2019 18:13:11 +0000
parents b9d17598aca0
children f8a4ac568c07
files fasta_filter_by_length.py fasta_filter_by_length.xml test-data/fasta_tool_filter_length_2.out
diffstat 3 files changed, 9 insertions(+), 1 deletions(-) [+]
line wrap: on
line diff
--- a/fasta_filter_by_length.py	Thu Jul 20 13:48:53 2017 -0400
+++ b/fasta_filter_by_length.py	Tue Dec 17 18:13:11 2019 +0000
@@ -38,7 +38,7 @@
             tmp_buf = line
             tmp_size = 0                                                       
         else:
-            if max_length == 0 or tmp_size < max_length:
+            if max_length == 0 or tmp_size <= max_length:
                 tmp_size += len(line.rstrip('\r\n'))
                 tmp_buf += line
     # final flush of buffer
--- a/fasta_filter_by_length.xml	Thu Jul 20 13:48:53 2017 -0400
+++ b/fasta_filter_by_length.xml	Tue Dec 17 18:13:11 2019 +0000
@@ -22,6 +22,12 @@
 			<param name="max_length" value="0" />
 			<output name="output" file="fasta_tool_filter_length_1.out" />
 		</test>
+		<test>
+			<param name="input" value="4.fasta" />
+			<param name="min_length" value="0" />
+			<param name="max_length" value="60" />
+			<output name="output" file="fasta_tool_filter_length_2.out" />
+		</test>
 	</tests>
 	<help>
 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_tool_filter_length_2.out	Tue Dec 17 18:13:11 2019 +0000
@@ -0,0 +1,2 @@
+>EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_
+CCGGTATCCGGGTGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGCCGAA