Mercurial > repos > devteam > depth_of_coverage
changeset 0:6d46b7a39a08 draft default tip
Imported from capsule None
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/depth_of_coverage.xml Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,743 @@ +<tool id="gatk_depth_of_coverage" name="Depth of Coverage" version="0.0.2"> + <description>on BAM files</description> + <requirements> + <requirement type="package" version="1.4">gatk</requirement> + <requirement type="package" version="0.1.18">samtools</requirement> + </requirements> + <macros> + <import>gatk_macros.xml</import> + </macros> + <command interpreter="python">gatk_wrapper.py + --max_jvm_heap_fraction "1" + --stdout "${output_log}" + #for $i, $input_bam in enumerate( $reference_source.input_bams ): + -d "-I" "${input_bam.input_bam}" "${input_bam.input_bam.ext}" "gatk_input_${i}" + #if str( $input_bam.input_bam.metadata.bam_index ) != "None": + -d "" "${input_bam.input_bam.metadata.bam_index}" "bam_index" "gatk_input_${i}" ##hardcode galaxy ext type as bam_index + #end if + #end for + -p 'java + -jar "\$JAVA_JAR_PATH/GenomeAnalysisTK.jar" + -T "DepthOfCoverage" + ##--num_threads 4 ##hard coded, for now + + -et "NO_ET" ##ET no phone home + #if $reference_source.reference_source_selector != "history": + -R "${reference_source.ref_file.fields.path}" + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + --calculateCoverageOverGenes "${input_calculate_coverage_over_genes}" + #end if + #if str( $partition_type ) != "None": + #for $pt in str( $partition_type ).split( ',' ): + --partitionType "${pt}" + #end for + #end if + --out "${output_per_locus_coverage}" + + #for $ct_group in $summary_coverage_threshold_group: + --summaryCoverageThreshold "${ct_group.summary_coverage_threshold}" + #end for + --outputFormat "${output_format}" + ' + + #include source=$standard_gatk_options# + ##start analysis specific options + #if $analysis_param_type.analysis_param_type_selector == "advanced": + -p ' + ${analysis_param_type.ignore_deletion_sites} + ${analysis_param_type.include_deletions} + --maxBaseQuality "${analysis_param_type.max_base_quality}" + --maxMappingQuality "${analysis_param_type.max_mapping_quality}" + --minBaseQuality "${analysis_param_type.min_base_quality}" + --minMappingQuality "${analysis_param_type.min_mapping_quality}" + --nBins "${analysis_param_type.n_bins}" + ${analysis_param_type.omit_depth_output_at_each_base} + ${analysis_param_type.omit_interval_statistics} + ${analysis_param_type.omit_locus_table} + ${analysis_param_type.omit_per_sample_stats} + ${analysis_param_type.print_base_counts} + ${analysis_param_type.print_bin_endpoints_and_exit} + --start "${analysis_param_type.start}" + --stop "${analysis_param_type.stop}" + ' + #end if + ##Move additional files to final location + #if str( $partition_type ) != "None": + #set $partition_types = str( $partition_type ).split( ',' ) + #else: + #set $partition_types = [ 'sample' ] + #end if + #if 'sample' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ): + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "": + && mv ${output_per_locus_coverage}.sample_summary ${output_summary_sample} + && mv ${output_per_locus_coverage}.sample_statistics ${output_statistics_sample} + #end if + #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ): + && mv ${output_per_locus_coverage}.sample_interval_summary ${output_interval_summary_sample} + && mv ${output_per_locus_coverage}.sample_interval_statistics ${output_interval_statistics_sample} + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + && mv ${output_per_locus_coverage}.sample_gene_summary ${output_gene_summary_sample} + && mv ${output_per_locus_coverage}.sample_gene_statistics ${output_gene_statistics_sample} + #end if + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "": + && mv ${output_per_locus_coverage}.sample_cumulative_coverage_counts ${output_cumulative_coverage_counts_sample} + && mv ${output_per_locus_coverage}.sample_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_sample} + #end if + #end if + + #if 'readgroup' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ): + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "": + && mv ${output_per_locus_coverage}.read_group_summary ${output_summary_readgroup} + && mv ${output_per_locus_coverage}.read_group_statistics ${output_statistics_readgroup} + #end if + #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ): + && mv ${output_per_locus_coverage}.read_group_interval_summary ${output_interval_summary_readgroup} + && mv ${output_per_locus_coverage}.read_group_interval_statistics ${output_interval_statistics_readgroup} + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + && mv ${output_per_locus_coverage}.read_group_gene_summary ${output_gene_summary_readgroup} + && mv ${output_per_locus_coverage}.read_group_gene_statistics ${output_gene_statistics_readgroup} + #end if + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "": + && mv ${output_per_locus_coverage}.read_group_cumulative_coverage_counts ${output_cumulative_coverage_counts_readgroup} + && mv ${output_per_locus_coverage}.read_group_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_readgroup} + #end if + #end if + + #if 'library' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ): + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "": + && mv ${output_per_locus_coverage}.library_summary ${output_summary_library} + && mv ${output_per_locus_coverage}.library_statistics ${output_statistics_library} + #end if + #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ): + && mv ${output_per_locus_coverage}.library_interval_summary ${output_interval_summary_library} + && mv ${output_per_locus_coverage}.library_interval_statistics ${output_interval_statistics_library} + #end if + #if str( $input_calculate_coverage_over_genes ) != "None": + && mv ${output_per_locus_coverage}.library_gene_summary ${output_gene_summary_library} + && mv ${output_per_locus_coverage}.library_gene_statistics ${output_gene_statistics_library} + #end if + #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "": + && mv ${output_per_locus_coverage}.library_cumulative_coverage_counts ${output_cumulative_coverage_counts_library} + && mv ${output_per_locus_coverage}.library_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_library} + #end if + #end if + + + </command> + <inputs> + <conditional name="reference_source"> + <expand macro="reference_source_selector_param" /> + <when value="cached"> + <repeat name="input_bams" title="BAM file" min="1" help="-I,--input_file &lt;input_file&gt;"> + <param name="input_bam" type="data" format="bam" label="BAM file"> + <validator type="unspecified_build" /> + <validator type="dataset_metadata_in_data_table" table_name="gatk_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select --> + </param> + </repeat> + <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &lt;reference_sequence&gt;"> + <options from_data_table="gatk_picard_indexes"> + <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...--> + </options> + <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> + </param> + </when> + <when value="history"> <!-- FIX ME!!!! --> + <repeat name="input_bams" title="BAM file" min="1" help="-I,--input_file &lt;input_file&gt;"> + <param name="input_bam" type="data" format="bam" label="BAM file" /> + </repeat> + <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &lt;reference_sequence&gt;" /> + </when> + </conditional> + + <param name="input_calculate_coverage_over_genes" type="data" format="data" label="RefSeq Rod" optional="True" help="-geneList,--calculateCoverageOverGenes &lt;calculateCoverageOverGenes&gt;" /> + + <param name="partition_type" type="select" label="Partition type for depth of coverage" multiple="True" display="checkboxes" help="-pt,--partitionType &lt;partitionType&gt;"> + <option value="sample" selected="True">sample</option> + <option value="readgroup">readgroup</option> + <option value="library">library</option> + </param> + + <repeat name="summary_coverage_threshold_group" title="Summary coverage threshold" help="-ct,--summaryCoverageThreshold &lt;summaryCoverageThreshold&gt;"> + <param name="summary_coverage_threshold" type="integer" value="15" label="for summary file outputs, report the % of bases covered to >= this number" /> + </repeat> + + <param name="output_format" type="select" label="Output format" help="--outputFormat &lt;outputFormat&gt;" > + <option value="csv">csv</option> + <option value="table">table</option> + <option value="rtable" selected="True">rtable</option> + </param> + + <expand macro="gatk_param_type_conditional" /> + + <expand macro="analysis_type_conditional"> + <param name="ignore_deletion_sites" type="boolean" truevalue="--ignoreDeletionSites" falsevalue="" checked="False" label="Ignore sites consisting only of deletions" help="--ignoreDeletionSites" /> + <param name="include_deletions" type="boolean" truevalue="--includeDeletions" falsevalue="" checked="False" label="Include information on deletions" help="-dels,--includeDeletions" /> + <param name="max_base_quality" type="integer" value="127" label="Maximum quality of bases to count towards depth" help="--maxBaseQuality &lt;maxBaseQuality&gt;" /> + <param name="min_base_quality" type="integer" value="-1" label="Minimum quality of bases to count towards depth" help="-mbq,--minBaseQuality &lt;minBaseQuality&gt;" /> + <param name="max_mapping_quality" type="integer" value="2147483647" label="Maximum mapping quality of reads to count towards depth." help="--maxMappingQuality &lt;maxMappingQuality&gt;" /> + <param name="min_mapping_quality" type="integer" value="127" label="Minimum mapping quality of reads to count towards depth" help="-mmq,--minMappingQuality &lt;minMappingQuality&gt;" /> + <param name="n_bins" type="integer" value="499" label="Number of bins to use for granular binning" help="--nBins &lt;nBins&gt;" /> + <param name="omit_depth_output_at_each_base" type="boolean" truevalue="--omitDepthOutputAtEachBase" falsevalue="" checked="False" label="Omit the output of the depth of coverage at each base" help="-omitBaseOutput,--omitDepthOutputAtEachBase" /> + <param name="omit_interval_statistics" type="boolean" truevalue="--omitIntervalStatistics" falsevalue="" checked="False" label="Omit the per-interval statistics section" help="-omitIntervals,--omitIntervalStatistics" /> + <param name="omit_locus_table" type="boolean" truevalue="--omitLocusTable" falsevalue="" checked="False" label="Do not calculate the per-sample per-depth counts of loci" help="-omitLocusTable,--omitLocusTable" /> + <param name="omit_per_sample_stats" type="boolean" truevalue="--omitPerSampleStats" falsevalue="" checked="False" label="Omit the summary files per-sample." help="-omitSampleSummary,--omitPerSampleStats" /> + <param name="print_base_counts" type="boolean" truevalue="--printBaseCounts" falsevalue="" checked="False" label="Add base counts to per-locus output" help="-baseCounts,--printBaseCounts" /> + <param name="print_bin_endpoints_and_exit" type="boolean" truevalue="--printBinEndpointsAndExit" falsevalue="" checked="False" label="Print the bin values and exits immediately" help="--printBinEndpointsAndExit" /> + <param name="start" type="integer" value="1" label="Starting (left endpoint) for granular binning" help="--start &lt;start&gt;" /> + <param name="stop" type="integer" value="500" label="Ending (right endpoint) for granular binning" help="--stop &lt;stop&gt;" /> + </expand> + </inputs> + <outputs> + <data format="tabular" name="output_per_locus_coverage" label="${tool.name} on ${on_string} (per locus coverage)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_summary_sample" label="${tool.name} on ${on_string} (output summary sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_statistics_sample" label="${tool.name} on ${on_string} (output statistics sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_summary_sample" label="${tool.name} on ${on_string} (output interval summary sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_statistics_sample" label="${tool.name} on ${on_string} (output interval statistics sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_summary_sample" label="${tool.name} on ${on_string} (output gene summary sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_statistics_sample" label="${tool.name} on ${on_string} (output gene statistics sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_counts_sample" label="${tool.name} on ${on_string} (output cumulative coverage counts sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_proportions_sample" label="${tool.name} on ${on_string} (output cumulative coverage proportions sample)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'sample' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + + <data format="tabular" name="output_summary_readgroup" label="${tool.name} on ${on_string} (output summary readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_statistics_readgroup" label="${tool.name} on ${on_string} (output statistics readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_summary_readgroup" label="${tool.name} on ${on_string} (output interval summary readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_statistics_readgroup" label="${tool.name} on ${on_string} (output interval statistics readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_summary_readgroup" label="${tool.name} on ${on_string} (output gene summary readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_statistics_readgroup" label="${tool.name} on ${on_string} (output gene statistics readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_counts_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage counts readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_proportions_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage proportions readgroup)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>'readgroup' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + + <data format="tabular" name="output_summary_library" label="${tool.name} on ${on_string} (output summary library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_statistics_library" label="${tool.name} on ${on_string} (output statistics library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_summary_library" label="${tool.name} on ${on_string} (output interval summary library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_interval_statistics_library" label="${tool.name} on ${on_string} (output interval statistics library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_summary_library" label="${tool.name} on ${on_string} (output gene summary library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_gene_statistics_library" label="${tool.name} on ${on_string} (output gene statistics library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_counts_library" label="${tool.name} on ${on_string} (output cumulative coverage counts library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="tabular" name="output_cumulative_coverage_proportions_library" label="${tool.name} on ${on_string} (output cumulative coverage proportions library)" > + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter> + <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter> + <filter>'library' in partition_type</filter> + <actions> + <conditional name="output_format"> + <when value="rtable"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + <when value="csv"> + <action type="format"> + <option type="from_param" name="output_format" /> + </action> + </when> + </conditional> + </actions> + </data> + + <data format="tabular" name="output_log" label="${tool.name} on ${on_string} (log)" /> + </outputs> + <trackster_conf/> + <tests> + <test> + <param name="reference_source_selector" value="history" /> + <param name="ref_file" value="phiX.fasta" ftype="fasta" /> + <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" /> + <param name="input_calculate_coverage_over_genes" /> + <param name="partition_type" value="sample" /> + <param