Mercurial > repos > devteam > fasta_clipping_histogram

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fasta_clipping_histogram.xml	Wed Sep 25 14:38:48 2013 -0400
@@ -0,0 +1,112 @@
+<tool id="cshl_fasta_clipping_histogram" name="Length Distribution">
+	<description>chart</description>
+    <requirements>
+        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
+    </requirements>
+	<command>fasta_clipping_histogram.pl $input $outfile</command>
+
+	<inputs>
+		<param format="fasta" name="input" type="data" label="Library to analyze" />
+	</inputs>
+
+	<outputs>
+		<data format="png" name="outfile" metadata_source="input" />
+	</outputs>
+<help>
+
+**What it does**
+
+This tool creates a histogram image of sequence lengths distribution in a given fasta dataset file.
+
+**TIP:** Use this tool after clipping your library (with **FASTX Clipper tool**), to visualize the clipping results.
+
+-----
+
+**Output Examples**
+
+In the following library, most sequences are 24-mers to 27-mers.
+This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place).
+
+.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_1.png
+
+
+In the following library, most sequences are 19,22 or 23-mers.
+This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place).
+
+.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_2.png
+
+
+-----
+
+
+**Input Formats**
+
+This tool accepts short-reads FASTA files. The reads don't have to be short, but they do have to be on a single line, like so::
+
+   >sequence1
+   AGTAGTAGGTGATGTAGAGAGAGAGAGAGTAG
+   >sequence2
+   GTGTGTGTGGGAAGTTGACACAGTA
+   >sequence3
+   CCTTGAGATTAACGCTAATCAAGTAAAC
+
+
+If the sequences span over multiple lines::
+
+   >sequence1
+   CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAG
+   TCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAG
+   aactggtctttacctTTAAGTTG
+
+Use the **FASTA Width Formatter** tool to re-format the FASTA into a single-lined sequences::
+
+   >sequence1
+   CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG
+
+
+-----
+
+
+
+**Multiplicity counts (a.k.a reads-count)**
+
+If the sequence identifier (the text after the '>') contains a dash and a number, it is treated as a multiplicity count value (i.e. how many times that individual sequence repeated in the original FASTA file, before collapsing).
+
+Example 1 - The following FASTA file *does not* have multiplicity counts::
+
+    >seq1
+    GGATCC
+    >seq2
+    GGTCATGGGTTTAAA
+    >seq3
+    GGGATATATCCCCACACACACACAC
+
+Each sequence is counts as one, to produce the following chart:
+
+.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_3.png
+
+
+Example 2 - The following FASTA file have multiplicity counts::
+
+    >seq1-2
+    GGATCC
+    >seq2-10
+    GGTCATGGGTTTAAA
+    >seq3-3
+    GGGATATATCCCCACACACACACAC
+
+The first sequence counts as 2, the second as 10, the third as 3, to produce the following chart:
+
+.. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_4.png
+
+Use the **FASTA Collapser** tool to create FASTA files with multiplicity counts.
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
+</help>
+</tool>
+<!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Wed Sep 25 14:38:48 2013 -0400
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+    <package name="fastx_toolkit" version="0.0.13">
+        <repository changeset_revision="e76e81b3eccf" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://testtoolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>