Mercurial > repos > devteam > fasta_clipping_histogram
changeset 3:d0969fa24eb1 draft
planemo upload commit 33927a87ba2eee9bf0ecdd376a66241b17b3d734
| author | devteam |
|---|---|
| date | Tue, 13 Oct 2015 12:38:50 -0400 |
| parents | 20e471a2fdc6 |
| children | 40ec4170291e |
| files | fasta_clipping_histogram.xml fasta_clipping_histogram_1.png fasta_clipping_histogram_2.png fasta_clipping_histogram_3.png fasta_clipping_histogram_4.png tool_dependencies.xml |
| diffstat | 6 files changed, 17 insertions(+), 26 deletions(-) [+] |
line wrap: on
line diff
--- a/fasta_clipping_histogram.xml Tue Jun 03 15:30:44 2014 -0400 +++ b/fasta_clipping_histogram.xml Tue Oct 13 12:38:50 2015 -0400 @@ -1,19 +1,20 @@ <tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0"> - <description>chart</description> + <description>chart</description> <requirements> <requirement type="package" version="0.0.13">fastx_toolkit</requirement> </requirements> - <command>fasta_clipping_histogram.pl $input $outfile</command> - - <inputs> - <param format="fasta" name="input" type="data" label="Library to analyze" /> - </inputs> + <command>fasta_clipping_histogram.pl $input $outfile</command> + + <inputs> + <param format="fasta" name="input" type="data" label="Library to analyze" /> + </inputs> - <outputs> - <data format="png" name="outfile" metadata_source="input" /> - </outputs> -<help> - + <outputs> + <data format="png" name="outfile" metadata_source="input" /> + </outputs> + <tests> + </tests> + <help> **What it does** This tool creates a histogram image of sequence lengths distribution in a given fasta dataset file. @@ -24,21 +25,18 @@ **Output Examples** -In the following library, most sequences are 24-mers to 27-mers. +In the following library, most sequences are 24-mers to 27-mers. This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place). .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_1.png - -In the following library, most sequences are 19,22 or 23-mers. +In the following library, most sequences are 19,22 or 23-mers. This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place). .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_2.png - ----- - **Input Formats** This tool accepts short-reads FASTA files. The reads don't have to be short, but they do have to be on a single line, like so:: @@ -50,7 +48,6 @@ >sequence3 CCTTGAGATTAACGCTAATCAAGTAAAC - If the sequences span over multiple lines:: >sequence1 @@ -63,11 +60,8 @@ >sequence1 CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG - ----- - - **Multiplicity counts (a.k.a reads-count)** If the sequence identifier (the text after the '>') contains a dash and a number, it is treated as a multiplicity count value (i.e. how many times that individual sequence repeated in the original FASTA file, before collapsing). @@ -85,7 +79,6 @@ .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_3.png - Example 2 - The following FASTA file have multiplicity counts:: >seq1-2 @@ -106,7 +99,5 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - -</help> -<!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> -</tool> \ No newline at end of file + </help> +</tool>
--- a/tool_dependencies.xml Tue Jun 03 15:30:44 2014 -0400 +++ b/tool_dependencies.xml Tue Oct 13 12:38:50 2015 -0400 @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="e76e81b3eccf" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + <repository changeset_revision="e76e81b3eccf" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> </package> </tool_dependency>