name="summary_coverage_threshold_group" value="0" /> + <param name="output_format" value="rtable" /> + <param name="gatk_param_type_selector" value="basic" /> + <param name="analysis_param_type_selector" value="basic" /> + <output name="output_per_locus_coverage" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular" /> + <output name="output_summary_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular" /> + <output name="output_statistics_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular" /> + <output name="output_cumulative_coverage_counts_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular" /> + <output name="output_cumulative_coverage_proportions_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular" /> + <output name="output_log" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains" compare="contains" /> + </test> + </tests> + <help> +**What it does** + +DepthOfCoverage processes a set of bam files to determine coverage at different levels of partitioning and aggregation. Coverage can be analyzed per locus, per interval, per gene, or in total; can be partitioned by sample, by read group, by technology, by center, or by library; and can be summarized by mean, median, quartiles, and/or percentage of bases covered to or beyond a threshold. Additionally, reads and bases can be filtered by mapping or base quality score. + +For more information on the GATK Depth of Coverage, see this `tool specific page <http://www.broadinstitute.org/gsa/wiki/index.php/Depth_of_Coverage>`_. + +To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gsa/wiki/index.php/Best_Practice_Variant_Detection_with_the_GATK_v3>`_. + +If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions>`_. + +------ + +**Inputs** + +GenomeAnalysisTK: DepthOfCoverage accepts aligned BAM input files. + + +**Outputs** + +The output is in various table formats. + + +Go `here <http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK>`_ for details on GATK file formats. + +------- + +**Settings**:: + + calculateCoverageOverGenes File NA Calculate the coverage statistics over this list of genes. Currently accepts RefSeq. + ignoreDeletionSites boolean false Ignore sites consisting only of deletions + includeDeletions boolean false Include information on deletions + maxBaseQuality byte 127 Maximum quality of bases to count towards depth. Defaults to 127 (Byte.MAX_VALUE). + maxMappingQuality int 2147483647 Maximum mapping quality of reads to count towards depth. Defaults to 2^31-1 (Integer.MAX_VALUE). + minBaseQuality byte -1 Minimum quality of bases to count towards depth. Defaults to -1. + minMappingQuality int -1 Minimum mapping quality of reads to count towards depth. Defaults to -1. + nBins int 499 Number of bins to use for granular binning + omitDepthOutputAtEachBase boolean false Will omit the output of the depth of coverage at each base, which should result in speedup + omitIntervalStatistics boolean false Will omit the per-interval statistics section, which should result in speedup + omitLocusTable boolean false Will not calculate the per-sample per-depth counts of loci, which should result in speedup + omitPerSampleStats boolean false Omits the summary files per-sample. These statistics are still calculated, so this argument will not improve runtime. + outputFormat String rtable the format of the output file (e.g. csv, table, rtable); defaults to r-readable table + partitionType Set[Partition] [sample] Partition type for depth of coverage. Defaults to sample. Can be any combination of sample, readgroup, library. + printBaseCounts boolean false Will add base counts to per-locus output. + printBinEndpointsAndExit boolean false Prints the bin values and exits immediately. Use to calibrate what bins you want before running on data. + start int 1 Starting (left endpoint) for granular binning + stop int 500 Ending (right endpoint) for granular binning + summaryCoverageThreshold int[] [15] for summary file outputs, report the % of bases coverd to >= this number. Defaults to 15; can take multiple arguments. + +@CITATION_SECTION@ + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk_macros.xml Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,305 @@ +<macros> + <template name="standard_gatk_options"> + ##start standard gatk options + #if $gatk_param_type.gatk_param_type_selector == "advanced": + #for $pedigree in $gatk_param_type.pedigree: + -p '--pedigree "${pedigree.pedigree_file}"' + #end for + #for $pedigree_string in $gatk_param_type.pedigree_string_repeat: + -p '--pedigreeString "${pedigree_string.pedigree_string}"' + #end for + -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"' + #for $read_filter in $gatk_param_type.read_filter: + -p '--read_filter "${read_filter.read_filter_type.read_filter_type_selector}" + ###raise Exception( str( dir( $read_filter ) ) ) + #for $name, $param in $read_filter.read_filter_type.iteritems(): + #if $name not in [ "__current_case__", "read_filter_type_selector" ]: + #if hasattr( $param.input, 'truevalue' ): + ${param} + #else: + --${name} "${param}" + #end if + #end if + #end for + ' + #end for + #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ): + -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}" + #end for + + #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ): + -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}" + #end for + + -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"' + + -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"' + #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE": + -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"' + #end if + -p ' + --baq "${gatk_param_type.baq}" + --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}" + ${gatk_param_type.use_original_qualities} + --defaultBaseQualities "${gatk_param_type.default_base_qualities}" + --validation_strictness "${gatk_param_type.validation_strictness}" + --interval_merging "${gatk_param_type.interval_merging}" + ${gatk_param_type.disable_experimental_low_memory_sharding} + ${gatk_param_type.non_deterministic_random_seed} + ' + #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ): + #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file": + -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}" + #else + -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"' + #end if + #end for + #end if + + #if str( $reference_source.reference_source_selector ) == "history": + -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input" + #end if + ##end standard gatk options + </template> + <xml name="gatk_param_type_conditional"> + <conditional name="gatk_param_type"> + <param name="gatk_param_type_selector" type="select" label="Basic or Advanced GATK options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <repeat name="pedigree" title="Pedigree file" help="-ped,--pedigree &lt;pedigree&gt;"> + <param name="pedigree_file" type="data" format="txt" label="Pedigree files for samples"/> + </repeat> + <repeat name="pedigree_string_repeat" title="Pedigree string" help="-pedString,--pedigreeString &lt;pedigreeString&gt;"> + <param name="pedigree_string" type="text" value="" label="Pedigree string for samples"/> + </repeat> + <param name="pedigree_validation_type" type="select" label="How strict should we be in validating the pedigree information" help="-pedValidationType,--pedigreeValidationType &lt;pedigreeValidationType&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="SILENT">SILENT</option> + </param> + <repeat name="read_filter" title="Read Filter" help="-rf,--read_filter &lt;read_filter&gt;"> + <conditional name="read_filter_type"> + <param name="read_filter_type_selector" type="select" label="Read Filter Type"> + <option value="BadCigar">BadCigar</option> + <option value="BadMate">BadMate</option> + <option value="DuplicateRead">DuplicateRead</option> + <option value="FailsVendorQualityCheck">FailsVendorQualityCheck</option> + <option value="MalformedRead">MalformedRead</option> + <option value="MappingQuality">MappingQuality</option> + <option value="MappingQualityUnavailable">MappingQualityUnavailable</option> + <option value="MappingQualityZero">MappingQualityZero</option> + <option value="MateSameStrand">MateSameStrand</option> + <option value="MaxInsertSize">MaxInsertSize</option> + <option value="MaxReadLength" selected="True">MaxReadLength</option> + <option value="MissingReadGroup">MissingReadGroup</option> + <option value="NoOriginalQualityScores">NoOriginalQualityScores</option> + <option value="NotPrimaryAlignment">NotPrimaryAlignment</option> + <option value="Platform454">Platform454</option> + <option value="Platform">Platform</option> + <option value="PlatformUnit">PlatformUnit</option> + <option value="ReadGroupBlackList">ReadGroupBlackList</option> + <option value="ReadName">ReadName</option> + <option value="ReadStrand">ReadStrand</option> + <option value="ReassignMappingQuality">ReassignMappingQuality</option> + <option value="Sample">Sample</option> + <option value="SingleReadGroup">SingleReadGroup</option> + <option value="UnmappedRead">UnmappedRead</option> + </param> + <when value="BadCigar"> + <!-- no extra options --> + </when> + <when value="BadMate"> + <!-- no extra options --> + </when> + <when value="DuplicateRead"> + <!-- no extra options --> + </when> + <when value="FailsVendorQualityCheck"> + <!-- no extra options --> + </when> + <when value="MalformedRead"> + <!-- no extra options --> + </when> + <when value="MappingQuality"> + <param name="min_mapping_quality_score" type="integer" value="10" label="Minimum read mapping quality required to consider a read for calling"/> + </when> + <when value="MappingQualityUnavailable"> + <!-- no extra options --> + </when> + <when value="MappingQualityZero"> + <!-- no extra options --> + </when> + <when value="MateSameStrand"> + <!-- no extra options --> + </when> + <when value="MaxInsertSize"> + <param name="maxInsertSize" type="integer" value="1000000" label="Discard reads with insert size greater than the specified value"/> + </when> + <when value="MaxReadLength"> + <param name="maxReadLength" type="integer" value="76" label="Max Read Length"/> + </when> + <when value="MissingReadGroup"> + <!-- no extra options --> + </when> + <when value="NoOriginalQualityScores"> + <!-- no extra options --> + </when> + <when value="NotPrimaryAlignment"> + <!-- no extra options --> + </when> + <when value="Platform454"> + <!-- no extra options --> + </when> + <when value="Platform"> + <param name="PLFilterName" type="text" value="" label="Discard reads with RG:PL attribute containing this string"/> + </when> + <when value="PlatformUnit"> + <!-- no extra options --> + </when> + <when value="ReadGroupBlackList"> + <!-- no extra options --> + </when> + <when value="ReadName"> + <param name="readName" type="text" value="" label="Filter out all reads except those with this read name"/> + </when> + <when value="ReadStrand"> + <param name="filterPositive" type="boolean" truevalue="--filterPositive" falsevalue="" label="Discard reads on the forward strand"/> + </when> + <when value="ReassignMappingQuality"> + <param name="default_mapping_quality" type="integer" value="60" label="Default read mapping quality to assign to all reads"/> + </when> + <when value="Sample"> + <param name="sample_to_keep" type="text" value="" label="The name of the sample(s) to keep, filtering out all others"/> + </when> + <when value="SingleReadGroup"> + <param name="read_group_to_keep" type="integer" value="76" label="The name of the read group to keep, filtering out all others"/> + </when> + <when value="UnmappedRead"> + <!-- no extra options --> + </when> + </conditional> + </repeat> + <repeat name="input_interval_repeat" title="Operate on Genomic intervals" help="-L,--intervals &lt;intervals&gt;"> + <param name="input_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" /> + </repeat> + <repeat name="input_exclude_interval_repeat" title="Exclude Genomic intervals" help="-XL,--excludeIntervals &lt;excludeIntervals&gt;"> + <param name="input_exclude_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" /> + </repeat> + + <param name="interval_set_rule" type="select" label="Interval set rule" help="-isr,--interval_set_rule &lt;interval_set_rule&gt;"> + <option value="UNION" selected="True">UNION</option> + <option value="INTERSECTION">INTERSECTION</option> + </param> + + <conditional name="downsampling_type"> + <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &lt;downsampling_type&gt;"> + <option value="NONE" selected="True">NONE</option> + <option value="ALL_READS">ALL_READS</option> + <option value="BY_SAMPLE">BY_SAMPLE</option> + </param> + <when value="NONE"> + <!-- no more options here --> + </when> + <when value="ALL_READS"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + <when value="BY_SAMPLE"> + <conditional name="downsample_to_type"> + <param name="downsample_to_type_selector" type="select" label="Downsample method"> + <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option> + <option value="downsample_to_coverage">Downsample by Coverage</option> + </param> + <when value="downsample_to_fraction"> + <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &lt;downsample_to_fraction&gt;"/> + </when> + <when value="downsample_to_coverage"> + <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &lt;downsample_to_coverage&gt;"/> + </when> + </conditional> + </when> + </conditional> + <param name="baq" type="select" label="Type of BAQ calculation to apply in the engine" help="-baq,--baq &lt;baq&gt;"> + <option value="OFF" selected="True">OFF</option> + <option value="CALCULATE_AS_NECESSARY">CALCULATE_AS_NECESSARY</option> + <option value="RECALCULATE">RECALCULATE</option> + </param> + <param name="baq_gap_open_penalty" type="float" label="BAQ gap open penalty (Phred Scaled)" value="40" help="Default value is 40. 30 is perhaps better for whole genome call sets. -baqGOP,--baqGapOpenPenalty &lt;baqGapOpenPenalty&gt;" /> + <param name="use_original_qualities" type="boolean" truevalue="--useOriginalQualities" falsevalue="" label="Use the original base quality scores from the OQ tag" help="-OQ,--useOriginalQualities" /> + <param name="default_base_qualities" type="integer" label="Value to be used for all base quality scores, when some are missing" value="-1" help="-DBQ,--defaultBaseQualities &lt;defaultBaseQualities&gt;"/> + <param name="validation_strictness" type="select" label="How strict should we be with validation" help="-S,--validation_strictness &lt;validation_strictness&gt;"> + <option value="STRICT" selected="True">STRICT</option> + <option value="LENIENT">LENIENT</option> + <option value="SILENT">SILENT</option> + <!-- <option value="DEFAULT_STRINGENCY">DEFAULT_STRINGENCY</option> listed in docs, but not valid value...--> + </param> + <param name="interval_merging" type="select" label="Interval merging rule" help="-im,--interval_merging &lt;interval_merging&gt;"> + <option value="ALL" selected="True">ALL</option> + <option value="OVERLAPPING_ONLY">OVERLAPPING_ONLY</option> + </param> + + <repeat name="read_group_black_list_repeat" title="Read group black list" help="-rgbl,--read_group_black_list &lt;read_group_black_list&gt;"> + <conditional name="read_group_black_list_type"> + <param name="read_group_black_list_type_selector" type="select" label="Type of reads read group black list"> + <option value="file" selected="True">Filters in file</option> + <option value="text">Specify filters as a string</option> + </param> + <when value="file"> + <param name="read_group_black_list" type="data" format="txt" label="Read group black list file" /> + </when> + <when value="text"> + <param name="read_group_black_list" type="text" value="tag:string" label="Read group black list tag:string" /> + </when> + </conditional> + </repeat> + + <param name="disable_experimental_low_memory_sharding" type="boolean" truevalue="--disable_experimental_low_memory_sharding" falsevalue="" label="Disable experimental low-memory sharding functionality." checked="False" help="--disable_experimental_low_memory_sharding"/> + <param name="non_deterministic_random_seed" type="boolean" truevalue="--nonDeterministicRandomSeed" falsevalue="" label="Makes the GATK behave non deterministically, that is, the random numbers generated will be different in every run" checked="False" help="-ndrs,--nonDeterministicRandomSeed"/> + + </when> + </conditional> + </xml> + <xml name="analysis_type_conditional"> + <conditional name="analysis_param_type"> + <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options"> + <option value="basic" selected="True">Basic</option> + <option value="advanced">Advanced</option> + </param> + <when value="basic"> + <!-- Do nothing here --> + </when> + <when value="advanced"> + <yield /> + </when> + </conditional> + </xml> + <xml name="reference_source_selector_param"> + <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> + <option value="cached">Locally cached</option> + <option value="history">History</option> + </param> + </xml> + <token name="@CITATION_SECTION@">------ + +**Citation** + +For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. <http://www.ncbi.nlm.nih.gov/pubmed/21478889>`_ + +If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* + + </token> +</macros> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gatk_wrapper.py Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,126 @@ +#!/usr/bin/env python +#Dan Blankenberg + +""" +A wrapper script for running the GenomeAnalysisTK.jar commands. +""" + +import sys, optparse, os, tempfile, subprocess, shutil +from binascii import unhexlify +from string import Template + +GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is +GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed +DEFAULT_GATK_PREFIX = "gatk_file" +CHUNK_SIZE = 2**20 #1mb + + +def cleanup_before_exit( tmp_dir ): + if tmp_dir and os.path.exists( tmp_dir ): + shutil.rmtree( tmp_dir ) + +def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ): + suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext ) + if prefix is None: + prefix = DEFAULT_GATK_PREFIX + if target_dir is None: + target_dir = os.getcwd() + gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) ) + os.symlink( galaxy_filename, gatk_filename ) + return gatk_filename + +def gatk_filetype_argument_substitution( argument, galaxy_ext ): + return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) ) + +def open_file_from_option( filename, mode = 'rb' ): + if filename: + return open( filename, mode = mode ) + return None + +def html_report_from_directory( html_out, dir ): + html_out.write( '<html>\n<head>\n<title>Galaxy - GATK Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' ) + for fname in sorted( os.listdir( dir ) ): + html_out.write( '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) ) + html_out.write( '</ul>\n</body>\n</html>\n' ) + +def index_bam_files( bam_filenames, tmp_dir ): + for bam_filename in bam_filenames: + bam_index_filename = "%s.bai" % bam_filename + if not os.path.exists( bam_index_filename ): + #need to index this bam file + stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name + command = 'samtools index %s %s' % ( bam_filename, bam_index_filename ) + proc = subprocess.Popen( args=command, shell=True, stderr=open( stderr_name, 'wb' ) ) + return_code = proc.wait() + if return_code: + for line in open( stderr_name ): + print >> sys.stderr, line + os.unlink( stderr_name ) #clean up + cleanup_before_exit( tmp_dir ) + raise Exception( "Error indexing BAM file" ) + os.unlink( stderr_name ) #clean up + +def __main__(): + #Parse Command Line + parser = optparse.OptionParser() + parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' ) + parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' ) + parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' ) + parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' ) + parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' ) + parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' ) + parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' ) + parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"') + (options, args) = parser.parse_args() + + tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' ) + if options.pass_through_options: + cmd = ' '.join( options.pass_through_options ) + else: + cmd = '' + if options.pass_through_options_encoded: + cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) ) + if options.max_jvm_heap is not None: + cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 ) + elif options.max_jvm_heap_fraction is not None: + cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 ) + bam_filenames = [] + if options.datasets: + for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets: + gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix ) + if dataset_arg: + cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename ) + if galaxy_ext == "bam": + bam_filenames.append( gatk_filename ) + index_bam_files( bam_filenames, tmp_dir ) + #set up stdout and stderr output options + stdout = open_file_from_option( options.stdout, mode = 'wb' ) + stderr = open_file_from_option( options.stderr, mode = 'wb' ) + #if no stderr file is specified, we'll use our own + if stderr is None: + stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir ) + + proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir ) + return_code = proc.wait() + + if return_code: + stderr_target = sys.stderr + else: + stderr_target = sys.stdout + stderr.flush() + stderr.seek(0) + while True: + chunk = stderr.read( CHUNK_SIZE ) + if chunk: + stderr_target.write( chunk ) + else: + break + stderr.close() + #generate html reports + if options.html_report_from_directory: + for ( html_filename, html_dir ) in options.html_report_from_directory: + html_report_from_directory( open( html_filename, 'wb' ), html_dir ) + + cleanup_before_exit( tmp_dir ) + +if __name__=="__main__": __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/a.tab Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,15 @@ +CHR SNP BP A1 TEST NMISS BETA STAT P +1 rs1181876 3671541 T DOMDEV 958 -1.415 -3.326 0.0009161 +1 rs10492923 5092886 C ADD 1007 5.105 4.368 1.382e-05 +1 rs10492923 5092886 C DOMDEV 1007 -5.612 -4.249 2.35e-05 +1 rs10492923 5092886 C GENO_2DF 1007 NA 19.9 4.775e-05 +1 rs1801133 11778965 T ADD 1022 1.23 3.97 7.682e-05 +1 rs1801133 11778965 T GENO_2DF 1022 NA 16.07 0.0003233 +1 rs1361912 12663121 A ADD 1021 12.69 4.093 4.596e-05 +1 rs1361912 12663121 A DOMDEV 1021 -12.37 -3.945 8.533e-05 +1 rs1361912 12663121 A GENO_2DF 1021 NA 17.05 0.0001982 +1 rs1009806 19373138 G ADD 1021 -1.334 -3.756 0.0001826 +1 rs1009806 19373138 G GENO_2DF 1021 NA 19.36 6.244e-05 +1 rs873654 29550948 A DOMDEV 1012 1.526 3.6 0.0003339 +1 rs10489527 36800027 C ADD 1016 12.67 4.114 4.211e-05 +1 rs10489527 36800027 C DOMDEV 1016 -13.05 -4.02 6.249e-05
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,6 @@ +TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] +TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining +DepthOfCoverageWalker - Printing summary info +DepthOfCoverageWalker - Printing locus summary +TraversalEngine - Total runtime +TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%) \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,2 @@ + gte_0 gte_1 gte_2 gte_3 gte_4 gte_5 gte_6 gte_7 gte_8 gte_9 gte_10 gte_11 gte_12 gte_13 gte_14 gte_15 gte_16 gte_17 gte_18 gte_19 gte_20 gte_21 gte_22 gte_23 gte_24 gte_25 gte_26 gte_27 gte_28 gte_29 gte_30 gte_31 gte_32 gte_33 gte_34 gte_35 gte_36 gte_37 gte_38 gte_39 gte_40 gte_41 gte_42 gte_43 gte_44 gte_45 gte_46 gte_47 gte_48 gte_49 gte_50 gte_51 gte_52 gte_53 gte_54 gte_55 gte_56 gte_57 gte_58 gte_59 gte_60 gte_61 gte_62 gte_63 gte_64 gte_65 gte_66 gte_67 gte_68 gte_69 gte_70 gte_71 gte_72 gte_73 gte_74 gte_75 gte_76 gte_77 gte_78 gte_79 gte_80 gte_81 gte_82 gte_83 gte_84 gte_85 gte_86 gte_87 gte_88 gte_89 gte_90 gte_91 gte_92 gte_93 gte_94 gte_95 gte_96 gte_97 gte_98 gte_99 gte_100 gte_101 gte_102 gte_103 gte_104 gte_105 gte_106 gte_107 gte_108 gte_109 gte_110 gte_111 gte_112 gte_113 gte_114 gte_115 gte_116 gte_117 gte_118 gte_119 gte_120 gte_121 gte_122 gte_123 gte_124 gte_125 gte_126 gte_127 gte_128 gte_129 gte_130 gte_131 gte_132 gte_133 gte_134 gte_135 gte_136 gte_137 gte_138 gte_139 gte_140 gte_141 gte_142 gte_143 gte_144 gte_145 gte_146 gte_147 gte_148 gte_149 gte_150 gte_151 gte_152 gte_153 gte_154 gte_155 gte_156 gte_157 gte_158 gte_159 gte_160 gte_161 gte_162 gte_163 gte_164 gte_165 gte_166 gte_167 gte_168 gte_169 gte_170 gte_171 gte_172 gte_173 gte_174 gte_175 gte_176 gte_177 gte_178 gte_179 gte_180 gte_181 gte_182 gte_183 gte_184 gte_185 gte_186 gte_187 gte_188 gte_189 gte_190 gte_191 gte_192 gte_193 gte_194 gte_195 gte_196 gte_197 gte_198 gte_199 gte_200 gte_201 gte_202 gte_203 gte_204 gte_205 gte_206 gte_207 gte_208 gte_209 gte_210 gte_211 gte_212 gte_213 gte_214 gte_215 gte_216 gte_217 gte_218 gte_219 gte_220 gte_221 gte_222 gte_223 gte_224 gte_225 gte_226 gte_227 gte_228 gte_229 gte_230 gte_231 gte_232 gte_233 gte_234 gte_235 gte_236 gte_237 gte_238 gte_239 gte_240 gte_241 gte_242 gte_243 gte_244 gte_245 gte_246 gte_247 gte_248 gte_249 gte_250 gte_251 gte_252 gte_253 gte_254 gte_255 gte_256 gte_257 gte_258 gte_259 gte_260 gte_261 gte_262 gte_263 gte_264 gte_265 gte_266 gte_267 gte_268 gte_269 gte_270 gte_271 gte_272 gte_273 gte_274 gte_275 gte_276 gte_277 gte_278 gte_279 gte_280 gte_281 gte_282 gte_283 gte_284 gte_285 gte_286 gte_287 gte_288 gte_289 gte_290 gte_291 gte_292 gte_293 gte_294 gte_295 gte_296 gte_297 gte_298 gte_299 gte_300 gte_301 gte_302 gte_303 gte_304 gte_305 gte_306 gte_307 gte_308 gte_309 gte_310 gte_311 gte_312 gte_313 gte_314 gte_315 gte_316 gte_317 gte_318 gte_319 gte_320 gte_321 gte_322 gte_323 gte_324 gte_325 gte_326 gte_327 gte_328 gte_329 gte_330 gte_331 gte_332 gte_333 gte_334 gte_335 gte_336 gte_337 gte_338 gte_339 gte_340 gte_341 gte_342 gte_343 gte_344 gte_345 gte_346 gte_347 gte_348 gte_349 gte_350 gte_351 gte_352 gte_353 gte_354 gte_355 gte_356 gte_357 gte_358 gte_359 gte_360 gte_361 gte_362 gte_363 gte_364 gte_365 gte_366 gte_367 gte_368 gte_369 gte_370 gte_371 gte_372 gte_373 gte_374 gte_375 gte_376 gte_377 gte_378 gte_379 gte_380 gte_381 gte_382 gte_383 gte_384 gte_385 gte_386 gte_387 gte_388 gte_389 gte_390 gte_391 gte_392 gte_393 gte_394 gte_395 gte_396 gte_397 gte_398 gte_399 gte_400 gte_401 gte_402 gte_403 gte_404 gte_405 gte_406 gte_407 gte_408 gte_409 gte_410 gte_411 gte_412 gte_413 gte_414 gte_415 gte_416 gte_417 gte_418 gte_419 gte_420 gte_421 gte_422 gte_423 gte_424 gte_425 gte_426 gte_427 gte_428 gte_429 gte_430 gte_431 gte_432 gte_433 gte_434 gte_435 gte_436 gte_437 gte_438 gte_439 gte_440 gte_441 gte_442 gte_443 gte_444 gte_445 gte_446 gte_447 gte_448 gte_449 gte_450 gte_451 gte_452 gte_453 gte_454 gte_455 gte_456 gte_457 gte_458 gte_459 gte_460 gte_461 gte_462 gte_463 gte_464 gte_465 gte_466 gte_467 gte_468 gte_469 gte_470 gte_471 gte_472 gte_473 gte_474 gte_475 gte_476 gte_477 gte_478 gte_479 gte_480 gte_481 gte_482 gte_483 gte_484 gte_485 gte_486 gte_487 gte_488 gte_489 gte_490 gte_491 gte_492 gte_493 gte_494 gte_495 gte_496 gte_497 gte_498 gte_499 gte_500 +NSamples_1 5386 43 41 40 38 37 36 34 32 30 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,2 @@ + gte_0 gte_1 gte_2 gte_3 gte_4 gte_5 gte_6 gte_7 gte_8 gte_9 gte_10 gte_11 gte_12 gte_13 gte_14 gte_15 gte_16 gte_17 gte_18 gte_19 gte_20 gte_21 gte_22 gte_23 gte_24 gte_25 gte_26 gte_27 gte_28 gte_29 gte_30 gte_31 gte_32 gte_33 gte_34 gte_35 gte_36 gte_37 gte_38 gte_39 gte_40 gte_41 gte_42 gte_43 gte_44 gte_45 gte_46 gte_47 gte_48 gte_49 gte_50 gte_51 gte_52 gte_53 gte_54 gte_55 gte_56 gte_57 gte_58 gte_59 gte_60 gte_61 gte_62 gte_63 gte_64 gte_65 gte_66 gte_67 gte_68 gte_69 gte_70 gte_71 gte_72 gte_73 gte_74 gte_75 gte_76 gte_77 gte_78 gte_79 gte_80 gte_81 gte_82 gte_83 gte_84 gte_85 gte_86 gte_87 gte_88 gte_89 gte_90 gte_91 gte_92 gte_93 gte_94 gte_95 gte_96 gte_97 gte_98 gte_99 gte_100 gte_101 gte_102 gte_103 gte_104 gte_105 gte_106 gte_107 gte_108 gte_109 gte_110 gte_111 gte_112 gte_113 gte_114 gte_115 gte_116 gte_117 gte_118 gte_119 gte_120 gte_121 gte_122 gte_123 gte_124 gte_125 gte_126 gte_127 gte_128 gte_129 gte_130 gte_131 gte_132 gte_133 gte_134 gte_135 gte_136 gte_137 gte_138 gte_139 gte_140 gte_141 gte_142 gte_143 gte_144 gte_145 gte_146 gte_147 gte_148 gte_149 gte_150 gte_151 gte_152 gte_153 gte_154 gte_155 gte_156 gte_157 gte_158 gte_159 gte_160 gte_161 gte_162 gte_163 gte_164 gte_165 gte_166 gte_167 gte_168 gte_169 gte_170 gte_171 gte_172 gte_173 gte_174 gte_175 gte_176 gte_177 gte_178 gte_179 gte_180 gte_181 gte_182 gte_183 gte_184 gte_185 gte_186 gte_187 gte_188 gte_189 gte_190 gte_191 gte_192 gte_193 gte_194 gte_195 gte_196 gte_197 gte_198 gte_199 gte_200 gte_201 gte_202 gte_203 gte_204 gte_205 gte_206 gte_207 gte_208 gte_209 gte_210 gte_211 gte_212 gte_213 gte_214 gte_215 gte_216 gte_217 gte_218 gte_219 gte_220 gte_221 gte_222 gte_223 gte_224 gte_225 gte_226 gte_227 gte_228 gte_229 gte_230 gte_231 gte_232 gte_233 gte_234 gte_235 gte_236 gte_237 gte_238 gte_239 gte_240 gte_241 gte_242 gte_243 gte_244 gte_245 gte_246 gte_247 gte_248 gte_249 gte_250 gte_251 gte_252 gte_253 gte_254 gte_255 gte_256 gte_257 gte_258 gte_259 gte_260 gte_261 gte_262 gte_263 gte_264 gte_265 gte_266 gte_267 gte_268 gte_269 gte_270 gte_271 gte_272 gte_273 gte_274 gte_275 gte_276 gte_277 gte_278 gte_279 gte_280 gte_281 gte_282 gte_283 gte_284 gte_285 gte_286 gte_287 gte_288 gte_289 gte_290 gte_291 gte_292 gte_293 gte_294 gte_295 gte_296 gte_297 gte_298 gte_299 gte_300 gte_301 gte_302 gte_303 gte_304 gte_305 gte_306 gte_307 gte_308 gte_309 gte_310 gte_311 gte_312 gte_313 gte_314 gte_315 gte_316 gte_317 gte_318 gte_319 gte_320 gte_321 gte_322 gte_323 gte_324 gte_325 gte_326 gte_327 gte_328 gte_329 gte_330 gte_331 gte_332 gte_333 gte_334 gte_335 gte_336 gte_337 gte_338 gte_339 gte_340 gte_341 gte_342 gte_343 gte_344 gte_345 gte_346 gte_347 gte_348 gte_349 gte_350 gte_351 gte_352 gte_353 gte_354 gte_355 gte_356 gte_357 gte_358 gte_359 gte_360 gte_361 gte_362 gte_363 gte_364 gte_365 gte_366 gte_367 gte_368 gte_369 gte_370 gte_371 gte_372 gte_373 gte_374 gte_375 gte_376 gte_377 gte_378 gte_379 gte_380 gte_381 gte_382 gte_383 gte_384 gte_385 gte_386 gte_387 gte_388 gte_389 gte_390 gte_391 gte_392 gte_393 gte_394 gte_395 gte_396 gte_397 gte_398 gte_399 gte_400 gte_401 gte_402 gte_403 gte_404 gte_405 gte_406 gte_407 gte_408 gte_409 gte_410 gte_411 gte_412 gte_413 gte_414 gte_415 gte_416 gte_417 gte_418 gte_419 gte_420 gte_421 gte_422 gte_423 gte_424 gte_425 gte_426 gte_427 gte_428 gte_429 gte_430 gte_431 gte_432 gte_433 gte_434 gte_435 gte_436 gte_437 gte_438 gte_439 gte_440 gte_441 gte_442 gte_443 gte_444 gte_445 gte_446 gte_447 gte_448 gte_449 gte_450 gte_451 gte_452 gte_453 gte_454 gte_455 gte_456 gte_457 gte_458 gte_459 gte_460 gte_461 gte_462 gte_463 gte_464 gte_465 gte_466 gte_467 gte_468 gte_469 gte_470 gte_471 gte_472 gte_473 gte_474 gte_475 gte_476 gte_477 gte_478 gte_479 gte_480 gte_481 gte_482 gte_483 gte_484 gte_485 gte_486 gte_487 gte_488 gte_489 gte_490 gte_491 gte_492 gte_493 gte_494 gte_495 gte_496 gte_497 gte_498 gte_499 gte_500 +A Fake phiX Sample 1.00 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,5387 @@ +Locus Total_Depth Average_Depth_sample Depth_for_A Fake phiX Sample +phiX174:1 0 0.00 0 +phiX174:2 0 0.00 0 +phiX174:3 0 0.00 0 +phiX174:4 0 0.00 0 +phiX174:5 0 0.00 0 +phiX174:6 0 0.00 0 +phiX174:7 0 0.00 0 +phiX174:8 0 0.00 0 +phiX174:9 0 0.00 0 +phiX174:10 0 0.00 0 +phiX174:11 0 0.00 0 +phiX174:12 0 0.00 0 +phiX174:13 0 0.00 0 +phiX174:14 0 0.00 0 +phiX174:15 0 0.00 0 +phiX174:16 0 0.00 0 +phiX174:17 0 0.00 0 +phiX174:18 0 0.00 0 +phiX174:19 0 0.00 0 +phiX174:20 0 0.00 0 +phiX174:21 0 0.00 0 +phiX174:22 0 0.00 0 +phiX174:23 0 0.00 0 +phiX174:24 0 0.00 0 +phiX174:25 0 0.00 0 +phiX174:26 0 0.00 0 +phiX174:27 0 0.00 0 +phiX174:28 0 0.00 0 +phiX174:29 0 0.00 0 +phiX174:30 0 0.00 0 +phiX174:31 0 0.00 0 +phiX174:32 0 0.00 0 +phiX174:33 0 0.00 0 +phiX174:34 0 0.00 0 +phiX174:35 0 0.00 0 +phiX174:36 0 0.00 0 +phiX174:37 0 0.00 0 +phiX174:38 0 0.00 0 +phiX174:39 0 0.00 0 +phiX174:40 0 0.00 0 +phiX174:41 0 0.00 0 +phiX174:42 0 0.00 0 +phiX174:43 0 0.00 0 +phiX174:44 0 0.00 0 +phiX174:45 0 0.00 0 +phiX174:46 0 0.00 0 +phiX174:47 0 0.00 0 +phiX174:48 0 0.00 0 +phiX174:49 0 0.00 0 +phiX174:50 0 0.00 0 +phiX174:51 0 0.00 0 +phiX174:52 0 0.00 0 +phiX174:53 0 0.00 0 +phiX174:54 0 0.00 0 +phiX174:55 0 0.00 0 +phiX174:56 0 0.00 0 +phiX174:57 0 0.00 0 +phiX174:58 0 0.00 0 +phiX174:59 0 0.00 0 +phiX174:60 0 0.00 0 +phiX174:61 0 0.00 0 +phiX174:62 0 0.00 0 +phiX174:63 0 0.00 0 +phiX174:64 0 0.00 0 +phiX174:65 0 0.00 0 +phiX174:66 0 0.00 0 +phiX174:67 0 0.00 0 +phiX174:68 0 0.00 0 +phiX174:69 0 0.00 0 +phiX174:70 0 0.00 0 +phiX174:71 0 0.00 0 +phiX174:72 0 0.00 0 +phiX174:73 0 0.00 0 +phiX174:74 0 0.00 0 +phiX174:75 0 0.00 0 +phiX174:76 0 0.00 0 +phiX174:77 0 0.00 0 +phiX174:78 0 0.00 0 +phiX174:79 0 0.00 0 +phiX174:80 0 0.00 0 +phiX174:81 0 0.00 0 +phiX174:82 0 0.00 0 +phiX174:83 0 0.00 0 +phiX174:84 0 0.00 0 +phiX174:85 0 0.00 0 +phiX174:86 0 0.00 0 +phiX174:87 0 0.00 0 +phiX174:88 0 0.00 0 +phiX174:89 0 0.00 0 +phiX174:90 0 0.00 0 +phiX174:91 0 0.00 0 +phiX174:92 0 0.00 0 +phiX174:93 0 0.00 0 +phiX174:94 0 0.00 0 +phiX174:95 0 0.00 0 +phiX174:96 0 0.00 0 +phiX174:97 0 0.00 0 +phiX174:98 0 0.00 0 +phiX174:99 0 0.00 0 +phiX174:100 0 0.00 0 +phiX174:101 0 0.00 0 +phiX174:102 0 0.00 0 +phiX174:103 0 0.00 0 +phiX174:104 0 0.00 0 +phiX174:105 0 0.00 0 +phiX174:106 0 0.00 0 +phiX174:107 0 0.00 0 +phiX174:108 0 0.00 0 +phiX174:109 0 0.00 0 +phiX174:110 0 0.00 0 +phiX174:111 0 0.00 0 +phiX174:112 0 0.00 0 +phiX174:113 0 0.00 0 +phiX174:114 0 0.00 0 +phiX174:115 0 0.00 0 +phiX174:116 0 0.00 0 +phiX174:117 0 0.00 0 +phiX174:118 0 0.00 0 +phiX174:119 0 0.00 0 +phiX174:120 0 0.00 0 +phiX174:121 0 0.00 0 +phiX174:122 0 0.00 0 +phiX174:123 0 0.00 0 +phiX174:124 0 0.00 0 +phiX174:125 0 0.00 0 +phiX174:126 0 0.00 0 +phiX174:127 0 0.00 0 +phiX174:128 0 0.00 0 +phiX174:129 0 0.00 0 +phiX174:130 0 0.00 0 +phiX174:131 0 0.00 0 +phiX174:132 0 0.00 0 +phiX174:133 0 0.00 0 +phiX174:134 0 0.00 0 +phiX174:135 0 0.00 0 +phiX174:136 0 0.00 0 +phiX174:137 0 0.00 0 +phiX174:138 0 0.00 0 +phiX174:139 0 0.00 0 +phiX174:140 0 0.00 0 +phiX174:141 0 0.00 0 +phiX174:142 0 0.00 0 +phiX174:143 0 0.00 0 +phiX174:144 0 0.00 0 +phiX174:145 0 0.00 0 +phiX174:146 0 0.00 0 +phiX174:147 0 0.00 0 +phiX174:148 0 0.00 0 +phiX174:149 0 0.00 0 +phiX174:150 0 0.00 0 +phiX174:151 0 0.00 0 +phiX174:152 0 0.00 0 +phiX174:153 0 0.00 0 +phiX174:154 0 0.00 0 +phiX174:155 0 0.00 0 +phiX174:156 0 0.00 0 +phiX174:157 0 0.00 0 +phiX174:158 0 0.00 0 +phiX174:159 0 0.00 0 +phiX174:160 0 0.00 0 +phiX174:161 0 0.00 0 +phiX174:162 0 0.00 0 +phiX174:163 0 0.00 0 +phiX174:164 0 0.00 0 +phiX174:165 0 0.00 0 +phiX174:166 0 0.00 0 +phiX174:167 0 0.00 0 +phiX174:168 0 0.00 0 +phiX174:169 0 0.00 0 +phiX174:170 0 0.00 0 +phiX174:171 0 0.00 0 +phiX174:172 0 0.00 0 +phiX174:173 0 0.00 0 +phiX174:174 0 0.00 0 +phiX174:175 0 0.00 0 +phiX174:176 0 0.00 0 +phiX174:177 0 0.00 0 +phiX174:178 0 0.00 0 +phiX174:179 0 0.00 0 +phiX174:180 0 0.00 0 +phiX174:181 0 0.00 0 +phiX174:182 0 0.00 0 +phiX174:183 0 0.00 0 +phiX174:184 0 0.00 0 +phiX174:185 0 0.00 0 +phiX174:186 0 0.00 0 +phiX174:187 0 0.00 0 +phiX174:188 0 0.00 0 +phiX174:189 0 0.00 0 +phiX174:190 0 0.00 0 +phiX174:191 0 0.00 0 +phiX174:192 0 0.00 0 +phiX174:193 0 0.00 0 +phiX174:194 0 0.00 0 +phiX174:195 0 0.00 0 +phiX174:196 0 0.00 0 +phiX174:197 0 0.00 0 +phiX174:198 0 0.00 0 +phiX174:199 0 0.00 0 +phiX174:200 0 0.00 0 +phiX174:201 0 0.00 0 +phiX174:202 0 0.00 0 +phiX174:203 0 0.00 0 +phiX174:204 0 0.00 0 +phiX174:205 0 0.00 0 +phiX174:206 0 0.00 0 +phiX174:207 0 0.00 0 +phiX174:208 0 0.00 0 +phiX174:209 0 0.00 0 +phiX174:210 0 0.00 0 +phiX174:211 0 0.00 0 +phiX174:212 0 0.00 0 +phiX174:213 0 0.00 0 +phiX174:214 0 0.00 0 +phiX174:215 0 0.00 0 +phiX174:216 0 0.00 0 +phiX174:217 0 0.00 0 +phiX174:218 0 0.00 0 +phiX174:219 0 0.00 0 +phiX174:220 0 0.00 0 +phiX174:221 0 0.00 0 +phiX174:222 0 0.00 0 +phiX174:223 0 0.00 0 +phiX174:224 0 0.00 0 +phiX174:225 0 0.00 0 +phiX174:226 0 0.00 0 +phiX174:227 0 0.00 0 +phiX174:228 0 0.00 0 +phiX174:229 0 0.00 0 +phiX174:230 0 0.00 0 +phiX174:231 0 0.00 0 +phiX174:232 0 0.00 0 +phiX174:233 0 0.00 0 +phiX174:234 0 0.00 0 +phiX174:235 0 0.00 0 +phiX174:236 0 0.00 0 +phiX174:237 0 0.00 0 +phiX174:238 0 0.00 0 +phiX174:239 0 0.00 0 +phiX174:240 0 0.00 0 +phiX174:241 0 0.00 0 +phiX174:242 0 0.00 0 +phiX174:243 0 0.00 0 +phiX174:244 0 0.00 0 +phiX174:245 0 0.00 0 +phiX174:246 0 0.00 0 +phiX174:247 0 0.00 0 +phiX174:248 0 0.00 0 +phiX174:249 0 0.00 0 +phiX174:250 0 0.00 0 +phiX174:251 0 0.00 0 +phiX174:252 0 0.00 0 +phiX174:253 0 0.00 0 +phiX174:254 0 0.00 0 +phiX174:255 0 0.00 0 +phiX174:256 0 0.00 0 +phiX174:257 0 0.00 0 +phiX174:258 0 0.00 0 +phiX174:259 0 0.00 0 +phiX174:260 0 0.00 0 +phiX174:261 0 0.00 0 +phiX174:262 0 0.00 0 +phiX174:263 0 0.00 0 +phiX174:264 0 0.00 0 +phiX174:265 0 0.00 0 +phiX174:266 0 0.00 0 +phiX174:267 0 0.00 0 +phiX174:268 0 0.00 0 +phiX174:269 0 0.00 0 +phiX174:270 0 0.00 0 +phiX174:271 0 0.00 0 +phiX174:272 0 0.00 0 +phiX174:273 0 0.00 0 +phiX174:274 0 0.00 0 +phiX174:275 0 0.00 0 +phiX174:276 0 0.00 0 +phiX174:277 0 0.00 0 +phiX174:278 0 0.00 0 +phiX174:279 0 0.00 0 +phiX174:280 0 0.00 0 +phiX174:281 0 0.00 0 +phiX174:282 0 0.00 0 +phiX174:283 0 0.00 0 +phiX174:284 0 0.00 0 +phiX174:285 0 0.00 0 +phiX174:286 0 0.00 0 +phiX174:287 0 0.00 0 +phiX174:288 0 0.00 0 +phiX174:289 0 0.00 0 +phiX174:290 0 0.00 0 +phiX174:291 0 0.00 0 +phiX174:292 0 0.00 0 +phiX174:293 0 0.00 0 +phiX174:294 0 0.00 0 +phiX174:295 0 0.00 0 +phiX174:296 0 0.00 0 +phiX174:297 0 0.00 0 +phiX174:298 0 0.00 0 +phiX174:299 0 0.00 0 +phiX174:300 0 0.00 0 +phiX174:301 0 0.00 0 +phiX174:302 0 0.00 0 +phiX174:303 0 0.00 0 +phiX174:304 0 0.00 0 +phiX174:305 0 0.00 0 +phiX174:306 0 0.00 0 +phiX174:307 0 0.00 0 +phiX174:308 0 0.00 0 +phiX174:309 0 0.00 0 +phiX174:310 0 0.00 0 +phiX174:311 0 0.00 0 +phiX174:312 0 0.00 0 +phiX174:313 0 0.00 0 +phiX174:314 0 0.00 0 +phiX174:315 0 0.00 0 +phiX174:316 0 0.00 0 +phiX174:317 0 0.00 0 +phiX174:318 0 0.00 0 +phiX174:319 0 0.00 0 +phiX174:320 0 0.00 0 +phiX174:321 0 0.00 0 +phiX174:322 0 0.00 0 +phiX174:323 0 0.00 0 +phiX174:324 0 0.00 0 +phiX174:325 0 0.00 0 +phiX174:326 0 0.00 0 +phiX174:327 0 0.00 0 +phiX174:328 0 0.00 0 +phiX174:329 0 0.00 0 +phiX174:330 0 0.00 0 +phiX174:331 0 0.00 0 +phiX174:332 0 0.00 0 +phiX174:333 0 0.00 0 +phiX174:334 0 0.00 0 +phiX174:335 0 0.00 0 +phiX174:336 0 0.00 0 +phiX174:337 0 0.00 0 +phiX174:338 0 0.00 0 +phiX174:339 0 0.00 0 +phiX174:340 0 0.00 0 +phiX174:341 0 0.00 0 +phiX174:342 0 0.00 0 +phiX174:343 0 0.00 0 +phiX174:344 0 0.00 0 +phiX174:345 0 0.00 0 +phiX174:346 0 0.00 0 +phiX174:347 0 0.00 0 +phiX174:348 0 0.00 0 +phiX174:349 0 0.00 0 +phiX174:350 0 0.00 0 +phiX174:351 0 0.00 0 +phiX174:352 0 0.00 0 +phiX174:353 0 0.00 0 +phiX174:354 0 0.00 0 +phiX174:355 0 0.00 0 +phiX174:356 0 0.00 0 +phiX174:357 0 0.00 0 +phiX174:358 0 0.00 0 +phiX174:359 0 0.00 0 +phiX174:360 0 0.00 0 +phiX174:361 0 0.00 0 +phiX174:362 0 0.00 0 +phiX174:363 0 0.00 0 +phiX174:364 0 0.00 0 +phiX174:365 0 0.00 0 +phiX174:366 0 0.00 0 +phiX174:367 0 0.00 0 +phiX174:368 0 0.00 0 +phiX174:369 0 0.00 0 +phiX174:370 0 0.00 0 +phiX174:371 0 0.00 0 +phiX174:372 0 0.00 0 +phiX174:373 0 0.00 0 +phiX174:374 0 0.00 0 +phiX174:375 0 0.00 0 +phiX174:376 0 0.00 0 +phiX174:377 0 0.00 0 +phiX174:378 0 0.00 0 +phiX174:379 0 0.00 0 +phiX174:380 0 0.00 0 +phiX174:381 0 0.00 0 +phiX174:382 0 0.00 0 +phiX174:383 0 0.00 0 +phiX174:384 0 0.00 0 +phiX174:385 0 0.00 0 +phiX174:386 0 0.00 0 +phiX174:387 0 0.00 0 +phiX174:388 0 0.00 0 +phiX174:389 0 0.00 0 +phiX174:390 0 0.00 0 +phiX174:391 0 0.00 0 +phiX174:392 0 0.00 0 +phiX174:393 0 0.00 0 +phiX174:394 0 0.00 0 +phiX174:395 0 0.00 0 +phiX174:396 0 0.00 0 +phiX174:397 0 0.00 0 +phiX174:398 0 0.00 0 +phiX174:399 0 0.00 0 +phiX174:400 0 0.00 0 +phiX174:401 0 0.00 0 +phiX174:402 0 0.00 0 +phiX174:403 0 0.00 0 +phiX174:404 0 0.00 0 +phiX174:405 0 0.00 0 +phiX174:406 0 0.00 0 +phiX174:407 0 0.00 0 +phiX174:408 0 0.00 0 +phiX174:409 0 0.00 0 +phiX174:410 0 0.00 0 +phiX174:411 0 0.00 0 +phiX174:412 0 0.00 0 +phiX174:413 0 0.00 0 +phiX174:414 0 0.00 0 +phiX174:415 0 0.00 0 +phiX174:416 0 0.00 0 +phiX174:417 0 0.00 0 +phiX174:418 0 0.00 0 +phiX174:419 0 0.00 0 +phiX174:420 0 0.00 0 +phiX174:421 0 0.00 0 +phiX174:422 0 0.00 0 +phiX174:423 0 0.00 0 +phiX174:424 0 0.00 0 +phiX174:425 0 0.00 0 +phiX174:426 0 0.00 0 +phiX174:427 0 0.00 0 +phiX174:428 0 0.00 0 +phiX174:429 0 0.00 0 +phiX174:430 0 0.00 0 +phiX174:431 0 0.00 0 +phiX174:432 0 0.00 0 +phiX174:433 0 0.00 0 +phiX174:434 0 0.00 0 +phiX174:435 0 0.00 0 +phiX174:436 0 0.00 0 +phiX174:437 0 0.00 0 +phiX174:438 0 0.00 0 +phiX174:439 0 0.00 0 +phiX174:440 0 0.00 0 +phiX174:441 0 0.00 0 +phiX174:442 0 0.00 0 +phiX174:443 0 0.00 0 +phiX174:444 0 0.00 0 +phiX174:445 0 0.00 0 +phiX174:446 0 0.00 0 +phiX174:447 0 0.00 0 +phiX174:448 0 0.00 0 +phiX174:449 0 0.00 0 +phiX174:450 0 0.00 0 +phiX174:451 0 0.00 0 +phiX174:452 0 0.00 0 +phiX174:453 0 0.00 0 +phiX174:454 0 0.00 0 +phiX174:455 0 0.00 0 +phiX174:456 0 0.00 0 +phiX174:457 0 0.00 0 +phiX174:458 0 0.00 0 +phiX174:459 0 0.00 0 +phiX174:460 0 0.00 0 +phiX174:461 0 0.00 0 +phiX174:462 0 0.00 0 +phiX174:463 0 0.00 0 +phiX174:464 0 0.00 0 +phiX174:465 0 0.00 0 +phiX174:466 0 0.00 0 +phiX174:467 0 0.00 0 +phiX174:468 0 0.00 0 +phiX174:469 0 0.00 0 +phiX174:470 0 0.00 0 +phiX174:471 0 0.00 0 +phiX174:472 0 0.00 0 +phiX174:473 0 0.00 0 +phiX174:474 0 0.00 0 +phiX174:475 0 0.00 0 +phiX174:476 0 0.00 0 +phiX174:477 0 0.00 0 +phiX174:478 0 0.00 0 +phiX174:479 0 0.00 0 +phiX174:480 0 0.00 0 +phiX174:481 0 0.00 0 +phiX174:482 0 0.00 0 +phiX174:483 0 0.00 0 +phiX174:484 0 0.00 0 +phiX174:485 0 0.00 0 +phiX174:486 0 0.00 0 +phiX174:487 0 0.00 0 +phiX174:488 0 0.00 0 +phiX174:489 0 0.00 0 +phiX174:490 0 0.00 0 +phiX174:491 0 0.00 0 +phiX174:492 0 0.00 0 +phiX174:493 0 0.00 0 +phiX174:494 0 0.00 0 +phiX174:495 0 0.00 0 +phiX174:496 0 0.00 0 +phiX174:497 0 0.00 0 +phiX174:498 0 0.00 0 +phiX174:499 0 0.00 0 +phiX174:500 0 0.00 0 +phiX174:501 0 0.00 0 +phiX174:502 0 0.00 0 +phiX174:503 0 0.00 0 +phiX174:504 0 0.00 0 +phiX174:505 0 0.00 0 +phiX174:506 0 0.00 0 +phiX174:507 0 0.00 0 +phiX174:508 0 0.00 0 +phiX174:509 0 0.00 0 +phiX174:510 0 0.00 0 +phiX174:511 0 0.00 0 +phiX174:512 0 0.00 0 +phiX174:513 0 0.00 0 +phiX174:514 0 0.00 0 +phiX174:515 0 0.00 0 +phiX174:516 0 0.00 0 +phiX174:517 0 0.00 0 +phiX174:518 0 0.00 0 +phiX174:519 0 0.00 0 +phiX174:520 0 0.00 0 +phiX174:521 0 0.00 0 +phiX174:522 0 0.00 0 +phiX174:523 0 0.00 0 +phiX174:524 0 0.00 0 +phiX174:525 0 0.00 0 +phiX174:526 0 0.00 0 +phiX174:527 0 0.00 0 +phiX174:528 0 0.00 0 +phiX174:529 0 0.00 0 +phiX174:530 0 0.00 0 +phiX174:531 0 0.00 0 +phiX174:532 0 0.00 0 +phiX174:533 0 0.00 0 +phiX174:534 0 0.00 0 +phiX174:535 0 0.00 0 +phiX174:536 0 0.00 0 +phiX174:537 0 0.00 0 +phiX174:538 0 0.00 0 +phiX174:539 0 0.00 0 +phiX174:540 0 0.00 0 +phiX174:541 0 0.00 0 +phiX174:542 0 0.00 0 +phiX174:543 0 0.00 0 +phiX174:544 0 0.00 0 +phiX174:545 0 0.00 0 +phiX174:546 0 0.00 0 +phiX174:547 0 0.00 0 +phiX174:548 0 0.00 0 +phiX174:549 0 0.00 0 +phiX174:550 0 0.00 0 +phiX174:551 0 0.00 0 +phiX174:552 0 0.00 0 +phiX174:553 0 0.00 0 +phiX174:554 0 0.00 0 +phiX174:555 0 0.00 0 +phiX174:556 0 0.00 0 +phiX174:557 0 0.00 0 +phiX174:558 0 0.00 0 +phiX174:559 0 0.00 0 +phiX174:560 0 0.00 0 +phiX174:561 0 0.00 0 +phiX174:562 0 0.00 0 +phiX174:563 0 0.00 0 +phiX174:564 0 0.00 0 +phiX174:565 0 0.00 0 +phiX174:566 0 0.00 0 +phiX174:567 0 0.00 0 +phiX174:568 0 0.00 0 +phiX174:569 0 0.00 0 +phiX174:570 0 0.00 0 +phiX174:571 0 0.00 0 +phiX174:572 0 0.00 0 +phiX174:573 0 0.00 0 +phiX174:574 0 0.00 0 +phiX174:575 0 0.00 0 +phiX174:576 0 0.00 0 +phiX174:577 0 0.00 0 +phiX174:578 0 0.00 0 +phiX174:579 0 0.00 0 +phiX174:580 0 0.00 0 +phiX174:581 0 0.00 0 +phiX174:582 0 0.00 0 +phiX174:583 0 0.00 0 +phiX174:584 0 0.00 0 +phiX174:585 0 0.00 0 +phiX174:586 0 0.00 0 +phiX174:587 0 0.00 0 +phiX174:588 0 0.00 0 +phiX174:589 0 0.00 0 +phiX174:590 0 0.00 0 +phiX174:591 0 0.00 0 +phiX174:592 0 0.00 0 +phiX174:593 0 0.00 0 +phiX174:594 0 0.00 0 +phiX174:595 0 0.00 0 +phiX174:596 0 0.00 0 +phiX174:597 0 0.00 0 +phiX174:598 0 0.00 0 +phiX174:599 0 0.00 0 +phiX174:600 0 0.00 0 +phiX174:601 0 0.00 0 +phiX174:602 0 0.00 0 +phiX174:603 0 0.00 0 +phiX174:604 0 0.00 0 +phiX174:605 0 0.00 0 +phiX174:606 0 0.00 0 +phiX174:607 0 0.00 0 +phiX174:608 0 0.00 0 +phiX174:609 0 0.00 0 +phiX174:610 0 0.00 0 +phiX174:611 0 0.00 0 +phiX174:612 0 0.00 0 +phiX174:613 0 0.00 0 +phiX174:614 0 0.00 0 +phiX174:615 0 0.00 0 +phiX174:616 0 0.00 0 +phiX174:617 0 0.00 0 +phiX174:618 0 0.00 0 +phiX174:619 0 0.00 0 +phiX174:620 0 0.00 0 +phiX174:621 0 0.00 0 +phiX174:622 0 0.00 0 +phiX174:623 0 0.00 0 +phiX174:624 0 0.00 0 +phiX174:625 0 0.00 0 +phiX174:626 0 0.00 0 +phiX174:627 0 0.00 0 +phiX174:628 0 0.00 0 +phiX174:629 0 0.00 0 +phiX174:630 0 0.00 0 +phiX174:631 0 0.00 0 +phiX174:632 0 0.00 0 +phiX174:633 0 0.00 0 +phiX174:634 0 0.00 0 +phiX174:635 0 0.00 0 +phiX174:636 0 0.00 0 +phiX174:637 0 0.00 0 +phiX174:638 0 0.00 0 +phiX174:639 0 0.00 0 +phiX174:640 0 0.00 0 +phiX174:641 0 0.00 0 +phiX174:642 0 0.00 0 +phiX174:643 0 0.00 0 +phiX174:644 0 0.00 0 +phiX174:645 0 0.00 0 +phiX174:646 0 0.00 0 +phiX174:647 0 0.00 0 +phiX174:648 0 0.00 0 +phiX174:649 0 0.00 0 +phiX174:650 0 0.00 0 +phiX174:651 0 0.00 0 +phiX174:652 0 0.00 0 +phiX174:653 0 0.00 0 +phiX174:654 0 0.00 0 +phiX174:655 0 0.00 0 +phiX174:656 0 0.00 0 +phiX174:657 0 0.00 0 +phiX174:658 0 0.00 0 +phiX174:659 0 0.00 0 +phiX174:660 0 0.00 0 +phiX174:661 0 0.00 0 +phiX174:662 0 0.00 0 +phiX174:663 0 0.00 0 +phiX174:664 0 0.00 0 +phiX174:665 0 0.00 0 +phiX174:666 0 0.00 0 +phiX174:667 0 0.00 0 +phiX174:668 0 0.00 0 +phiX174:669 0 0.00 0 +phiX174:670 0 0.00 0 +phiX174:671 0 0.00 0 +phiX174:672 0 0.00 0 +phiX174:673 0 0.00 0 +phiX174:674 0 0.00 0 +phiX174:675 0 0.00 0 +phiX174:676 0 0.00 0 +phiX174:677 0 0.00 0 +phiX174:678 0 0.00 0 +phiX174:679 0 0.00 0 +phiX174:680 0 0.00 0 +phiX174:681 0 0.00 0 +phiX174:682 0 0.00 0 +phiX174:683 0 0.00 0 +phiX174:684 0 0.00 0 +phiX174:685 0 0.00 0 +phiX174:686 0 0.00 0 +phiX174:687 0 0.00 0 +phiX174:688 0 0.00 0 +phiX174:689 0 0.00 0 +phiX174:690 0 0.00 0 +phiX174:691 0 0.00 0 +phiX174:692 0 0.00 0 +phiX174:693 0 0.00 0 +phiX174:694 0 0.00 0 +phiX174:695 0 0.00 0 +phiX174:696 0 0.00 0 +phiX174:697 0 0.00 0 +phiX174:698 0 0.00 0 +phiX174:699 0 0.00 0 +phiX174:700 0 0.00 0 +phiX174:701 0 0.00 0 +phiX174:702 0 0.00 0 +phiX174:703 0 0.00 0 +phiX174:704 0 0.00 0 +phiX174:705 0 0.00 0 +phiX174:706 0 0.00 0 +phiX174:707 0 0.00 0 +phiX174:708 0 0.00 0 +phiX174:709 0 0.00 0 +phiX174:710 0 0.00 0 +phiX174:711 0 0.00 0 +phiX174:712 0 0.00 0 +phiX174:713 0 0.00 0 +phiX174:714 0 0.00 0 +phiX174:715 0 0.00 0 +phiX174:716 0 0.00 0 +phiX174:717 0 0.00 0 +phiX174:718 0 0.00 0 +phiX174:719 0 0.00 0 +phiX174:720 0 0.00 0 +phiX174:721 0 0.00 0 +phiX174:722 0 0.00 0 +phiX174:723 0 0.00 0 +phiX174:724 0 0.00 0 +phiX174:725 0 0.00 0 +phiX174:726 0 0.00 0 +phiX174:727 0 0.00 0 +phiX174:728 0 0.00 0 +phiX174:729 0 0.00 0 +phiX174:730 0 0.00 0 +phiX174:731 0 0.00 0 +phiX174:732 0 0.00 0 +phiX174:733 0 0.00 0 +phiX174:734 0 0.00 0 +phiX174:735 0 0.00 0 +phiX174:736 0 0.00 0 +phiX174:737 0 0.00 0 +phiX174:738 0 0.00 0 +phiX174:739 0 0.00 0 +phiX174:740 0 0.00 0 +phiX174:741 0 0.00 0 +phiX174:742 0 0.00 0 +phiX174:743 0 0.00 0 +phiX174:744 0 0.00 0 +phiX174:745 0 0.00 0 +phiX174:746 0 0.00 0 +phiX174:747 0 0.00 0 +phiX174:748 0 0.00 0 +phiX174:749 0 0.00 0 +phiX174:750 0 0.00 0 +phiX174:751 0 0.00 0 +phiX174:752 0 0.00 0 +phiX174:753 0 0.00 0 +phiX174:754 0 0.00 0 +phiX174:755 0 0.00 0 +phiX174:756 0 0.00 0 +phiX174:757 0 0.00 0 +phiX174:758 0 0.00 0 +phiX174:759 0 0.00 0 +phiX174:760 0 0.00 0 +phiX174:761 0 0.00 0 +phiX174:762 0 0.00 0 +phiX174:763 0 0.00 0 +phiX174:764 0 0.00 0 +phiX174:765 0 0.00 0 +phiX174:766 0 0.00 0 +phiX174:767 0 0.00 0 +phiX174:768 0 0.00 0 +phiX174:769 0 0.00 0 +phiX174:770 0 0.00 0 +phiX174:771 0 0.00 0 +phiX174:772 0 0.00 0 +phiX174:773 0 0.00 0 +phiX174:774 0 0.00 0 +phiX174:775 0 0.00 0 +phiX174:776 0 0.00 0 +phiX174:777 0 0.00 0 +phiX174:778 0 0.00 0 +phiX174:779 0 0.00 0 +phiX174:780 0 0.00 0 +phiX174:781 0 0.00 0 +phiX174:782 0 0.00 0 +phiX174:783 0 0.00 0 +phiX174:784 0 0.00 0 +phiX174:785 0 0.00 0 +phiX174:786 0 0.00 0 +phiX174:787 0 0.00 0 +phiX174:788 0 0.00 0 +phiX174:789 0 0.00 0 +phiX174:790 0 0.00 0 +phiX174:791 0 0.00 0 +phiX174:792 0 0.00 0 +phiX174:793 0 0.00 0 +phiX174:794 0 0.00 0 +phiX174:795 0 0.00 0 +phiX174:796 0 0.00 0 +phiX174:797 0 0.00 0 +phiX174:798 0 0.00 0 +phiX174:799 0 0.00 0 +phiX174:800 0 0.00 0 +phiX174:801 0 0.00 0 +phiX174:802 0 0.00 0 +phiX174:803 0 0.00 0 +phiX174:804 0 0.00 0 +phiX174:805 0 0.00 0 +phiX174:806 0 0.00 0 +phiX174:807 0 0.00 0 +phiX174:808 0 0.00 0 +phiX174:809 0 0.00 0 +phiX174:810 0 0.00 0 +phiX174:811 0 0.00 0 +phiX174:812 0 0.00 0 +phiX174:813 0 0.00 0 +phiX174:814 0 0.00 0 +phiX174:815 0 0.00 0 +phiX174:816 0 0.00 0 +phiX174:817 0 0.00 0 +phiX174:818 0 0.00 0 +phiX174:819 0 0.00 0 +phiX174:820 0 0.00 0 +phiX174:821 0 0.00 0 +phiX174:822 0 0.00 0 +phiX174:823 0 0.00 0 +phiX174:824 0 0.00 0 +phiX174:825 0 0.00 0 +phiX174:826 0 0.00 0 +phiX174:827 0 0.00 0 +phiX174:828 0 0.00 0 +phiX174:829 0 0.00 0 +phiX174:830 0 0.00 0 +phiX174:831 0 0.00 0 +phiX174:832 0 0.00 0 +phiX174:833 0 0.00 0 +phiX174:834 0 0.00 0 +phiX174:835 0 0.00 0 +phiX174:836 0 0.00 0 +phiX174:837 0 0.00 0 +phiX174:838 0 0.00 0 +phiX174:839 0 0.00 0 +phiX174:840 0 0.00 0 +phiX174:841 0 0.00 0 +phiX174:842 0 0.00 0 +phiX174:843 0 0.00 0 +phiX174:844 0 0.00 0 +phiX174:845 0 0.00 0 +phiX174:846 0 0.00 0 +phiX174:847 0 0.00 0 +phiX174:848 0 0.00 0 +phiX174:849 0 0.00 0 +phiX174:850 0 0.00 0 +phiX174:851 0 0.00 0 +phiX174:852 0 0.00 0 +phiX174:853 0 0.00 0 +phiX174:854 0 0.00 0 +phiX174:855 0 0.00 0 +phiX174:856 0 0.00 0 +phiX174:857 0 0.00 0 +phiX174:858 0 0.00 0 +phiX174:859 0 0.00 0 +phiX174:860 0 0.00 0 +phiX174:861 0 0.00 0 +phiX174:862 0 0.00 0 +phiX174:863 0 0.00 0 +phiX174:864 0 0.00 0 +phiX174:865 0 0.00 0 +phiX174:866 0 0.00 0 +phiX174:867 0 0.00 0 +phiX174:868 0 0.00 0 +phiX174:869 0 0.00 0 +phiX174:870 0 0.00 0 +phiX174:871 0 0.00 0 +phiX174:872 0 0.00 0 +phiX174:873 0 0.00 0 +phiX174:874 0 0.00 0 +phiX174:875 0 0.00 0 +phiX174:876 0 0.00 0 +phiX174:877 0 0.00 0 +phiX174:878 0 0.00 0 +phiX174:879 0 0.00 0 +phiX174:880 0 0.00 0 +phiX174:881 0 0.00 0 +phiX174:882 0 0.00 0 +phiX174:883 0 0.00 0 +phiX174:884 0 0.00 0 +phiX174:885 0 0.00 0 +phiX174:886 0 0.00 0 +phiX174:887 0 0.00 0 +phiX174:888 0 0.00 0 +phiX174:889 0 0.00 0 +phiX174:890 0 0.00 0 +phiX174:891 0 0.00 0 +phiX174:892 0 0.00 0 +phiX174:893 0 0.00 0 +phiX174:894 0 0.00 0 +phiX174:895 0 0.00 0 +phiX174:896 0 0.00 0 +phiX174:897 0 0.00 0 +phiX174:898 0 0.00 0 +phiX174:899 0 0.00 0 +phiX174:900 0 0.00 0 +phiX174:901 0 0.00 0 +phiX174:902 0 0.00 0 +phiX174:903 0 0.00 0 +phiX174:904 0 0.00 0 +phiX174:905 0 0.00 0 +phiX174:906 0 0.00 0 +phiX174:907 0 0.00 0 +phiX174:908 0 0.00 0 +phiX174:909 0 0.00 0 +phiX174:910 0 0.00 0 +phiX174:911 0 0.00 0 +phiX174:912 0 0.00 0 +phiX174:913 0 0.00 0 +phiX174:914 0 0.00 0 +phiX174:915 0 0.00 0 +phiX174:916 0 0.00 0 +phiX174:917 0 0.00 0 +phiX174:918 0 0.00 0 +phiX174:919 0 0.00 0 +phiX174:920 0 0.00 0 +phiX174:921 0 0.00 0 +phiX174:922 0 0.00 0 +phiX174:923 0 0.00 0 +phiX174:924 0 0.00 0 +phiX174:925 0 0.00 0 +phiX174:926 0 0.00 0 +phiX174:927 0 0.00 0 +phiX174:928 0 0.00 0 +phiX174:929 0 0.00 0 +phiX174:930 0 0.00 0 +phiX174:931 0 0.00 0 +phiX174:932 0 0.00 0 +phiX174:933 0 0.00 0 +phiX174:934 0 0.00 0 +phiX174:935 0 0.00 0 +phiX174:936 0 0.00 0 +phiX174:937 0 0.00 0 +phiX174:938 0 0.00 0 +phiX174:939 0 0.00 0 +phiX174:940 0 0.00 0 +phiX174:941 0 0.00 0 +phiX174:942 0 0.00 0 +phiX174:943 0 0.00 0 +phiX174:944 0 0.00 0 +phiX174:945 0 0.00 0 +phiX174:946 0 0.00 0 +phiX174:947 0 0.00 0 +phiX174:948 0 0.00 0 +phiX174:949 0 0.00 0 +phiX174:950 0 0.00 0 +phiX174:951 0 0.00 0 +phiX174:952 0 0.00 0 +phiX174:953 0 0.00 0 +phiX174:954 0 0.00 0 +phiX174:955 0 0.00 0 +phiX174:956 0 0.00 0 +phiX174:957 0 0.00 0 +phiX174:958 0 0.00 0 +phiX174:959 0 0.00 0 +phiX174:960 0 0.00 0 +phiX174:961 0 0.00 0 +phiX174:962 0 0.00 0 +phiX174:963 0 0.00 0 +phiX174:964 0 0.00 0 +phiX174:965 0 0.00 0 +phiX174:966 0 0.00 0 +phiX174:967 0 0.00 0 +phiX174:968 0 0.00 0 +phiX174:969 0 0.00 0 +phiX174:970 0 0.00 0 +phiX174:971 0 0.00 0 +phiX174:972 0 0.00 0 +phiX174:973 0 0.00 0 +phiX174:974 0 0.00 0 +phiX174:975 0 0.00 0 +phiX174:976 0 0.00 0 +phiX174:977 0 0.00 0 +phiX174:978 0 0.00 0 +phiX174:979 0 0.00 0 +phiX174:980 0 0.00 0 +phiX174:981 0 0.00 0 +phiX174:982 0 0.00 0 +phiX174:983 0 0.00 0 +phiX174:984 0 0.00 0 +phiX174:985 0 0.00 0 +phiX174:986 0 0.00 0 +phiX174:987 0 0.00 0 +phiX174:988 0 0.00 0 +phiX174:989 0 0.00 0 +phiX174:990 0 0.00 0 +phiX174:991 0 0.00 0 +phiX174:992 0 0.00 0 +phiX174:993 0 0.00 0 +phiX174:994 0 0.00 0 +phiX174:995 0 0.00 0 +phiX174:996 0 0.00 0 +phiX174:997 0 0.00 0 +phiX174:998 0 0.00 0 +phiX174:999 0 0.00 0 +phiX174:1000 0 0.00 0 +phiX174:1001 0 0.00 0 +phiX174:1002 0 0.00 0 +phiX174:1003 0 0.00 0 +phiX174:1004 0 0.00 0 +phiX174:1005 0 0.00 0 +phiX174:1006 0 0.00 0 +phiX174:1007 0 0.00 0 +phiX174:1008 0 0.00 0 +phiX174:1009 0 0.00 0 +phiX174:1010 0 0.00 0 +phiX174:1011 0 0.00 0 +phiX174:1012 0 0.00 0 +phiX174:1013 0 0.00 0 +phiX174:1014 0 0.00 0 +phiX174:1015 0 0.00 0 +phiX174:1016 0 0.00 0 +phiX174:1017 0 0.00 0 +phiX174:1018 0 0.00 0 +phiX174:1019 0 0.00 0 +phiX174:1020 0 0.00 0 +phiX174:1021 0 0.00 0 +phiX174:1022 0 0.00 0 +phiX174:1023 0 0.00 0 +phiX174:1024 0 0.00 0 +phiX174:1025 0 0.00 0 +phiX174:1026 0 0.00 0 +phiX174:1027 0 0.00 0 +phiX174:1028 0 0.00 0 +phiX174:1029 0 0.00 0 +phiX174:1030 0 0.00 0 +phiX174:1031 0 0.00 0 +phiX174:1032 0 0.00 0 +phiX174:1033 0 0.00 0 +phiX174:1034 0 0.00 0 +phiX174:1035 0 0.00 0 +phiX174:1036 0 0.00 0 +phiX174:1037 0 0.00 0 +phiX174:1038 0 0.00 0 +phiX174:1039 0 0.00 0 +phiX174:1040 0 0.00 0 +phiX174:1041 0 0.00 0 +phiX174:1042 0 0.00 0 +phiX174:1043 0 0.00 0 +phiX174:1044 0 0.00 0 +phiX174:1045 0 0.00 0 +phiX174:1046 0 0.00 0 +phiX174:1047 0 0.00 0 +phiX174:1048 0 0.00 0 +phiX174:1049 0 0.00 0 +phiX174:1050 0 0.00 0 +phiX174:1051 0 0.00 0 +phiX174:1052 0 0.00 0 +phiX174:1053 0 0.00 0 +phiX174:1054 0 0.00 0 +phiX174:1055 0 0.00 0 +phiX174:1056 0 0.00 0 +phiX174:1057 0 0.00 0 +phiX174:1058 0 0.00 0 +phiX174:1059 0 0.00 0 +phiX174:1060 0 0.00 0 +phiX174:1061 0 0.00 0 +phiX174:1062 0 0.00 0 +phiX174:1063 0 0.00 0 +phiX174:1064 0 0.00 0 +phiX174:1065 0 0.00 0 +phiX174:1066 0 0.00 0 +phiX174:1067 0 0.00 0 +phiX174:1068 0 0.00 0 +phiX174:1069 0 0.00 0 +phiX174:1070 0 0.00 0 +phiX174:1071 0 0.00 0 +phiX174:1072 0 0.00 0 +phiX174:1073 0 0.00 0 +phiX174:1074 0 0.00 0 +phiX174:1075 0 0.00 0 +phiX174:1076 0 0.00 0 +phiX174:1077 0 0.00 0 +phiX174:1078 0 0.00 0 +phiX174:1079 0 0.00 0 +phiX174:1080 0 0.00 0 +phiX174:1081 0 0.00 0 +phiX174:1082 0 0.00 0 +phiX174:1083 0 0.00 0 +phiX174:1084 0 0.00 0 +phiX174:1085 0 0.00 0 +phiX174:1086 0 0.00 0 +phiX174:1087 0 0.00 0 +phiX174:1088 0 0.00 0 +phiX174:1089 0 0.00 0 +phiX174:1090 0 0.00 0 +phiX174:1091 0 0.00 0 +phiX174:1092 0 0.00 0 +phiX174:1093 0 0.00 0 +phiX174:1094 0 0.00 0 +phiX174:1095 0 0.00 0 +phiX174:1096 0 0.00 0 +phiX174:1097 0 0.00 0 +phiX174:1098 0 0.00 0 +phiX174:1099 0 0.00 0 +phiX174:1100 0 0.00 0 +phiX174:1101 0 0.00 0 +phiX174:1102 0 0.00 0 +phiX174:1103 0 0.00 0 +phiX174:1104 0 0.00 0 +phiX174:1105 0 0.00 0 +phiX174:1106 0 0.00 0 +phiX174:1107 0 0.00 0 +phiX174:1108 0 0.00 0 +phiX174:1109 0 0.00 0 +phiX174:1110 0 0.00 0 +phiX174:1111 0 0.00 0 +phiX174:1112 0 0.00 0 +phiX174:1113 0 0.00 0 +phiX174:1114 0 0.00 0 +phiX174:1115 0 0.00 0 +phiX174:1116 0 0.00 0 +phiX174:1117 0 0.00 0 +phiX174:1118 0 0.00 0 +phiX174:1119 0 0.00 0 +phiX174:1120 0 0.00 0 +phiX174:1121 0 0.00 0 +phiX174:1122 0 0.00 0 +phiX174:1123 0 0.00 0 +phiX174:1124 0 0.00 0 +phiX174:1125 0 0.00 0 +phiX174:1126 0 0.00 0 +phiX174:1127 0 0.00 0 +phiX174:1128 0 0.00 0 +phiX174:1129 0 0.00 0 +phiX174:1130 0 0.00 0 +phiX174:1131 0 0.00 0 +phiX174:1132 0 0.00 0 +phiX174:1133 0 0.00 0 +phiX174:1134 0 0.00 0 +phiX174:1135 0 0.00 0 +phiX174:1136 0 0.00 0 +phiX174:1137 0 0.00 0 +phiX174:1138 0 0.00 0 +phiX174:1139 0 0.00 0 +phiX174:1140 0 0.00 0 +phiX174:1141 0 0.00 0 +phiX174:1142 0 0.00 0 +phiX174:1143 0 0.00 0 +phiX174:1144 0 0.00 0 +phiX174:1145 0 0.00 0 +phiX174:1146 0 0.00 0 +phiX174:1147 0 0.00 0 +phiX174:1148 0 0.00 0 +phiX174:1149 0 0.00 0 +phiX174:1150 0 0.00 0 +phiX174:1151 0 0.00 0 +phiX174:1152 0 0.00 0 +phiX174:1153 0 0.00 0 +phiX174:1154 0 0.00 0 +phiX174:1155 0 0.00 0 +phiX174:1156 0 0.00 0 +phiX174:1157 0 0.00 0 +phiX174:1158 0 0.00 0 +phiX174:1159 0 0.00 0 +phiX174:1160 0 0.00 0 +phiX174:1161 0 0.00 0 +phiX174:1162 0 0.00 0 +phiX174:1163 0 0.00 0 +phiX174:1164 0 0.00 0 +phiX174:1165 0 0.00 0 +phiX174:1166 0 0.00 0 +phiX174:1167 0 0.00 0 +phiX174:1168 0 0.00 0 +phiX174:1169 0 0.00 0 +phiX174:1170 0 0.00 0 +phiX174:1171 0 0.00 0 +phiX174:1172 0 0.00 0 +phiX174:1173 0 0.00 0 +phiX174:1174 0 0.00 0 +phiX174:1175 0 0.00 0 +phiX174:1176 0 0.00 0 +phiX174:1177 0 0.00 0 +phiX174:1178 0 0.00 0 +phiX174:1179 0 0.00 0 +phiX174:1180 0 0.00 0 +phiX174:1181 0 0.00 0 +phiX174:1182 0 0.00 0 +phiX174:1183 0 0.00 0 +phiX174:1184 0 0.00 0 +phiX174:1185 0 0.00 0 +phiX174:1186 0 0.00 0 +phiX174:1187 0 0.00 0 +phiX174:1188 0 0.00 0 +phiX174:1189 0 0.00 0 +phiX174:1190 0 0.00 0 +phiX174:1191 0 0.00 0 +phiX174:1192 0 0.00 0 +phiX174:1193 0 0.00 0 +phiX174:1194 0 0.00 0 +phiX174:1195 0 0.00 0 +phiX174:1196 0 0.00 0 +phiX174:1197 0 0.00 0 +phiX174:1198 0 0.00 0 +phiX174:1199 0 0.00 0 +phiX174:1200 0 0.00 0 +phiX174:1201 0 0.00 0 +phiX174:1202 0 0.00 0 +phiX174:1203 0 0.00 0 +phiX174:1204 0 0.00 0 +phiX174:1205 0 0.00 0 +phiX174:1206 0 0.00 0 +phiX174:1207 0 0.00 0 +phiX174:1208 0 0.00 0 +phiX174:1209 0 0.00 0 +phiX174:1210 0 0.00 0 +phiX174:1211 0 0.00 0 +phiX174:1212 0 0.00 0 +phiX174:1213 0 0.00 0 +phiX174:1214 0 0.00 0 +phiX174:1215 0 0.00 0 +phiX174:1216 0 0.00 0 +phiX174:1217 0 0.00 0 +phiX174:1218 0 0.00 0 +phiX174:1219 0 0.00 0 +phiX174:1220 0 0.00 0 +phiX174:1221 0 0.00 0 +phiX174:1222 0 0.00 0 +phiX174:1223 0 0.00 0 +phiX174:1224 0 0.00 0 +phiX174:1225 0 0.00 0 +phiX174:1226 0 0.00 0 +phiX174:1227 0 0.00 0 +phiX174:1228 0 0.00 0 +phiX174:1229 0 0.00 0 +phiX174:1230 0 0.00 0 +phiX174:1231 0 0.00 0 +phiX174:1232 0 0.00 0 +phiX174:1233 0 0.00 0 +phiX174:1234 0 0.00 0 +phiX174:1235 0 0.00 0 +phiX174:1236 0 0.00 0 +phiX174:1237 0 0.00 0 +phiX174:1238 0 0.00 0 +phiX174:1239 0 0.00 0 +phiX174:1240 0 0.00 0 +phiX174:1241 0 0.00 0 +phiX174:1242 0 0.00 0 +phiX174:1243 0 0.00 0 +phiX174:1244 0 0.00 0 +phiX174:1245 0 0.00 0 +phiX174:1246 0 0.00 0 +phiX174:1247 0 0.00 0 +phiX174:1248 0 0.00 0 +phiX174:1249 0 0.00 0 +phiX174:1250 0 0.00 0 +phiX174:1251 0 0.00 0 +phiX174:1252 0 0.00 0 +phiX174:1253 0 0.00 0 +phiX174:1254 0 0.00 0 +phiX174:1255 0 0.00 0 +phiX174:1256 0 0.00 0 +phiX174:1257 0 0.00 0 +phiX174:1258 0 0.00 0 +phiX174:1259 0 0.00 0 +phiX174:1260 0 0.00 0 +phiX174:1261 0 0.00 0 +phiX174:1262 0 0.00 0 +phiX174:1263 0 0.00 0 +phiX174:1264 0 0.00 0 +phiX174:1265 0 0.00 0 +phiX174:1266 0 0.00 0 +phiX174:1267 0 0.00 0 +phiX174:1268 0 0.00 0 +phiX174:1269 0 0.00 0 +phiX174:1270 0 0.00 0 +phiX174:1271 0 0.00 0 +phiX174:1272 0 0.00 0 +phiX174:1273 0 0.00 0 +phiX174:1274 0 0.00 0 +phiX174:1275 0 0.00 0 +phiX174:1276 0 0.00 0 +phiX174:1277 0 0.00 0 +phiX174:1278 0 0.00 0 +phiX174:1279 0 0.00 0 +phiX174:1280 0 0.00 0 +phiX174:1281 0 0.00 0 +phiX174:1282 0 0.00 0 +phiX174:1283 0 0.00 0 +phiX174:1284 0 0.00 0 +phiX174:1285 0 0.00 0 +phiX174:1286 0 0.00 0 +phiX174:1287 0 0.00 0 +phiX174:1288 0 0.00 0 +phiX174:1289 0 0.00 0 +phiX174:1290 0 0.00 0 +phiX174:1291 0 0.00 0 +phiX174:1292 0 0.00 0 +phiX174:1293 0 0.00 0 +phiX174:1294 0 0.00 0 +phiX174:1295 0 0.00 0 +phiX174:1296 0 0.00 0 +phiX174:1297 0 0.00 0 +phiX174:1298 0 0.00 0 +phiX174:1299 0 0.00 0 +phiX174:1300 0 0.00 0 +phiX174:1301 0 0.00 0 +phiX174:1302 0 0.00 0 +phiX174:1303 0 0.00 0 +phiX174:1304 0 0.00 0 +phiX174:1305 0 0.00 0 +phiX174:1306 0 0.00 0 +phiX174:1307 0 0.00 0 +phiX174:1308 0 0.00 0 +phiX174:1309 0 0.00 0 +phiX174:1310 0 0.00 0 +phiX174:1311 0 0.00 0 +phiX174:1312 0 0.00 0 +phiX174:1313 0 0.00 0 +phiX174:1314 0 0.00 0 +phiX174:1315 0 0.00 0 +phiX174:1316 0 0.00 0 +phiX174:1317 0 0.00 0 +phiX174:1318 0 0.00 0 +phiX174:1319 0 0.00 0 +phiX174:1320 0 0.00 0 +phiX174:1321 0 0.00 0 +phiX174:1322 0 0.00 0 +phiX174:1323 0 0.00 0 +phiX174:1324 0 0.00 0 +phiX174:1325 0 0.00 0 +phiX174:1326 0 0.00 0 +phiX174:1327 0 0.00 0 +phiX174:1328 0 0.00 0 +phiX174:1329 0 0.00 0 +phiX174:1330 0 0.00 0 +phiX174:1331 0 0.00 0 +phiX174:1332 0 0.00 0 +phiX174:1333 0 0.00 0 +phiX174:1334 0 0.00 0 +phiX174:1335 0 0.00 0 +phiX174:1336 0 0.00 0 +phiX174:1337 0 0.00 0 +phiX174:1338 0 0.00 0 +phiX174:1339 0 0.00 0 +phiX174:1340 0 0.00 0 +phiX174:1341 0 0.00 0 +phiX174:1342 0 0.00 0 +phiX174:1343 0 0.00 0 +phiX174:1344 0 0.00 0 +phiX174:1345 0 0.00 0 +phiX174:1346 0 0.00 0 +phiX174:1347 0 0.00 0 +phiX174:1348 0 0.00 0 +phiX174:1349 0 0.00 0 +phiX174:1350 0 0.00 0 +phiX174:1351 0 0.00 0 +phiX174:1352 0 0.00 0 +phiX174:1353 0 0.00 0 +phiX174:1354 0 0.00 0 +phiX174:1355 0 0.00 0 +phiX174:1356 0 0.00 0 +phiX174:1357 0 0.00 0 +phiX174:1358 0 0.00 0 +phiX174:1359 0 0.00 0 +phiX174:1360 0 0.00 0 +phiX174:1361 0 0.00 0 +phiX174:1362 0 0.00 0 +phiX174:1363 0 0.00 0 +phiX174:1364 0 0.00 0 +phiX174:1365 0 0.00 0 +phiX174:1366 0 0.00 0 +phiX174:1367 0 0.00 0 +phiX174:1368 0 0.00 0 +phiX174:1369 0 0.00 0 +phiX174:1370 0 0.00 0 +phiX174:1371 0 0.00 0 +phiX174:1372 0 0.00 0 +phiX174:1373 0 0.00 0 +phiX174:1374 0 0.00 0 +phiX174:1375 0 0.00 0 +phiX174:1376 0 0.00 0 +phiX174:1377 0 0.00 0 +phiX174:1378 0 0.00 0 +phiX174:1379 0 0.00 0 +phiX174:1380 0 0.00 0 +phiX174:1381 0 0.00 0 +phiX174:1382 0 0.00 0 +phiX174:1383 0 0.00 0 +phiX174:1384 0 0.00 0 +phiX174:1385 0 0.00 0 +phiX174:1386 0 0.00 0 +phiX174:1387 0 0.00 0 +phiX174:1388 0 0.00 0 +phiX174:1389 0 0.00 0 +phiX174:1390 0 0.00 0 +phiX174:1391 0 0.00 0 +phiX174:1392 0 0.00 0 +phiX174:1393 0 0.00 0 +phiX174:1394 0 0.00 0 +phiX174:1395 0 0.00 0 +phiX174:1396 0 0.00 0 +phiX174:1397 0 0.00 0 +phiX174:1398 0 0.00 0 +phiX174:1399 0 0.00 0 +phiX174:1400 0 0.00 0 +phiX174:1401 0 0.00 0 +phiX174:1402 0 0.00 0 +phiX174:1403 0 0.00 0 +phiX174:1404 0 0.00 0 +phiX174:1405 0 0.00 0 +phiX174:1406 0 0.00 0 +phiX174:1407 0 0.00 0 +phiX174:1408 0 0.00 0 +phiX174:1409 0 0.00 0 +phiX174:1410 0 0.00 0 +phiX174:1411 1 1.00 1 +phiX174:1412 3 3.00 3 +phiX174:1413 5 5.00 5 +phiX174:1414 6 6.00 6 +phiX174:1415 7 7.00 7 +phiX174:1416 8 8.00 8 +phiX174:1417 9 9.00 9 +phiX174:1418 10 10.00 10 +phiX174:1419 10 10.00 10 +phiX174:1420 10 10.00 10 +phiX174:1421 10 10.00 10 +phiX174:1422 10 10.00 10 +phiX174:1423 10 10.00 10 +phiX174:1424 10 10.00 10 +phiX174:1425 10 10.00 10 +phiX174:1426 10 10.00 10 +phiX174:1427 10 10.00 10 +phiX174:1428 10 10.00 10 +phiX174:1429 10 10.00 10 +phiX174:1430 10 10.00 10 +phiX174:1431 10 10.00 10 +phiX174:1432 10 10.00 10 +phiX174:1433 10 10.00 10 +phiX174:1434 10 10.00 10 +phiX174:1435 10 10.00 10 +phiX174:1436 10 10.00 10 +phiX174:1437 10 10.00 10 +phiX174:1438 10 10.00 10 +phiX174:1439 10 10.00 10 +phiX174:1440 10 10.00 10 +phiX174:1441 10 10.00 10 +phiX174:1442 10 10.00 10 +phiX174:1443 10 10.00 10 +phiX174:1444 7 7.00 7 +phiX174:1445 10 10.00 10 +phiX174:1446 10 10.00 10 +phiX174:1447 10 10.00 10 +phiX174:1448 8 8.00 8 +phiX174:1449 6 6.00 6 +phiX174:1450 4 4.00 4 +phiX174:1451 3 3.00 3 +phiX174:1452 2 2.00 2 +phiX174:1453 1 1.00 1 +phiX174:1454 0 0.00 0 +phiX174:1455 0 0.00 0 +phiX174:1456 0 0.00 0 +phiX174:1457 0 0.00 0 +phiX174:1458 0 0.00 0 +phiX174:1459 0 0.00 0 +phiX174:1460 0 0.00 0 +phiX174:1461 0 0.00 0 +phiX174:1462 0 0.00 0 +phiX174:1463 0 0.00 0 +phiX174:1464 0 0.00 0 +phiX174:1465 0 0.00 0 +phiX174:1466 0 0.00 0 +phiX174:1467 0 0.00 0 +phiX174:1468 0 0.00 0 +phiX174:1469 0 0.00 0 +phiX174:1470 0 0.00 0 +phiX174:1471 0 0.00 0 +phiX174:1472 0 0.00 0 +phiX174:1473 0 0.00 0 +phiX174:1474 0 0.00 0 +phiX174:1475 0 0.00 0 +phiX174:1476 0 0.00 0 +phiX174:1477 0 0.00 0 +phiX174:1478 0 0.00 0 +phiX174:1479 0 0.00 0 +phiX174:1480 0 0.00 0 +phiX174:1481 0 0.00 0 +phiX174:1482 0 0.00 0 +phiX174:1483 0 0.00 0 +phiX174:1484 0 0.00 0 +phiX174:1485 0 0.00 0 +phiX174:1486 0 0.00 0 +phiX174:1487 0 0.00 0 +phiX174:1488 0 0.00 0 +phiX174:1489 0 0.00 0 +phiX174:1490 0 0.00 0 +phiX174:1491 0 0.00 0 +phiX174:1492 0 0.00 0 +phiX174:1493 0 0.00 0 +phiX174:1494 0 0.00 0 +phiX174:1495 0 0.00 0 +phiX174:1496 0 0.00 0 +phiX174:1497 0 0.00 0 +phiX174:1498 0 0.00 0 +phiX174:1499 0 0.00 0 +phiX174:1500 0 0.00 0 +phiX174:1501 0 0.00 0 +phiX174:1502 0 0.00 0 +phiX174:1503 0 0.00 0 +phiX174:1504 0 0.00 0 +phiX174:1505 0 0.00 0 +phiX174:1506 0 0.00 0 +phiX174:1507 0 0.00 0 +phiX174:1508 0 0.00 0 +phiX174:1509 0 0.00 0 +phiX174:1510 0 0.00 0 +phiX174:1511 0 0.00 0 +phiX174:1512 0 0.00 0 +phiX174:1513 0 0.00 0 +phiX174:1514 0 0.00 0 +phiX174:1515 0 0.00 0 +phiX174:1516 0 0.00 0 +phiX174:1517 0 0.00 0 +phiX174:1518 0 0.00 0 +phiX174:1519 0 0.00 0 +phiX174:1520 0 0.00 0 +phiX174:1521 0 0.00 0 +phiX174:1522 0 0.00 0 +phiX174:1523 0 0.00 0 +phiX174:1524 0 0.00 0 +phiX174:1525 0 0.00 0 +phiX174:1526 0 0.00 0 +phiX174:1527 0 0.00 0 +phiX174:1528 0 0.00 0 +phiX174:1529 0 0.00 0 +phiX174:1530 0 0.00 0 +phiX174:1531 0 0.00 0 +phiX174:1532 0 0.00 0 +phiX174:1533 0 0.00 0 +phiX174:1534 0 0.00 0 +phiX174:1535 0 0.00 0 +phiX174:1536 0 0.00 0 +phiX174:1537 0 0.00 0 +phiX174:1538 0 0.00 0 +phiX174:1539 0 0.00 0 +phiX174:1540 0 0.00 0 +phiX174:1541 0 0.00 0 +phiX174:1542 0 0.00 0 +phiX174:1543 0 0.00 0 +phiX174:1544 0 0.00 0 +phiX174:1545 0 0.00 0 +phiX174:1546 0 0.00 0 +phiX174:1547 0 0.00 0 +phiX174:1548 0 0.00 0 +phiX174:1549 0 0.00 0 +phiX174:1550 0 0.00 0 +phiX174:1551 0 0.00 0 +phiX174:1552 0 0.00 0 +phiX174:1553 0 0.00 0 +phiX174:1554 0 0.00 0 +phiX174:1555 0 0.00 0 +phiX174:1556 0 0.00 0 +phiX174:1557 0 0.00 0 +phiX174:1558 0 0.00 0 +phiX174:1559 0 0.00 0 +phiX174:1560 0 0.00 0 +phiX174:1561 0 0.00 0 +phiX174:1562 0 0.00 0 +phiX174:1563 0 0.00 0 +phiX174:1564 0 0.00 0 +phiX174:1565 0 0.00 0 +phiX174:1566 0 0.00 0 +phiX174:1567 0 0.00 0 +phiX174:1568 0 0.00 0 +phiX174:1569 0 0.00 0 +phiX174:1570 0 0.00 0 +phiX174:1571 0 0.00 0 +phiX174:1572 0 0.00 0 +phiX174:1573 0 0.00 0 +phiX174:1574 0 0.00 0 +phiX174:1575 0 0.00 0 +phiX174:1576 0 0.00 0 +phiX174:1577 0 0.00 0 +phiX174:1578 0 0.00 0 +phiX174:1579 0 0.00 0 +phiX174:1580 0 0.00 0 +phiX174:1581 0 0.00 0 +phiX174:1582 0 0.00 0 +phiX174:1583 0 0.00 0 +phiX174:1584 0 0.00 0 +phiX174:1585 0 0.00 0 +phiX174:1586 0 0.00 0 +phiX174:1587 0 0.00 0 +phiX174:1588 0 0.00 0 +phiX174:1589 0 0.00 0 +phiX174:1590 0 0.00 0 +phiX174:1591 0 0.00 0 +phiX174:1592 0 0.00 0 +phiX174:1593 0 0.00 0 +phiX174:1594 0 0.00 0 +phiX174:1595 0 0.00 0 +phiX174:1596 0 0.00 0 +phiX174:1597 0 0.00 0 +phiX174:1598 0 0.00 0 +phiX174:1599 0 0.00 0 +phiX174:1600 0 0.00 0 +phiX174:1601 0 0.00 0 +phiX174:1602 0 0.00 0 +phiX174:1603 0 0.00 0 +phiX174:1604 0 0.00 0 +phiX174:1605 0 0.00 0 +phiX174:1606 0 0.00 0 +phiX174:1607 0 0.00 0 +phiX174:1608 0 0.00 0 +phiX174:1609 0 0.00 0 +phiX174:1610 0 0.00 0 +phiX174:1611 0 0.00 0 +phiX174:1612 0 0.00 0 +phiX174:1613 0 0.00 0 +phiX174:1614 0 0.00 0 +phiX174:1615 0 0.00 0 +phiX174:1616 0 0.00 0 +phiX174:1617 0 0.00 0 +phiX174:1618 0 0.00 0 +phiX174:1619 0 0.00 0 +phiX174:1620 0 0.00 0 +phiX174:1621 0 0.00 0 +phiX174:1622 0 0.00 0 +phiX174:1623 0 0.00 0 +phiX174:1624 0 0.00 0 +phiX174:1625 0 0.00 0 +phiX174:1626 0 0.00 0 +phiX174:1627 0 0.00 0 +phiX174:1628 0 0.00 0 +phiX174:1629 0 0.00 0 +phiX174:1630 0 0.00 0 +phiX174:1631 0 0.00 0 +phiX174:1632 0 0.00 0 +phiX174:1633 0 0.00 0 +phiX174:1634 0 0.00 0 +phiX174:1635 0 0.00 0 +phiX174:1636 0 0.00 0 +phiX174:1637 0 0.00 0 +phiX174:1638 0 0.00 0 +phiX174:1639 0 0.00 0 +phiX174:1640 0 0.00 0 +phiX174:1641 0 0.00 0 +phiX174:1642 0 0.00 0 +phiX174:1643 0 0.00 0 +phiX174:1644 0 0.00 0 +phiX174:1645 0 0.00 0 +phiX174:1646 0 0.00 0 +phiX174:1647 0 0.00 0 +phiX174:1648 0 0.00 0 +phiX174:1649 0 0.00 0 +phiX174:1650 0 0.00 0 +phiX174:1651 0 0.00 0 +phiX174:1652 0 0.00 0 +phiX174:1653 0 0.00 0 +phiX174:1654 0 0.00 0 +phiX174:1655 0 0.00 0 +phiX174:1656 0 0.00 0 +phiX174:1657 0 0.00 0 +phiX174:1658 0 0.00 0 +phiX174:1659 0 0.00 0 +phiX174:1660 0 0.00 0 +phiX174:1661 0 0.00 0 +phiX174:1662 0 0.00 0 +phiX174:1663 0 0.00 0 +phiX174:1664 0 0.00 0 +phiX174:1665 0 0.00 0 +phiX174:1666 0 0.00 0 +phiX174:1667 0 0.00 0 +phiX174:1668 0 0.00 0 +phiX174:1669 0 0.00 0 +phiX174:1670 0 0.00 0 +phiX174:1671 0 0.00 0 +phiX174:1672 0 0.00 0 +phiX174:1673 0 0.00 0 +phiX174:1674 0 0.00 0 +phiX174:1675 0 0.00 0 +phiX174:1676 0 0.00 0 +phiX174:1677 0 0.00 0 +phiX174:1678 0 0.00 0 +phiX174:1679 0 0.00 0 +phiX174:1680 0 0.00 0 +phiX174:1681 0 0.00 0 +phiX174:1682 0 0.00 0 +phiX174:1683 0 0.00 0 +phiX174:1684 0 0.00 0 +phiX174:1685 0 0.00 0 +phiX174:1686 0 0.00 0 +phiX174:1687 0 0.00 0 +phiX174:1688 0 0.00 0 +phiX174:1689 0 0.00 0 +phiX174:1690 0 0.00 0 +phiX174:1691 0 0.00 0 +phiX174:1692 0 0.00 0 +phiX174:1693 0 0.00 0 +phiX174:1694 0 0.00 0 +phiX174:1695 0 0.00 0 +phiX174:1696 0 0.00 0 +phiX174:1697 0 0.00 0 +phiX174:1698 0 0.00 0 +phiX174:1699 0 0.00 0 +phiX174:1700 0 0.00 0 +phiX174:1701 0 0.00 0 +phiX174:1702 0 0.00 0 +phiX174:1703 0 0.00 0 +phiX174:1704 0 0.00 0 +phiX174:1705 0 0.00 0 +phiX174:1706 0 0.00 0 +phiX174:1707 0 0.00 0 +phiX174:1708 0 0.00 0 +phiX174:1709 0 0.00 0 +phiX174:1710 0 0.00 0 +phiX174:1711 0 0.00 0 +phiX174:1712 0 0.00 0 +phiX174:1713 0 0.00 0 +phiX174:1714 0 0.00 0 +phiX174:1715 0 0.00 0 +phiX174:1716 0 0.00 0 +phiX174:1717 0 0.00 0 +phiX174:1718 0 0.00 0 +phiX174:1719 0 0.00 0 +phiX174:1720 0 0.00 0 +phiX174:1721 0 0.00 0 +phiX174:1722 0 0.00 0 +phiX174:1723 0 0.00 0 +phiX174:1724 0 0.00 0 +phiX174:1725 0 0.00 0 +phiX174:1726 0 0.00 0 +phiX174:1727 0 0.00 0 +phiX174:1728 0 0.00 0 +phiX174:1729 0 0.00 0 +phiX174:1730 0 0.00 0 +phiX174:1731 0 0.00 0 +phiX174:1732 0 0.00 0 +phiX174:1733 0 0.00 0 +phiX174:1734 0 0.00 0 +phiX174:1735 0 0.00 0 +phiX174:1736 0 0.00 0 +phiX174:1737 0 0.00 0 +phiX174:1738 0 0.00 0 +phiX174:1739 0 0.00 0 +phiX174:1740 0 0.00 0 +phiX174:1741 0 0.00 0 +phiX174:1742 0 0.00 0 +phiX174:1743 0 0.00 0 +phiX174:1744 0 0.00 0 +phiX174:1745 0 0.00 0 +phiX174:1746 0 0.00 0 +phiX174:1747 0 0.00 0 +phiX174:1748 0 0.00 0 +phiX174:1749 0 0.00 0 +phiX174:1750 0 0.00 0 +phiX174:1751 0 0.00 0 +phiX174:1752 0 0.00 0 +phiX174:1753 0 0.00 0 +phiX174:1754 0 0.00 0 +phiX174:1755 0 0.00 0 +phiX174:1756 0 0.00 0 +phiX174:1757 0 0.00 0 +phiX174:1758 0 0.00 0 +phiX174:1759 0 0.00 0 +phiX174:1760 0 0.00 0 +phiX174:1761 0 0.00 0 +phiX174:1762 0 0.00 0 +phiX174:1763 0 0.00 0 +phiX174:1764 0 0.00 0 +phiX174:1765 0 0.00 0 +phiX174:1766 0 0.00 0 +phiX174:1767 0 0.00 0 +phiX174:1768 0 0.00 0 +phiX174:1769 0 0.00 0 +phiX174:1770 0 0.00 0 +phiX174:1771 0 0.00 0 +phiX174:1772 0 0.00 0 +phiX174:1773 0 0.00 0 +phiX174:1774 0 0.00 0 +phiX174:1775 0 0.00 0 +phiX174:1776 0 0.00 0 +phiX174:1777 0 0.00 0 +phiX174:1778 0 0.00 0 +phiX174:1779 0 0.00 0 +phiX174:1780 0 0.00 0 +phiX174:1781 0 0.00 0 +phiX174:1782 0 0.00 0 +phiX174:1783 0 0.00 0 +phiX174:1784 0 0.00 0 +phiX174:1785 0 0.00 0 +phiX174:1786 0 0.00 0 +phiX174:1787 0 0.00 0 +phiX174:1788 0 0.00 0 +phiX174:1789 0 0.00 0 +phiX174:1790 0 0.00 0 +phiX174:1791 0 0.00 0 +phiX174:1792 0 0.00 0 +phiX174:1793 0 0.00 0 +phiX174:1794 0 0.00 0 +phiX174:1795 0 0.00 0 +phiX174:1796 0 0.00 0 +phiX174:1797 0 0.00 0 +phiX174:1798 0 0.00 0 +phiX174:1799 0 0.00 0 +phiX174:1800 0 0.00 0 +phiX174:1801 0 0.00 0 +phiX174:1802 0 0.00 0 +phiX174:1803 0 0.00 0 +phiX174:1804 0 0.00 0 +phiX174:1805 0 0.00 0 +phiX174:1806 0 0.00 0 +phiX174:1807 0 0.00 0 +phiX174:1808 0 0.00 0 +phiX174:1809 0 0.00 0 +phiX174:1810 0 0.00 0 +phiX174:1811 0 0.00 0 +phiX174:1812 0 0.00 0 +phiX174:1813 0 0.00 0 +phiX174:1814 0 0.00 0 +phiX174:1815 0 0.00 0 +phiX174:1816 0 0.00 0 +phiX174:1817 0 0.00 0 +phiX174:1818 0 0.00 0 +phiX174:1819 0 0.00 0 +phiX174:1820 0 0.00 0 +phiX174:1821 0 0.00 0 +phiX174:1822 0 0.00 0 +phiX174:1823 0 0.00 0 +phiX174:1824 0 0.00 0 +phiX174:1825 0 0.00 0 +phiX174:1826 0 0.00 0 +phiX174:1827 0 0.00 0 +phiX174:1828 0 0.00 0 +phiX174:1829 0 0.00 0 +phiX174:1830 0 0.00 0 +phiX174:1831 0 0.00 0 +phiX174:1832 0 0.00 0 +phiX174:1833 0 0.00 0 +phiX174:1834 0 0.00 0 +phiX174:1835 0 0.00 0 +phiX174:1836 0 0.00 0 +phiX174:1837 0 0.00 0 +phiX174:1838 0 0.00 0 +phiX174:1839 0 0.00 0 +phiX174:1840 0 0.00 0 +phiX174:1841 0 0.00 0 +phiX174:1842 0 0.00 0 +phiX174:1843 0 0.00 0 +phiX174:1844 0 0.00 0 +phiX174:1845 0 0.00 0 +phiX174:1846 0 0.00 0 +phiX174:1847 0 0.00 0 +phiX174:1848 0 0.00 0 +phiX174:1849 0 0.00 0 +phiX174:1850 0 0.00 0 +phiX174:1851 0 0.00 0 +phiX174:1852 0 0.00 0 +phiX174:1853 0 0.00 0 +phiX174:1854 0 0.00 0 +phiX174:1855 0 0.00 0 +phiX174:1856 0 0.00 0 +phiX174:1857 0 0.00 0 +phiX174:1858 0 0.00 0 +phiX174:1859 0 0.00 0 +phiX174:1860 0 0.00 0 +phiX174:1861 0 0.00 0 +phiX174:1862 0 0.00 0 +phiX174:1863 0 0.00 0 +phiX174:1864 0 0.00 0 +phiX174:1865 0 0.00 0 +phiX174:1866 0 0.00 0 +phiX174:1867 0 0.00 0 +phiX174:1868 0 0.00 0 +phiX174:1869 0 0.00 0 +phiX174:1870 0 0.00 0 +phiX174:1871 0 0.00 0 +phiX174:1872 0 0.00 0 +phiX174:1873 0 0.00 0 +phiX174:1874 0 0.00 0 +phiX174:1875 0 0.00 0 +phiX174:1876 0 0.00 0 +phiX174:1877 0 0.00 0 +phiX174:1878 0 0.00 0 +phiX174:1879 0 0.00 0 +phiX174:1880 0 0.00 0 +phiX174:1881 0 0.00 0 +phiX174:1882 0 0.00 0 +phiX174:1883 0 0.00 0 +phiX174:1884 0 0.00 0 +phiX174:1885 0 0.00 0 +phiX174:1886 0 0.00 0 +phiX174:1887 0 0.00 0 +phiX174:1888 0 0.00 0 +phiX174:1889 0 0.00 0 +phiX174:1890 0 0.00 0 +phiX174:1891 0 0.00 0 +phiX174:1892 0 0.00 0 +phiX174:1893 0 0.00 0 +phiX174:1894 0 0.00 0 +phiX174:1895 0 0.00 0 +phiX174:1896 0 0.00 0 +phiX174:1897 0 0.00 0 +phiX174:1898 0 0.00 0 +phiX174:1899 0 0.00 0 +phiX174:1900 0 0.00 0 +phiX174:1901 0 0.00 0 +phiX174:1902 0 0.00 0 +phiX174:1903 0 0.00 0 +phiX174:1904 0 0.00 0 +phiX174:1905 0 0.00 0 +phiX174:1906 0 0.00 0 +phiX174:1907 0 0.00 0 +phiX174:1908 0 0.00 0 +phiX174:1909 0 0.00 0 +phiX174:1910 0 0.00 0 +phiX174:1911 0 0.00 0 +phiX174:1912 0 0.00 0 +phiX174:1913 0 0.00 0 +phiX174:1914 0 0.00 0 +phiX174:1915 0 0.00 0 +phiX174:1916 0 0.00 0 +phiX174:1917 0 0.00 0 +phiX174:1918 0 0.00 0 +phiX174:1919 0 0.00 0 +phiX174:1920 0 0.00 0 +phiX174:1921 0 0.00 0 +phiX174:1922 0 0.00 0 +phiX174:1923 0 0.00 0 +phiX174:1924 0 0.00 0 +phiX174:1925 0 0.00 0 +phiX174:1926 0 0.00 0 +phiX174:1927 0 0.00 0 +phiX174:1928 0 0.00 0 +phiX174:1929 0 0.00 0 +phiX174:1930 0 0.00 0 +phiX174:1931 0 0.00 0 +phiX174:1932 0 0.00 0 +phiX174:1933 0 0.00 0 +phiX174:1934 0 0.00 0 +phiX174:1935 0 0.00 0 +phiX174:1936 0 0.00 0 +phiX174:1937 0 0.00 0 +phiX174:1938 0 0.00 0 +phiX174:1939 0 0.00 0 +phiX174:1940 0 0.00 0 +phiX174:1941 0 0.00 0 +phiX174:1942 0 0.00 0 +phiX174:1943 0 0.00 0 +phiX174:1944 0 0.00 0 +phiX174:1945 0 0.00 0 +phiX174:1946 0 0.00 0 +phiX174:1947 0 0.00 0 +phiX174:1948 0 0.00 0 +phiX174:1949 0 0.00 0 +phiX174:1950 0 0.00 0 +phiX174:1951 0 0.00 0 +phiX174:1952 0 0.00 0 +phiX174:1953 0 0.00 0 +phiX174:1954 0 0.00 0 +phiX174:1955 0 0.00 0 +phiX174:1956 0 0.00 0 +phiX174:1957 0 0.00 0 +phiX174:1958 0 0.00 0 +phiX174:1959 0 0.00 0 +phiX174:1960 0 0.00 0 +phiX174:1961 0 0.00 0 +phiX174:1962 0 0.00 0 +phiX174:1963 0 0.00 0 +phiX174:1964 0 0.00 0 +phiX174:1965 0 0.00 0 +phiX174:1966 0 0.00 0 +phiX174:1967 0 0.00 0 +phiX174:1968 0 0.00 0 +phiX174:1969 0 0.00 0 +phiX174:1970 0 0.00 0 +phiX174:1971 0 0.00 0 +phiX174:1972 0 0.00 0 +phiX174:1973 0 0.00 0 +phiX174:1974 0 0.00 0 +phiX174:1975 0 0.00 0 +phiX174:1976 0 0.00 0 +phiX174:1977 0 0.00 0 +phiX174:1978 0 0.00 0 +phiX174:1979 0 0.00 0 +phiX174:1980 0 0.00 0 +phiX174:1981 0 0.00 0 +phiX174:1982 0 0.00 0 +phiX174:1983 0 0.00 0 +phiX174:1984 0 0.00 0 +phiX174:1985 0 0.00 0 +phiX174:1986 0 0.00 0 +phiX174:1987 0 0.00 0 +phiX174:1988 0 0.00 0 +phiX174:1989 0 0.00 0 +phiX174:1990 0 0.00 0 +phiX174:1991 0 0.00 0 +phiX174:1992 0 0.00 0 +phiX174:1993 0 0.00 0 +phiX174:1994 0 0.00 0 +phiX174:1995 0 0.00 0 +phiX174:1996 0 0.00 0 +phiX174:1997 0 0.00 0 +phiX174:1998 0 0.00 0 +phiX174:1999 0 0.00 0 +phiX174:2000 0 0.00 0 +phiX174:2001 0 0.00 0 +phiX174:2002 0 0.00 0 +phiX174:2003 0 0.00 0 +phiX174:2004 0 0.00 0 +phiX174:2005 0 0.00 0 +phiX174:2006 0 0.00 0 +phiX174:2007 0 0.00 0 +phiX174:2008 0 0.00 0 +phiX174:2009 0 0.00 0 +phiX174:2010 0 0.00 0 +phiX174:2011 0 0.00 0 +phiX174:2012 0 0.00 0 +phiX174:2013 0 0.00 0 +phiX174:2014 0 0.00 0 +phiX174:2015 0 0.00 0 +phiX174:2016 0 0.00 0 +phiX174:2017 0 0.00 0 +phiX174:2018 0 0.00 0 +phiX174:2019 0 0.00 0 +phiX174:2020 0 0.00 0 +phiX174:2021 0 0.00 0 +phiX174:2022 0 0.00 0 +phiX174:2023 0 0.00 0 +phiX174:2024 0 0.00 0 +phiX174:2025 0 0.00 0 +phiX174:2026 0 0.00 0 +phiX174:2027 0 0.00 0 +phiX174:2028 0 0.00 0 +phiX174:2029 0 0.00 0 +phiX174:2030 0 0.00 0 +phiX174:2031 0 0.00 0 +phiX174:2032 0 0.00 0 +phiX174:2033 0 0.00 0 +phiX174:2034 0 0.00 0 +phiX174:2035 0 0.00 0 +phiX174:2036 0 0.00 0 +phiX174:2037 0 0.00 0 +phiX174:2038 0 0.00 0 +phiX174:2039 0 0.00 0 +phiX174:2040 0 0.00 0 +phiX174:2041 0 0.00 0 +phiX174:2042 0 0.00 0 +phiX174:2043 0 0.00 0 +phiX174:2044 0 0.00 0 +phiX174:2045 0 0.00 0 +phiX174:2046 0 0.00 0 +phiX174:2047 0 0.00 0 +phiX174:2048 0 0.00 0 +phiX174:2049 0 0.00 0 +phiX174:2050 0 0.00 0 +phiX174:2051 0 0.00 0 +phiX174:2052 0 0.00 0 +phiX174:2053 0 0.00 0 +phiX174:2054 0 0.00 0 +phiX174:2055 0 0.00 0 +phiX174:2056 0 0.00 0 +phiX174:2057 0 0.00 0 +phiX174:2058 0 0.00 0 +phiX174:2059 0 0.00 0 +phiX174:2060 0 0.00 0 +phiX174:2061 0 0.00 0 +phiX174:2062 0 0.00 0 +phiX174:2063 0 0.00 0 +phiX174:2064 0 0.00 0 +phiX174:2065 0 0.00 0 +phiX174:2066 0 0.00 0 +phiX174:2067 0 0.00 0 +phiX174:2068 0 0.00 0 +phiX174:2069 0 0.00 0 +phiX174:2070 0 0.00 0 +phiX174:2071 0 0.00 0 +phiX174:2072 0 0.00 0 +phiX174:2073 0 0.00 0 +phiX174:2074 0 0.00 0 +phiX174:2075 0 0.00 0 +phiX174:2076 0 0.00 0 +phiX174:2077 0 0.00 0 +phiX174:2078 0 0.00 0 +phiX174:2079 0 0.00 0 +phiX174:2080 0 0.00 0 +phiX174:2081 0 0.00 0 +phiX174:2082 0 0.00 0 +phiX174:2083 0 0.00 0 +phiX174:2084 0 0.00 0 +phiX174:2085 0 0.00 0 +phiX174:2086 0 0.00 0 +phiX174:2087 0 0.00 0 +phiX174:2088 0 0.00 0 +phiX174:2089 0 0.00 0 +phiX174:2090 0 0.00 0 +phiX174:2091 0 0.00 0 +phiX174:2092 0 0.00 0 +phiX174:2093 0 0.00 0 +phiX174:2094 0 0.00 0 +phiX174:2095 0 0.00 0 +phiX174:2096 0 0.00 0 +phiX174:2097 0 0.00 0 +phiX174:2098 0 0.00 0 +phiX174:2099 0 0.00 0 +phiX174:2100 0 0.00 0 +phiX174:2101 0 0.00 0 +phiX174:2102 0 0.00 0 +phiX174:2103 0 0.00 0 +phiX174:2104 0 0.00 0 +phiX174:2105 0 0.00 0 +phiX174:2106 0 0.00 0 +phiX174:2107 0 0.00 0 +phiX174:2108 0 0.00 0 +phiX174:2109 0 0.00 0 +phiX174:2110 0 0.00 0 +phiX174:2111 0 0.00 0 +phiX174:2112 0 0.00 0 +phiX174:2113 0 0.00 0 +phiX174:2114 0 0.00 0 +phiX174:2115 0 0.00 0 +phiX174:2116 0 0.00 0 +phiX174:2117 0 0.00 0 +phiX174:2118 0 0.00 0 +phiX174:2119 0 0.00 0 +phiX174:2120 0 0.00 0 +phiX174:2121 0 0.00 0 +phiX174:2122 0 0.00 0 +phiX174:2123 0 0.00 0 +phiX174:2124 0 0.00 0 +phiX174:2125 0 0.00 0 +phiX174:2126 0 0.00 0 +phiX174:2127 0 0.00 0 +phiX174:2128 0 0.00 0 +phiX174:2129 0 0.00 0 +phiX174:2130 0 0.00 0 +phiX174:2131 0 0.00 0 +phiX174:2132 0 0.00 0 +phiX174:2133 0 0.00 0 +phiX174:2134 0 0.00 0 +phiX174:2135 0 0.00 0 +phiX174:2136 0 0.00 0 +phiX174:2137 0 0.00 0 +phiX174:2138 0 0.00 0 +phiX174:2139 0 0.00 0 +phiX174:2140 0 0.00 0 +phiX174:2141 0 0.00 0 +phiX174:2142 0 0.00 0 +phiX174:2143 0 0.00 0 +phiX174:2144 0 0.00 0 +phiX174:2145 0 0.00 0 +phiX174:2146 0 0.00 0 +phiX174:2147 0 0.00 0 +phiX174:2148 0 0.00 0 +phiX174:2149 0 0.00 0 +phiX174:2150 0 0.00 0 +phiX174:2151 0 0.00 0 +phiX174:2152 0 0.00 0 +phiX174:2153 0 0.00 0 +phiX174:2154 0 0.00 0 +phiX174:2155 0 0.00 0 +phiX174:2156 0 0.00 0 +phiX174:2157 0 0.00 0 +phiX174:2158 0 0.00 0 +phiX174:2159 0 0.00 0 +phiX174:2160 0 0.00 0 +phiX174:2161 0 0.00 0 +phiX174:2162 0 0.00 0 +phiX174:2163 0 0.00 0 +phiX174:2164 0 0.00 0 +phiX174:2165 0 0.00 0 +phiX174:2166 0 0.00 0 +phiX174:2167 0 0.00 0 +phiX174:2168 0 0.00 0 +phiX174:2169 0 0.00 0 +phiX174:2170 0 0.00 0 +phiX174:2171 0 0.00 0 +phiX174:2172 0 0.00 0 +phiX174:2173 0 0.00 0 +phiX174:2174 0 0.00 0 +phiX174:2175 0 0.00 0 +phiX174:2176 0 0.00 0 +phiX174:2177 0 0.00 0 +phiX174:2178 0 0.00 0 +phiX174:2179 0 0.00 0 +phiX174:2180 0 0.00 0 +phiX174:2181 0 0.00 0 +phiX174:2182 0 0.00 0 +phiX174:2183 0 0.00 0 +phiX174:2184 0 0.00 0 +phiX174:2185 0 0.00 0 +phiX174:2186 0 0.00 0 +phiX174:2187 0 0.00 0 +phiX174:2188 0 0.00 0 +phiX174:2189 0 0.00 0 +phiX174:2190 0 0.00 0 +phiX174:2191 0 0.00 0 +phiX174:2192 0 0.00 0 +phiX174:2193 0 0.00 0 +phiX174:2194 0 0.00 0 +phiX174:2195 0 0.00 0 +phiX174:2196 0 0.00 0 +phiX174:2197 0 0.00 0 +phiX174:2198 0 0.00 0 +phiX174:2199 0 0.00 0 +phiX174:2200 0 0.00 0 +phiX174:2201 0 0.00 0 +phiX174:2202 0 0.00 0 +phiX174:2203 0 0.00 0 +phiX174:2204 0 0.00 0 +phiX174:2205 0 0.00 0 +phiX174:2206 0 0.00 0 +phiX174:2207 0 0.00 0 +phiX174:2208 0 0.00 0 +phiX174:2209 0 0.00 0 +phiX174:2210 0 0.00 0 +phiX174:2211 0 0.00 0 +phiX174:2212 0 0.00 0 +phiX174:2213 0 0.00 0 +phiX174:2214 0 0.00 0 +phiX174:2215 0 0.00 0 +phiX174:2216 0 0.00 0 +phiX174:2217 0 0.00 0 +phiX174:2218 0 0.00 0 +phiX174:2219 0 0.00 0 +phiX174:2220 0 0.00 0 +phiX174:2221 0 0.00 0 +phiX174:2222 0 0.00 0 +phiX174:2223 0 0.00 0 +phiX174:2224 0 0.00 0 +phiX174:2225 0 0.00 0 +phiX174:2226 0 0.00 0 +phiX174:2227 0 0.00 0 +phiX174:2228 0 0.00 0 +phiX174:2229 0 0.00 0 +phiX174:2230 0 0.00 0 +phiX174:2231 0 0.00 0 +phiX174:2232 0 0.00 0 +phiX174:2233 0 0.00 0 +phiX174:2234 0 0.00 0 +phiX174:2235 0 0.00 0 +phiX174:2236 0 0.00 0 +phiX174:2237 0 0.00 0 +phiX174:2238 0 0.00 0 +phiX174:2239 0 0.00 0 +phiX174:2240 0 0.00 0 +phiX174:2241 0 0.00 0 +phiX174:2242 0 0.00 0 +phiX174:2243 0 0.00 0 +phiX174:2244 0 0.00 0 +phiX174:2245 0 0.00 0 +phiX174:2246 0 0.00 0 +phiX174:2247 0 0.00 0 +phiX174:2248 0 0.00 0 +phiX174:2249 0 0.00 0 +phiX174:2250 0 0.00 0 +phiX174:2251 0 0.00 0 +phiX174:2252 0 0.00 0 +phiX174:2253 0 0.00 0 +phiX174:2254 0 0.00 0 +phiX174:2255 0 0.00 0 +phiX174:2256 0 0.00 0 +phiX174:2257 0 0.00 0 +phiX174:2258 0 0.00 0 +phiX174:2259 0 0.00 0 +phiX174:2260 0 0.00 0 +phiX174:2261 0 0.00 0 +phiX174:2262 0 0.00 0 +phiX174:2263 0 0.00 0 +phiX174:2264 0 0.00 0 +phiX174:2265 0 0.00 0 +phiX174:2266 0 0.00 0 +phiX174:2267 0 0.00 0 +phiX174:2268 0 0.00 0 +phiX174:2269 0 0.00 0 +phiX174:2270 0 0.00 0 +phiX174:2271 0 0.00 0 +phiX174:2272 0 0.00 0 +phiX174:2273 0 0.00 0 +phiX174:2274 0 0.00 0 +phiX174:2275 0 0.00 0 +phiX174:2276 0 0.00 0 +phiX174:2277 0 0.00 0 +phiX174:2278 0 0.00 0 +phiX174:2279 0 0.00 0 +phiX174:2280 0 0.00 0 +phiX174:2281 0 0.00 0 +phiX174:2282 0 0.00 0 +phiX174:2283 0 0.00 0 +phiX174:2284 0 0.00 0 +phiX174:2285 0 0.00 0 +phiX174:2286 0 0.00 0 +phiX174:2287 0 0.00 0 +phiX174:2288 0 0.00 0 +phiX174:2289 0 0.00 0 +phiX174:2290 0 0.00 0 +phiX174:2291 0 0.00 0 +phiX174:2292 0 0.00 0 +phiX174:2293 0 0.00 0 +phiX174:2294 0 0.00 0 +phiX174:2295 0 0.00 0 +phiX174:2296 0 0.00 0 +phiX174:2297 0 0.00 0 +phiX174:2298 0 0.00 0 +phiX174:2299 0 0.00 0 +phiX174:2300 0 0.00 0 +phiX174:2301 0 0.00 0 +phiX174:2302 0 0.00 0 +phiX174:2303 0 0.00 0 +phiX174:2304 0 0.00 0 +phiX174:2305 0 0.00 0 +phiX174:2306 0 0.00 0 +phiX174:2307 0 0.00 0 +phiX174:2308 0 0.00 0 +phiX174:2309 0 0.00 0 +phiX174:2310 0 0.00 0 +phiX174:2311 0 0.00 0 +phiX174:2312 0 0.00 0 +phiX174:2313 0 0.00 0 +phiX174:2314 0 0.00 0 +phiX174:2315 0 0.00 0 +phiX174:2316 0 0.00 0 +phiX174:2317 0 0.00 0 +phiX174:2318 0 0.00 0 +phiX174:2319 0 0.00 0 +phiX174:2320 0 0.00 0 +phiX174:2321 0 0.00 0 +phiX174:2322 0 0.00 0 +phiX174:2323 0 0.00 0 +phiX174:2324 0 0.00 0 +phiX174:2325 0 0.00 0 +phiX174:2326 0 0.00 0 +phiX174:2327 0 0.00 0 +phiX174:2328 0 0.00 0 +phiX174:2329 0 0.00 0 +phiX174:2330 0 0.00 0 +phiX174:2331 0 0.00 0 +phiX174:2332 0 0.00 0 +phiX174:2333 0 0.00 0 +phiX174:2334 0 0.00 0 +phiX174:2335 0 0.00 0 +phiX174:2336 0 0.00 0 +phiX174:2337 0 0.00 0 +phiX174:2338 0 0.00 0 +phiX174:2339 0 0.00 0 +phiX174:2340 0 0.00 0 +phiX174:2341 0 0.00 0 +phiX174:2342 0 0.00 0 +phiX174:2343 0 0.00 0 +phiX174:2344 0 0.00 0 +phiX174:2345 0 0.00 0 +phiX174:2346 0 0.00 0 +phiX174:2347 0 0.00 0 +phiX174:2348 0 0.00 0 +phiX174:2349 0 0.00 0 +phiX174:2350 0 0.00 0 +phiX174:2351 0 0.00 0 +phiX174:2352 0 0.00 0 +phiX174:2353 0 0.00 0 +phiX174:2354 0 0.00 0 +phiX174:2355 0 0.00 0 +phiX174:2356 0 0.00 0 +phiX174:2357 0 0.00 0 +phiX174:2358 0 0.00 0 +phiX174:2359 0 0.00 0 +phiX174:2360 0 0.00 0 +phiX174:2361 0 0.00 0 +phiX174:2362 0 0.00 0 +phiX174:2363 0 0.00 0 +phiX174:2364 0 0.00 0 +phiX174:2365 0 0.00 0 +phiX174:2366 0 0.00 0 +phiX174:2367 0 0.00 0 +phiX174:2368 0 0.00 0 +phiX174:2369 0 0.00 0 +phiX174:2370 0 0.00 0 +phiX174:2371 0 0.00 0 +phiX174:2372 0 0.00 0 +phiX174:2373 0 0.00 0 +phiX174:2374 0 0.00 0 +phiX174:2375 0 0.00 0 +phiX174:2376 0 0.00 0 +phiX174:2377 0 0.00 0 +phiX174:2378 0 0.00 0 +phiX174:2379 0 0.00 0 +phiX174:2380 0 0.00 0 +phiX174:2381 0 0.00 0 +phiX174:2382 0 0.00 0 +phiX174:2383 0 0.00 0 +phiX174:2384 0 0.00 0 +phiX174:2385 0 0.00 0 +phiX174:2386 0 0.00 0 +phiX174:2387 0 0.00 0 +phiX174:2388 0 0.00 0 +phiX174:2389 0 0.00 0 +phiX174:2390 0 0.00 0 +phiX174:2391 0 0.00 0 +phiX174:2392 0 0.00 0 +phiX174:2393 0 0.00 0 +phiX174:2394 0 0.00 0 +phiX174:2395 0 0.00 0 +phiX174:2396 0 0.00 0 +phiX174:2397 0 0.00 0 +phiX174:2398 0 0.00 0 +phiX174:2399 0 0.00 0 +phiX174:2400 0 0.00 0 +phiX174:2401 0 0.00 0 +phiX174:2402 0 0.00 0 +phiX174:2403 0 0.00 0 +phiX174:2404 0 0.00 0 +phiX174:2405 0 0.00 0 +phiX174:2406 0 0.00 0 +phiX174:2407 0 0.00 0 +phiX174:2408 0 0.00 0 +phiX174:2409 0 0.00 0 +phiX174:2410 0 0.00 0 +phiX174:2411 0 0.00 0 +phiX174:2412 0 0.00 0 +phiX174:2413 0 0.00 0 +phiX174:2414 0 0.00 0 +phiX174:2415 0 0.00 0 +phiX174:2416 0 0.00 0 +phiX174:2417 0 0.00 0 +phiX174:2418 0 0.00 0 +phiX174:2419 0 0.00 0 +phiX174:2420 0 0.00 0 +phiX174:2421 0 0.00 0 +phiX174:2422 0 0.00 0 +phiX174:2423 0 0.00 0 +phiX174:2424 0 0.00 0 +phiX174:2425 0 0.00 0 +phiX174:2426 0 0.00 0 +phiX174:2427 0 0.00 0 +phiX174:2428 0 0.00 0 +phiX174:2429 0 0.00 0 +phiX174:2430 0 0.00 0 +phiX174:2431 0 0.00 0 +phiX174:2432 0 0.00 0 +phiX174:2433 0 0.00 0 +phiX174:2434 0 0.00 0 +phiX174:2435 0 0.00 0 +phiX174:2436 0 0.00 0 +phiX174:2437 0 0.00 0 +phiX174:2438 0 0.00 0 +phiX174:2439 0 0.00 0 +phiX174:2440 0 0.00 0 +phiX174:2441 0 0.00 0 +phiX174:2442 0 0.00 0 +phiX174:2443 0 0.00 0 +phiX174:2444 0 0.00 0 +phiX174:2445 0 0.00 0 +phiX174:2446 0 0.00 0 +phiX174:2447 0 0.00 0 +phiX174:2448 0 0.00 0 +phiX174:2449 0 0.00 0 +phiX174:2450 0 0.00 0 +phiX174:2451 0 0.00 0 +phiX174:2452 0 0.00 0 +phiX174:2453 0 0.00 0 +phiX174:2454 0 0.00 0 +phiX174:2455 0 0.00 0 +phiX174:2456 0 0.00 0 +phiX174:2457 0 0.00 0 +phiX174:2458 0 0.00 0 +phiX174:2459 0 0.00 0 +phiX174:2460 0 0.00 0 +phiX174:2461 0 0.00 0 +phiX174:2462 0 0.00 0 +phiX174:2463 0 0.00 0 +phiX174:2464 0 0.00 0 +phiX174:2465 0 0.00 0 +phiX174:2466 0 0.00 0 +phiX174:2467 0 0.00 0 +phiX174:2468 0 0.00 0 +phiX174:2469 0 0.00 0 +phiX174:2470 0 0.00 0 +phiX174:2471 0 0.00 0 +phiX174:2472 0 0.00 0 +phiX174:2473 0 0.00 0 +phiX174:2474 0 0.00 0 +phiX174:2475 0 0.00 0 +phiX174:2476 0 0.00 0 +phiX174:2477 0 0.00 0 +phiX174:2478 0 0.00 0 +phiX174:2479 0 0.00 0 +phiX174:2480 0 0.00 0 +phiX174:2481 0 0.00 0 +phiX174:2482 0 0.00 0 +phiX174:2483 0 0.00 0 +phiX174:2484 0 0.00 0 +phiX174:2485 0 0.00 0 +phiX174:2486 0 0.00 0 +phiX174:2487 0 0.00 0 +phiX174:2488 0 0.00 0 +phiX174:2489 0 0.00 0 +phiX174:2490 0 0.00 0 +phiX174:2491 0 0.00 0 +phiX174:2492 0 0.00 0 +phiX174:2493 0 0.00 0 +phiX174:2494 0 0.00 0 +phiX174:2495 0 0.00 0 +phiX174:2496 0 0.00 0 +phiX174:2497 0 0.00 0 +phiX174:2498 0 0.00 0 +phiX174:2499 0 0.00 0 +phiX174:2500 0 0.00 0 +phiX174:2501 0 0.00 0 +phiX174:2502 0 0.00 0 +phiX174:2503 0 0.00 0 +phiX174:2504 0 0.00 0 +phiX174:2505 0 0.00 0 +phiX174:2506 0 0.00 0 +phiX174:2507 0 0.00 0 +phiX174:2508 0 0.00 0 +phiX174:2509 0 0.00 0 +phiX174:2510 0 0.00 0 +phiX174:2511 0 0.00 0 +phiX174:2512 0 0.00 0 +phiX174:2513 0 0.00 0 +phiX174:2514 0 0.00 0 +phiX174:2515 0 0.00 0 +phiX174:2516 0 0.00 0 +phiX174:2517 0 0.00 0 +phiX174:2518 0 0.00 0 +phiX174:2519 0 0.00 0 +phiX174:2520 0 0.00 0 +phiX174:2521 0 0.00 0 +phiX174:2522 0 0.00 0 +phiX174:2523 0 0.00 0 +phiX174:2524 0 0.00 0 +phiX174:2525 0 0.00 0 +phiX174:2526 0 0.00 0 +phiX174:2527 0 0.00 0 +phiX174:2528 0 0.00 0 +phiX174:2529 0 0.00 0 +phiX174:2530 0 0.00 0 +phiX174:2531 0 0.00 0 +phiX174:2532 0 0.00 0 +phiX174:2533 0 0.00 0 +phiX174:2534 0 0.00 0 +phiX174:2535 0 0.00 0 +phiX174:2536 0 0.00 0 +phiX174:2537 0 0.00 0 +phiX174:2538 0 0.00 0 +phiX174:2539 0 0.00 0 +phiX174:2540 0 0.00 0 +phiX174:2541 0 0.00 0 +phiX174:2542 0 0.00 0 +phiX174:2543 0 0.00 0 +phiX174:2544 0 0.00 0 +phiX174:2545 0 0.00 0 +phiX174:2546 0 0.00 0 +phiX174:2547 0 0.00 0 +phiX174:2548 0 0.00 0 +phiX174:2549 0 0.00 0 +phiX174:2550 0 0.00 0 +phiX174:2551 0 0.00 0 +phiX174:2552 0 0.00 0 +phiX174:2553 0 0.00 0 +phiX174:2554 0 0.00 0 +phiX174:2555 0 0.00 0 +phiX174:2556 0 0.00 0 +phiX174:2557 0 0.00 0 +phiX174:2558 0 0.00 0 +phiX174:2559 0 0.00 0 +phiX174:2560 0 0.00 0 +phiX174:2561 0 0.00 0 +phiX174:2562 0 0.00 0 +phiX174:2563 0 0.00 0 +phiX174:2564 0 0.00 0 +phiX174:2565 0 0.00 0 +phiX174:2566 0 0.00 0 +phiX174:2567 0 0.00 0 +phiX174:2568 0 0.00 0 +phiX174:2569 0 0.00 0 +phiX174:2570 0 0.00 0 +phiX174:2571 0 0.00 0 +phiX174:2572 0 0.00 0 +phiX174:2573 0 0.00 0 +phiX174:2574 0 0.00 0 +phiX174:2575 0 0.00 0 +phiX174:2576 0 0.00 0 +phiX174:2577 0 0.00 0 +phiX174:2578 0 0.00 0 +phiX174:2579 0 0.00 0 +phiX174:2580 0 0.00 0 +phiX174:2581 0 0.00 0 +phiX174:2582 0 0.00 0 +phiX174:2583 0 0.00 0 +phiX174:2584 0 0.00 0 +phiX174:2585 0 0.00 0 +phiX174:2586 0 0.00 0 +phiX174:2587 0 0.00 0 +phiX174:2588 0 0.00 0 +phiX174:2589 0 0.00 0 +phiX174:2590 0 0.00 0 +phiX174:2591 0 0.00 0 +phiX174:2592 0 0.00 0 +phiX174:2593 0 0.00 0 +phiX174:2594 0 0.00 0 +phiX174:2595 0 0.00 0 +phiX174:2596 0 0.00 0 +phiX174:2597 0 0.00 0 +phiX174:2598 0 0.00 0 +phiX174:2599 0 0.00 0 +phiX174:2600 0 0.00 0 +phiX174:2601 0 0.00 0 +phiX174:2602 0 0.00 0 +phiX174:2603 0 0.00 0 +phiX174:2604 0 0.00 0 +phiX174:2605 0 0.00 0 +phiX174:2606 0 0.00 0 +phiX174:2607 0 0.00 0 +phiX174:2608 0 0.00 0 +phiX174:2609 0 0.00 0 +phiX174:2610 0 0.00 0 +phiX174:2611 0 0.00 0 +phiX174:2612 0 0.00 0 +phiX174:2613 0 0.00 0 +phiX174:2614 0 0.00 0 +phiX174:2615 0 0.00 0 +phiX174:2616 0 0.00 0 +phiX174:2617 0 0.00 0 +phiX174:2618 0 0.00 0 +phiX174:2619 0 0.00 0 +phiX174:2620 0 0.00 0 +phiX174:2621 0 0.00 0 +phiX174:2622 0 0.00 0 +phiX174:2623 0 0.00 0 +phiX174:2624 0 0.00 0 +phiX174:2625 0 0.00 0 +phiX174:2626 0 0.00 0 +phiX174:2627 0 0.00 0 +phiX174:2628 0 0.00 0 +phiX174:2629 0 0.00 0 +phiX174:2630 0 0.00 0 +phiX174:2631 0 0.00 0 +phiX174:2632 0 0.00 0 +phiX174:2633 0 0.00 0 +phiX174:2634 0 0.00 0 +phiX174:2635 0 0.00 0 +phiX174:2636 0 0.00 0 +phiX174:2637 0 0.00 0 +phiX174:2638 0 0.00 0 +phiX174:2639 0 0.00 0 +phiX174:2640 0 0.00 0 +phiX174:2641 0 0.00 0 +phiX174:2642 0 0.00 0 +phiX174:2643 0 0.00 0 +phiX174:2644 0 0.00 0 +phiX174:2645 0 0.00 0 +phiX174:2646 0 0.00 0 +phiX174:2647 0 0.00 0 +phiX174:2648 0 0.00 0 +phiX174:2649 0 0.00 0 +phiX174:2650 0 0.00 0 +phiX174:2651 0 0.00 0 +phiX174:2652 0 0.00 0 +phiX174:2653 0 0.00 0 +phiX174:2654 0 0.00 0 +phiX174:2655 0 0.00 0 +phiX174:2656 0 0.00 0 +phiX174:2657 0 0.00 0 +phiX174:2658 0 0.00 0 +phiX174:2659 0 0.00 0 +phiX174:2660 0 0.00 0 +phiX174:2661 0 0.00 0 +phiX174:2662 0 0.00 0 +phiX174:2663 0 0.00 0 +phiX174:2664 0 0.00 0 +phiX174:2665 0 0.00 0 +phiX174:2666 0 0.00 0 +phiX174:2667 0 0.00 0 +phiX174:2668 0 0.00 0 +phiX174:2669 0 0.00 0 +phiX174:2670 0 0.00 0 +phiX174:2671 0 0.00 0 +phiX174:2672 0 0.00 0 +phiX174:2673 0 0.00 0 +phiX174:2674 0 0.00 0 +phiX174:2675 0 0.00 0 +phiX174:2676 0 0.00 0 +phiX174:2677 0 0.00 0 +phiX174:2678 0 0.00 0 +phiX174:2679 0 0.00 0 +phiX174:2680 0 0.00 0 +phiX174:2681 0 0.00 0 +phiX174:2682 0 0.00 0 +phiX174:2683 0 0.00 0 +phiX174:2684 0 0.00 0 +phiX174:2685 0 0.00 0 +phiX174:2686 0 0.00 0 +phiX174:2687 0 0.00 0 +phiX174:2688 0 0.00 0 +phiX174:2689 0 0.00 0 +phiX174:2690 0 0.00 0 +phiX174:2691 0 0.00 0 +phiX174:2692 0 0.00 0 +phiX174:2693 0 0.00 0 +phiX174:2694 0 0.00 0 +phiX174:2695 0 0.00 0 +phiX174:2696 0 0.00 0 +phiX174:2697 0 0.00 0 +phiX174:2698 0 0.00 0 +phiX174:2699 0 0.00 0 +phiX174:2700 0 0.00 0 +phiX174:2701 0 0.00 0 +phiX174:2702 0 0.00 0 +phiX174:2703 0 0.00 0 +phiX174:2704 0 0.00 0 +phiX174:2705 0 0.00 0 +phiX174:2706 0 0.00 0 +phiX174:2707 0 0.00 0 +phiX174:2708 0 0.00 0 +phiX174:2709 0 0.00 0 +phiX174:2710 0 0.00 0 +phiX174:2711 0 0.00 0 +phiX174:2712 0 0.00 0 +phiX174:2713 0 0.00 0 +phiX174:2714 0 0.00 0 +phiX174:2715 0 0.00 0 +phiX174:2716 0 0.00 0 +phiX174:2717 0 0.00 0 +phiX174:2718 0 0.00 0 +phiX174:2719 0 0.00 0 +phiX174:2720 0 0.00 0 +phiX174:2721 0 0.00 0 +phiX174:2722 0 0.00 0 +phiX174:2723 0 0.00 0 +phiX174:2724 0 0.00 0 +phiX174:2725 0 0.00 0 +phiX174:2726 0 0.00 0 +phiX174:2727 0 0.00 0 +phiX174:2728 0 0.00 0 +phiX174:2729 0 0.00 0 +phiX174:2730 0 0.00 0 +phiX174:2731 0 0.00 0 +phiX174:2732 0 0.00 0 +phiX174:2733 0 0.00 0 +phiX174:2734 0 0.00 0 +phiX174:2735 0 0.00 0 +phiX174:2736 0 0.00 0 +phiX174:2737 0 0.00 0 +phiX174:2738 0 0.00 0 +phiX174:2739 0 0.00 0 +phiX174:2740 0 0.00 0 +phiX174:2741 0 0.00 0 +phiX174:2742 0 0.00 0 +phiX174:2743 0 0.00 0 +phiX174:2744 0 0.00 0 +phiX174:2745 0 0.00 0 +phiX174:2746 0 0.00 0 +phiX174:2747 0 0.00 0 +phiX174:2748 0 0.00 0 +phiX174:2749 0 0.00 0 +phiX174:2750 0 0.00 0 +phiX174:2751 0 0.00 0 +phiX174:2752 0 0.00 0 +phiX174:2753 0 0.00 0 +phiX174:2754 0 0.00 0 +phiX174:2755 0 0.00 0 +phiX174:2756 0 0.00 0 +phiX174:2757 0 0.00 0 +phiX174:2758 0 0.00 0 +phiX174:2759 0 0.00 0 +phiX174:2760 0 0.00 0 +phiX174:2761 0 0.00 0 +phiX174:2762 0 0.00 0 +phiX174:2763 0 0.00 0 +phiX174:2764 0 0.00 0 +phiX174:2765 0 0.00 0 +phiX174:2766 0 0.00 0 +phiX174:2767 0 0.00 0 +phiX174:2768 0 0.00 0 +phiX174:2769 0 0.00 0 +phiX174:2770 0 0.00 0 +phiX174:2771 0 0.00 0 +phiX174:2772 0 0.00 0 +phiX174:2773 0 0.00 0 +phiX174:2774 0 0.00 0 +phiX174:2775 0 0.00 0 +phiX174:2776 0 0.00 0 +phiX174:2777 0 0.00 0 +phiX174:2778 0 0.00 0 +phiX174:2779 0 0.00 0 +phiX174:2780 0 0.00 0 +phiX174:2781 0 0.00 0 +phiX174:2782 0 0.00 0 +phiX174:2783 0 0.00 0 +phiX174:2784 0 0.00 0 +phiX174:2785 0 0.00 0 +phiX174:2786 0 0.00 0 +phiX174:2787 0 0.00 0 +phiX174:2788 0 0.00 0 +phiX174:2789 0 0.00 0 +phiX174:2790 0 0.00 0 +phiX174:2791 0 0.00 0 +phiX174:2792 0 0.00 0 +phiX174:2793 0 0.00 0 +phiX174:2794 0 0.00 0 +phiX174:2795 0 0.00 0 +phiX174:2796 0 0.00 0 +phiX174:2797 0 0.00 0 +phiX174:2798 0 0.00 0 +phiX174:2799 0 0.00 0 +phiX174:2800 0 0.00 0 +phiX174:2801 0 0.00 0 +phiX174:2802 0 0.00 0 +phiX174:2803 0 0.00 0 +phiX174:2804 0 0.00 0 +phiX174:2805 0 0.00 0 +phiX174:2806 0 0.00 0 +phiX174:2807 0 0.00 0 +phiX174:2808 0 0.00 0 +phiX174:2809 0 0.00 0 +phiX174:2810 0 0.00 0 +phiX174:2811 0 0.00 0 +phiX174:2812 0 0.00 0 +phiX174:2813 0 0.00 0 +phiX174:2814 0 0.00 0 +phiX174:2815 0 0.00 0 +phiX174:2816 0 0.00 0 +phiX174:2817 0 0.00 0 +phiX174:2818 0 0.00 0 +phiX174:2819 0 0.00 0 +phiX174:2820 0 0.00 0 +phiX174:2821 0 0.00 0 +phiX174:2822 0 0.00 0 +phiX174:2823 0 0.00 0 +phiX174:2824 0 0.00 0 +phiX174:2825 0 0.00 0 +phiX174:2826 0 0.00 0 +phiX174:2827 0 0.00 0 +phiX174:2828 0 0.00 0 +phiX174:2829 0 0.00 0 +phiX174:2830 0 0.00 0 +phiX174:2831 0 0.00 0 +phiX174:2832 0 0.00 0 +phiX174:2833 0 0.00 0 +phiX174:2834 0 0.00 0 +phiX174:2835 0 0.00 0 +phiX174:2836 0 0.00 0 +phiX174:2837 0 0.00 0 +phiX174:2838 0 0.00 0 +phiX174:2839 0 0.00 0 +phiX174:2840 0 0.00 0 +phiX174:2841 0 0.00 0 +phiX174:2842 0 0.00 0 +phiX174:2843 0 0.00 0 +phiX174:2844 0 0.00 0 +phiX174:2845 0 0.00 0 +phiX174:2846 0 0.00 0 +phiX174:2847 0 0.00 0 +phiX174:2848 0 0.00 0 +phiX174:2849 0 0.00 0 +phiX174:2850 0 0.00 0 +phiX174:2851 0 0.00 0 +phiX174:2852 0 0.00 0 +phiX174:2853 0 0.00 0 +phiX174:2854 0 0.00 0 +phiX174:2855 0 0.00 0 +phiX174:2856 0 0.00 0 +phiX174:2857 0 0.00 0 +phiX174:2858 0 0.00 0 +phiX174:2859 0 0.00 0 +phiX174:2860 0 0.00 0 +phiX174:2861 0 0.00 0 +phiX174:2862 0 0.00 0 +phiX174:2863 0 0.00 0 +phiX174:2864 0 0.00 0 +phiX174:2865 0 0.00 0 +phiX174:2866 0 0.00 0 +phiX174:2867 0 0.00 0 +phiX174:2868 0 0.00 0 +phiX174:2869 0 0.00 0 +phiX174:2870 0 0.00 0 +phiX174:2871 0 0.00 0 +phiX174:2872 0 0.00 0 +phiX174:2873 0 0.00 0 +phiX174:2874 0 0.00 0 +phiX174:2875 0 0.00 0 +phiX174:2876 0 0.00 0 +phiX174:2877 0 0.00 0 +phiX174:2878 0 0.00 0 +phiX174:2879 0 0.00 0 +phiX174:2880 0 0.00 0 +phiX174:2881 0 0.00 0 +phiX174:2882 0 0.00 0 +phiX174:2883 0 0.00 0 +phiX174:2884 0 0.00 0 +phiX174:2885 0 0.00 0 +phiX174:2886 0 0.00 0 +phiX174:2887 0 0.00 0 +phiX174:2888 0 0.00 0 +phiX174:2889 0 0.00 0 +phiX174:2890 0 0.00 0 +phiX174:2891 0 0.00 0 +phiX174:2892 0 0.00 0 +phiX174:2893 0 0.00 0 +phiX174:2894 0 0.00 0 +phiX174:2895 0 0.00 0 +phiX174:2896 0 0.00 0 +phiX174:2897 0 0.00 0 +phiX174:2898 0 0.00 0 +phiX174:2899 0 0.00 0 +phiX174:2900 0 0.00 0 +phiX174:2901 0 0.00 0 +phiX174:2902 0 0.00 0 +phiX174:2903 0 0.00 0 +phiX174:2904 0 0.00 0 +phiX174:2905 0 0.00 0 +phiX174:2906 0 0.00 0 +phiX174:2907 0 0.00 0 +phiX174:2908 0 0.00 0 +phiX174:2909 0 0.00 0 +phiX174:2910 0 0.00 0 +phiX174:2911 0 0.00 0 +phiX174:2912 0 0.00 0 +phiX174:2913 0 0.00 0 +phiX174:2914 0 0.00 0 +phiX174:2915 0 0.00 0 +phiX174:2916 0 0.00 0 +phiX174:2917 0 0.00 0 +phiX174:2918 0 0.00 0 +phiX174:2919 0 0.00 0 +phiX174:2920 0 0.00 0 +phiX174:2921 0 0.00 0 +phiX174:2922 0 0.00 0 +phiX174:2923 0 0.00 0 +phiX174:2924 0 0.00 0 +phiX174:2925 0 0.00 0 +phiX174:2926 0 0.00 0 +phiX174:2927 0 0.00 0 +phiX174:2928 0 0.00 0 +phiX174:2929 0 0.00 0 +phiX174:2930 0 0.00 0 +phiX174:2931 0 0.00 0 +phiX174:2932 0 0.00 0 +phiX174:2933 0 0.00 0 +phiX174:2934 0 0.00 0 +phiX174:2935 0 0.00 0 +phiX174:2936 0 0.00 0 +phiX174:2937 0 0.00 0 +phiX174:2938 0 0.00 0 +phiX174:2939 0 0.00 0 +phiX174:2940 0 0.00 0 +phiX174:2941 0 0.00 0 +phiX174:2942 0 0.00 0 +phiX174:2943 0 0.00 0 +phiX174:2944 0 0.00 0 +phiX174:2945 0 0.00 0 +phiX174:2946 0 0.00 0 +phiX174:2947 0 0.00 0 +phiX174:2948 0 0.00 0 +phiX174:2949 0 0.00 0 +phiX174:2950 0 0.00 0 +phiX174:2951 0 0.00 0 +phiX174:2952 0 0.00 0 +phiX174:2953 0 0.00 0 +phiX174:2954 0 0.00 0 +phiX174:2955 0 0.00 0 +phiX174:2956 0 0.00 0 +phiX174:2957 0 0.00 0 +phiX174:2958 0 0.00 0 +phiX174:2959 0 0.00 0 +phiX174:2960 0 0.00 0 +phiX174:2961 0 0.00 0 +phiX174:2962 0 0.00 0 +phiX174:2963 0 0.00 0 +phiX174:2964 0 0.00 0 +phiX174:2965 0 0.00 0 +phiX174:2966 0 0.00 0 +phiX174:2967 0 0.00 0 +phiX174:2968 0 0.00 0 +phiX174:2969 0 0.00 0 +phiX174:2970 0 0.00 0 +phiX174:2971 0 0.00 0 +phiX174:2972 0 0.00 0 +phiX174:2973 0 0.00 0 +phiX174:2974 0 0.00 0 +phiX174:2975 0 0.00 0 +phiX174:2976 0 0.00 0 +phiX174:2977 0 0.00 0 +phiX174:2978 0 0.00 0 +phiX174:2979 0 0.00 0 +phiX174:2980 0 0.00 0 +phiX174:2981 0 0.00 0 +phiX174:2982 0 0.00 0 +phiX174:2983 0 0.00 0 +phiX174:2984 0 0.00 0 +phiX174:2985 0 0.00 0 +phiX174:2986 0 0.00 0 +phiX174:2987 0 0.00 0 +phiX174:2988 0 0.00 0 +phiX174:2989 0 0.00 0 +phiX174:2990 0 0.00 0 +phiX174:2991 0 0.00 0 +phiX174:2992 0 0.00 0 +phiX174:2993 0 0.00 0 +phiX174:2994 0 0.00 0 +phiX174:2995 0 0.00 0 +phiX174:2996 0 0.00 0 +phiX174:2997 0 0.00 0 +phiX174:2998 0 0.00 0 +phiX174:2999 0 0.00 0 +phiX174:3000 0 0.00 0 +phiX174:3001 0 0.00 0 +phiX174:3002 0 0.00 0 +phiX174:3003 0 0.00 0 +phiX174:3004 0 0.00 0 +phiX174:3005 0 0.00 0 +phiX174:3006 0 0.00 0 +phiX174:3007 0 0.00 0 +phiX174:3008 0 0.00 0 +phiX174:3009 0 0.00 0 +phiX174:3010 0 0.00 0 +phiX174:3011 0 0.00 0 +phiX174:3012 0 0.00 0 +phiX174:3013 0 0.00 0 +phiX174:3014 0 0.00 0 +phiX174:3015 0 0.00 0 +phiX174:3016 0 0.00 0 +phiX174:3017 0 0.00 0 +phiX174:3018 0 0.00 0 +phiX174:3019 0 0.00 0 +phiX174:3020 0 0.00 0 +phiX174:3021 0 0.00 0 +phiX174:3022 0 0.00 0 +phiX174:3023 0 0.00 0 +phiX174:3024 0 0.00 0 +phiX174:3025 0 0.00 0 +phiX174:3026 0 0.00 0 +phiX174:3027 0 0.00 0 +phiX174:3028 0 0.00 0 +phiX174:3029 0 0.00 0 +phiX174:3030 0 0.00 0 +phiX174:3031 0 0.00 0 +phiX174:3032 0 0.00 0 +phiX174:3033 0 0.00 0 +phiX174:3034 0 0.00 0 +phiX174:3035 0 0.00 0 +phiX174:3036 0 0.00 0 +phiX174:3037 0 0.00 0 +phiX174:3038 0 0.00 0 +phiX174:3039 0 0.00 0 +phiX174:3040 0 0.00 0 +phiX174:3041 0 0.00 0 +phiX174:3042 0 0.00 0 +phiX174:3043 0 0.00 0 +phiX174:3044 0 0.00 0 +phiX174:3045 0 0.00 0 +phiX174:3046 0 0.00 0 +phiX174:3047 0 0.00 0 +phiX174:3048 0 0.00 0 +phiX174:3049 0 0.00 0 +phiX174:3050 0 0.00 0 +phiX174:3051 0 0.00 0 +phiX174:3052 0 0.00 0 +phiX174:3053 0 0.00 0 +phiX174:3054 0 0.00 0 +phiX174:3055 0 0.00 0 +phiX174:3056 0 0.00 0 +phiX174:3057 0 0.00 0 +phiX174:3058 0 0.00 0 +phiX174:3059 0 0.00 0 +phiX174:3060 0 0.00 0 +phiX174:3061 0 0.00 0 +phiX174:3062 0 0.00 0 +phiX174:3063 0 0.00 0 +phiX174:3064 0 0.00 0 +phiX174:3065 0 0.00 0 +phiX174:3066 0 0.00 0 +phiX174:3067 0 0.00 0 +phiX174:3068 0 0.00 0 +phiX174:3069 0 0.00 0 +phiX174:3070 0 0.00 0 +phiX174:3071 0 0.00 0 +phiX174:3072 0 0.00 0 +phiX174:3073 0 0.00 0 +phiX174:3074 0 0.00 0 +phiX174:3075 0 0.00 0 +phiX174:3076 0 0.00 0 +phiX174:3077 0 0.00 0 +phiX174:3078 0 0.00 0 +phiX174:3079 0 0.00 0 +phiX174:3080 0 0.00 0 +phiX174:3081 0 0.00 0 +phiX174:3082 0 0.00 0 +phiX174:3083 0 0.00 0 +phiX174:3084 0 0.00 0 +phiX174:3085 0 0.00 0 +phiX174:3086 0 0.00 0 +phiX174:3087 0 0.00 0 +phiX174:3088 0 0.00 0 +phiX174:3089 0 0.00 0 +phiX174:3090 0 0.00 0 +phiX174:3091 0 0.00 0 +phiX174:3092 0 0.00 0 +phiX174:3093 0 0.00 0 +phiX174:3094 0 0.00 0 +phiX174:3095 0 0.00 0 +phiX174:3096 0 0.00 0 +phiX174:3097 0 0.00 0 +phiX174:3098 0 0.00 0 +phiX174:3099 0 0.00 0 +phiX174:3100 0 0.00 0 +phiX174:3101 0 0.00 0 +phiX174:3102 0 0.00 0 +phiX174:3103 0 0.00 0 +phiX174:3104 0 0.00 0 +phiX174:3105 0 0.00 0 +phiX174:3106 0 0.00 0 +phiX174:3107 0 0.00 0 +phiX174:3108 0 0.00 0 +phiX174:3109 0 0.00 0 +phiX174:3110 0 0.00 0 +phiX174:3111 0 0.00 0 +phiX174:3112 0 0.00 0 +phiX174:3113 0 0.00 0 +phiX174:3114 0 0.00 0 +phiX174:3115 0 0.00 0 +phiX174:3116 0 0.00 0 +phiX174:3117 0 0.00 0 +phiX174:3118 0 0.00 0 +phiX174:3119 0 0.00 0 +phiX174:3120 0 0.00 0 +phiX174:3121 0 0.00 0 +phiX174:3122 0 0.00 0 +phiX174:3123 0 0.00 0 +phiX174:3124 0 0.00 0 +phiX174:3125 0 0.00 0 +phiX174:3126 0 0.00 0 +phiX174:3127 0 0.00 0 +phiX174:3128 0 0.00 0 +phiX174:3129 0 0.00 0 +phiX174:3130 0 0.00 0 +phiX174:3131 0 0.00 0 +phiX174:3132 0 0.00 0 +phiX174:3133 0 0.00 0 +phiX174:3134 0 0.00 0 +phiX174:3135 0 0.00 0 +phiX174:3136 0 0.00 0 +phiX174:3137 0 0.00 0 +phiX174:3138 0 0.00 0 +phiX174:3139 0 0.00 0 +phiX174:3140 0 0.00 0 +phiX174:3141 0 0.00 0 +phiX174:3142 0 0.00 0 +phiX174:3143 0 0.00 0 +phiX174:3144 0 0.00 0 +phiX174:3145 0 0.00 0 +phiX174:3146 0 0.00 0 +phiX174:3147 0 0.00 0 +phiX174:3148 0 0.00 0 +phiX174:3149 0 0.00 0 +phiX174:3150 0 0.00 0 +phiX174:3151 0 0.00 0 +phiX174:3152 0 0.00 0 +phiX174:3153 0 0.00 0 +phiX174:3154 0 0.00 0 +phiX174:3155 0 0.00 0 +phiX174:3156 0 0.00 0 +phiX174:3157 0 0.00 0 +phiX174:3158 0 0.00 0 +phiX174:3159 0 0.00 0 +phiX174:3160 0 0.00 0 +phiX174:3161 0 0.00 0 +phiX174:3162 0 0.00 0 +phiX174:3163 0 0.00 0 +phiX174:3164 0 0.00 0 +phiX174:3165 0 0.00 0 +phiX174:3166 0 0.00 0 +phiX174:3167 0 0.00 0 +phiX174:3168 0 0.00 0 +phiX174:3169 0 0.00 0 +phiX174:3170 0 0.00 0 +phiX174:3171 0 0.00 0 +phiX174:3172 0 0.00 0 +phiX174:3173 0 0.00 0 +phiX174:3174 0 0.00 0 +phiX174:3175 0 0.00 0 +phiX174:3176 0 0.00 0 +phiX174:3177 0 0.00 0 +phiX174:3178 0 0.00 0 +phiX174:3179 0 0.00 0 +phiX174:3180 0 0.00 0 +phiX174:3181 0 0.00 0 +phiX174:3182 0 0.00 0 +phiX174:3183 0 0.00 0 +phiX174:3184 0 0.00 0 +phiX174:3185 0 0.00 0 +phiX174:3186 0 0.00 0 +phiX174:3187 0 0.00 0 +phiX174:3188 0 0.00 0 +phiX174:3189 0 0.00 0 +phiX174:3190 0 0.00 0 +phiX174:3191 0 0.00 0 +phiX174:3192 0 0.00 0 +phiX174:3193 0 0.00 0 +phiX174:3194 0 0.00 0 +phiX174:3195 0 0.00 0 +phiX174:3196 0 0.00 0 +phiX174:3197 0 0.00 0 +phiX174:3198 0 0.00 0 +phiX174:3199 0 0.00 0 +phiX174:3200 0 0.00 0 +phiX174:3201 0 0.00 0 +phiX174:3202 0 0.00 0 +phiX174:3203 0 0.00 0 +phiX174:3204 0 0.00 0 +phiX174:3205 0 0.00 0 +phiX174:3206 0 0.00 0 +phiX174:3207 0 0.00 0 +phiX174:3208 0 0.00 0 +phiX174:3209 0 0.00 0 +phiX174:3210 0 0.00 0 +phiX174:3211 0 0.00 0 +phiX174:3212 0 0.00 0 +phiX174:3213 0 0.00 0 +phiX174:3214 0 0.00 0 +phiX174:3215 0 0.00 0 +phiX174:3216 0 0.00 0 +phiX174:3217 0 0.00 0 +phiX174:3218 0 0.00 0 +phiX174:3219 0 0.00 0 +phiX174:3220 0 0.00 0 +phiX174:3221 0 0.00 0 +phiX174:3222 0 0.00 0 +phiX174:3223 0 0.00 0 +phiX174:3224 0 0.00 0 +phiX174:3225 0 0.00 0 +phiX174:3226 0 0.00 0 +phiX174:3227 0 0.00 0 +phiX174:3228 0 0.00 0 +phiX174:3229 0 0.00 0 +phiX174:3230 0 0.00 0 +phiX174:3231 0 0.00 0 +phiX174:3232 0 0.00 0 +phiX174:3233 0 0.00 0 +phiX174:3234 0 0.00 0 +phiX174:3235 0 0.00 0 +phiX174:3236 0 0.00 0 +phiX174:3237 0 0.00 0 +phiX174:3238 0 0.00 0 +phiX174:3239 0 0.00 0 +phiX174:3240 0 0.00 0 +phiX174:3241 0 0.00 0 +phiX174:3242 0 0.00 0 +phiX174:3243 0 0.00 0 +phiX174:3244 0 0.00 0 +phiX174:3245 0 0.00 0 +phiX174:3246 0 0.00 0 +phiX174:3247 0 0.00 0 +phiX174:3248 0 0.00 0 +phiX174:3249 0 0.00 0 +phiX174:3250 0 0.00 0 +phiX174:3251 0 0.00 0 +phiX174:3252 0 0.00 0 +phiX174:3253 0 0.00 0 +phiX174:3254 0 0.00 0 +phiX174:3255 0 0.00 0 +phiX174:3256 0 0.00 0 +phiX174:3257 0 0.00 0 +phiX174:3258 0 0.00 0 +phiX174:3259 0 0.00 0 +phiX174:3260 0 0.00 0 +phiX174:3261 0 0.00 0 +phiX174:3262 0 0.00 0 +phiX174:3263 0 0.00 0 +phiX174:3264 0 0.00 0 +phiX174:3265 0 0.00 0 +phiX174:3266 0 0.00 0 +phiX174:3267 0 0.00 0 +phiX174:3268 0 0.00 0 +phiX174:3269 0 0.00 0 +phiX174:3270 0 0.00 0 +phiX174:3271 0 0.00 0 +phiX174:3272 0 0.00 0 +phiX174:3273 0 0.00 0 +phiX174:3274 0 0.00 0 +phiX174:3275 0 0.00 0 +phiX174:3276 0 0.00 0 +phiX174:3277 0 0.00 0 +phiX174:3278 0 0.00 0 +phiX174:3279 0 0.00 0 +phiX174:3280 0 0.00 0 +phiX174:3281 0 0.00 0 +phiX174:3282 0 0.00 0 +phiX174:3283 0 0.00 0 +phiX174:3284 0 0.00 0 +phiX174:3285 0 0.00 0 +phiX174:3286 0 0.00 0 +phiX174:3287 0 0.00 0 +phiX174:3288 0 0.00 0 +phiX174:3289 0 0.00 0 +phiX174:3290 0 0.00 0 +phiX174:3291 0 0.00 0 +phiX174:3292 0 0.00 0 +phiX174:3293 0 0.00 0 +phiX174:3294 0 0.00 0 +phiX174:3295 0 0.00 0 +phiX174:3296 0 0.00 0 +phiX174:3297 0 0.00 0 +phiX174:3298 0 0.00 0 +phiX174:3299 0 0.00 0 +phiX174:3300 0 0.00 0 +phiX174:3301 0 0.00 0 +phiX174:3302 0 0.00 0 +phiX174:3303 0 0.00 0 +phiX174:3304 0 0.00 0 +phiX174:3305 0 0.00 0 +phiX174:3306 0 0.00 0 +phiX174:3307 0 0.00 0 +phiX174:3308 0 0.00 0 +phiX174:3309 0 0.00 0 +phiX174:3310 0 0.00 0 +phiX174:3311 0 0.00 0 +phiX174:3312 0 0.00 0 +phiX174:3313 0 0.00 0 +phiX174:3314 0 0.00 0 +phiX174:3315 0 0.00 0 +phiX174:3316 0 0.00 0 +phiX174:3317 0 0.00 0 +phiX174:3318 0 0.00 0 +phiX174:3319 0 0.00 0 +phiX174:3320 0 0.00 0 +phiX174:3321 0 0.00 0 +phiX174:3322 0 0.00 0 +phiX174:3323 0 0.00 0 +phiX174:3324 0 0.00 0 +phiX174:3325 0 0.00 0 +phiX174:3326 0 0.00 0 +phiX174:3327 0 0.00 0 +phiX174:3328 0 0.00 0 +phiX174:3329 0 0.00 0 +phiX174:3330 0 0.00 0 +phiX174:3331 0 0.00 0 +phiX174:3332 0 0.00 0 +phiX174:3333 0 0.00 0 +phiX174:3334 0 0.00 0 +phiX174:3335 0 0.00 0 +phiX174:3336 0 0.00 0 +phiX174:3337 0 0.00 0 +phiX174:3338 0 0.00 0 +phiX174:3339 0 0.00 0 +phiX174:3340 0 0.00 0 +phiX174:3341 0 0.00 0 +phiX174:3342 0 0.00 0 +phiX174:3343 0 0.00 0 +phiX174:3344 0 0.00 0 +phiX174:3345 0 0.00 0 +phiX174:3346 0 0.00 0 +phiX174:3347 0 0.00 0 +phiX174:3348 0 0.00 0 +phiX174:3349 0 0.00 0 +phiX174:3350 0 0.00 0 +phiX174:3351 0 0.00 0 +phiX174:3352 0 0.00 0 +phiX174:3353 0 0.00 0 +phiX174:3354 0 0.00 0 +phiX174:3355 0 0.00 0 +phiX174:3356 0 0.00 0 +phiX174:3357 0 0.00 0 +phiX174:3358 0 0.00 0 +phiX174:3359 0 0.00 0 +phiX174:3360 0 0.00 0 +phiX174:3361 0 0.00 0 +phiX174:3362 0 0.00 0 +phiX174:3363 0 0.00 0 +phiX174:3364 0 0.00 0 +phiX174:3365 0 0.00 0 +phiX174:3366 0 0.00 0 +phiX174:3367 0 0.00 0 +phiX174:3368 0 0.00 0 +phiX174:3369 0 0.00 0 +phiX174:3370 0 0.00 0 +phiX174:3371 0 0.00 0 +phiX174:3372 0 0.00 0 +phiX174:3373 0 0.00 0 +phiX174:3374 0 0.00 0 +phiX174:3375 0 0.00 0 +phiX174:3376 0 0.00 0 +phiX174:3377 0 0.00 0 +phiX174:3378 0 0.00 0 +phiX174:3379 0 0.00 0 +phiX174:3380 0 0.00 0 +phiX174:3381 0 0.00 0 +phiX174:3382 0 0.00 0 +phiX174:3383 0 0.00 0 +phiX174:3384 0 0.00 0 +phiX174:3385 0 0.00 0 +phiX174:3386 0 0.00 0 +phiX174:3387 0 0.00 0 +phiX174:3388 0 0.00 0 +phiX174:3389 0 0.00 0 +phiX174:3390 0 0.00 0 +phiX174:3391 0 0.00 0 +phiX174:3392 0 0.00 0 +phiX174:3393 0 0.00 0 +phiX174:3394 0 0.00 0 +phiX174:3395 0 0.00 0 +phiX174:3396 0 0.00 0 +phiX174:3397 0 0.00 0 +phiX174:3398 0 0.00 0 +phiX174:3399 0 0.00 0 +phiX174:3400 0 0.00 0 +phiX174:3401 0 0.00 0 +phiX174:3402 0 0.00 0 +phiX174:3403 0 0.00 0 +phiX174:3404 0 0.00 0 +phiX174:3405 0 0.00 0 +phiX174:3406 0 0.00 0 +phiX174:3407 0 0.00 0 +phiX174:3408 0 0.00 0 +phiX174:3409 0 0.00 0 +phiX174:3410 0 0.00 0 +phiX174:3411 0 0.00 0 +phiX174:3412 0 0.00 0 +phiX174:3413 0 0.00 0 +phiX174:3414 0 0.00 0 +phiX174:3415 0 0.00 0 +phiX174:3416 0 0.00 0 +phiX174:3417 0 0.00 0 +phiX174:3418 0 0.00 0 +phiX174:3419 0 0.00 0 +phiX174:3420 0 0.00 0 +phiX174:3421 0 0.00 0 +phiX174:3422 0 0.00 0 +phiX174:3423 0 0.00 0 +phiX174:3424 0 0.00 0 +phiX174:3425 0 0.00 0 +phiX174:3426 0 0.00 0 +phiX174:3427 0 0.00 0 +phiX174:3428 0 0.00 0 +phiX174:3429 0 0.00 0 +phiX174:3430 0 0.00 0 +phiX174:3431 0 0.00 0 +phiX174:3432 0 0.00 0 +phiX174:3433 0 0.00 0 +phiX174:3434 0 0.00 0 +phiX174:3435 0 0.00 0 +phiX174:3436 0 0.00 0 +phiX174:3437 0 0.00 0 +phiX174:3438 0 0.00 0 +phiX174:3439 0 0.00 0 +phiX174:3440 0 0.00 0 +phiX174:3441 0 0.00 0 +phiX174:3442 0 0.00 0 +phiX174:3443 0 0.00 0 +phiX174:3444 0 0.00 0 +phiX174:3445 0 0.00 0 +phiX174:3446 0 0.00 0 +phiX174:3447 0 0.00 0 +phiX174:3448 0 0.00 0 +phiX174:3449 0 0.00 0 +phiX174:3450 0 0.00 0 +phiX174:3451 0 0.00 0 +phiX174:3452 0 0.00 0 +phiX174:3453 0 0.00 0 +phiX174:3454 0 0.00 0 +phiX174:3455 0 0.00 0 +phiX174:3456 0 0.00 0 +phiX174:3457 0 0.00 0 +phiX174:3458 0 0.00 0 +phiX174:3459 0 0.00 0 +phiX174:3460 0 0.00 0 +phiX174:3461 0 0.00 0 +phiX174:3462 0 0.00 0 +phiX174:3463 0 0.00 0 +phiX174:3464 0 0.00 0 +phiX174:3465 0 0.00 0 +phiX174:3466 0 0.00 0 +phiX174:3467 0 0.00 0 +phiX174:3468 0 0.00 0 +phiX174:3469 0 0.00 0 +phiX174:3470 0 0.00 0 +phiX174:3471 0 0.00 0 +phiX174:3472 0 0.00 0 +phiX174:3473 0 0.00 0 +phiX174:3474 0 0.00 0 +phiX174:3475 0 0.00 0 +phiX174:3476 0 0.00 0 +phiX174:3477 0 0.00 0 +phiX174:3478 0 0.00 0 +phiX174:3479 0 0.00 0 +phiX174:3480 0 0.00 0 +phiX174:3481 0 0.00 0 +phiX174:3482 0 0.00 0 +phiX174:3483 0 0.00 0 +phiX174:3484 0 0.00 0 +phiX174:3485 0 0.00 0 +phiX174:3486 0 0.00 0 +phiX174:3487 0 0.00 0 +phiX174:3488 0 0.00 0 +phiX174:3489 0 0.00 0 +phiX174:3490 0 0.00 0 +phiX174:3491 0 0.00 0 +phiX174:3492 0 0.00 0 +phiX174:3493 0 0.00 0 +phiX174:3494 0 0.00 0 +phiX174:3495 0 0.00 0 +phiX174:3496 0 0.00 0 +phiX174:3497 0 0.00 0 +phiX174:3498 0 0.00 0 +phiX174:3499 0 0.00 0 +phiX174:3500 0 0.00 0 +phiX174:3501 0 0.00 0 +phiX174:3502 0 0.00 0 +phiX174:3503 0 0.00 0 +phiX174:3504 0 0.00 0 +phiX174:3505 0 0.00 0 +phiX174:3506 0 0.00 0 +phiX174:3507 0 0.00 0 +phiX174:3508 0 0.00 0 +phiX174:3509 0 0.00 0 +phiX174:3510 0 0.00 0 +phiX174:3511 0 0.00 0 +phiX174:3512 0 0.00 0 +phiX174:3513 0 0.00 0 +phiX174:3514 0 0.00 0 +phiX174:3515 0 0.00 0 +phiX174:3516 0 0.00 0 +phiX174:3517 0 0.00 0 +phiX174:3518 0 0.00 0 +phiX174:3519 0 0.00 0 +phiX174:3520 0 0.00 0 +phiX174:3521 0 0.00 0 +phiX174:3522 0 0.00 0 +phiX174:3523 0 0.00 0 +phiX174:3524 0 0.00 0 +phiX174:3525 0 0.00 0 +phiX174:3526 0 0.00 0 +phiX174:3527 0 0.00 0 +phiX174:3528 0 0.00 0 +phiX174:3529 0 0.00 0 +phiX174:3530 0 0.00 0 +phiX174:3531 0 0.00 0 +phiX174:3532 0 0.00 0 +phiX174:3533 0 0.00 0 +phiX174:3534 0 0.00 0 +phiX174:3535 0 0.00 0 +phiX174:3536 0 0.00 0 +phiX174:3537 0 0.00 0 +phiX174:3538 0 0.00 0 +phiX174:3539 0 0.00 0 +phiX174:3540 0 0.00 0 +phiX174:3541 0 0.00 0 +phiX174:3542 0 0.00 0 +phiX174:3543 0 0.00 0 +phiX174:3544 0 0.00 0 +phiX174:3545 0 0.00 0 +phiX174:3546 0 0.00 0 +phiX174:3547 0 0.00 0 +phiX174:3548 0 0.00 0 +phiX174:3549 0 0.00 0 +phiX174:3550 0 0.00 0 +phiX174:3551 0 0.00 0 +phiX174:3552 0 0.00 0 +phiX174:3553 0 0.00 0 +phiX174:3554 0 0.00 0 +phiX174:3555 0 0.00 0 +phiX174:3556 0 0.00 0 +phiX174:3557 0 0.00 0 +phiX174:3558 0 0.00 0 +phiX174:3559 0 0.00 0 +phiX174:3560 0 0.00 0 +phiX174:3561 0 0.00 0 +phiX174:3562 0 0.00 0 +phiX174:3563 0 0.00 0 +phiX174:3564 0 0.00 0 +phiX174:3565 0 0.00 0 +phiX174:3566 0 0.00 0 +phiX174:3567 0 0.00 0 +phiX174:3568 0 0.00 0 +phiX174:3569 0 0.00 0 +phiX174:3570 0 0.00 0 +phiX174:3571 0 0.00 0 +phiX174:3572 0 0.00 0 +phiX174:3573 0 0.00 0 +phiX174:3574 0 0.00 0 +phiX174:3575 0 0.00 0 +phiX174:3576 0 0.00 0 +phiX174:3577 0 0.00 0 +phiX174:3578 0 0.00 0 +phiX174:3579 0 0.00 0 +phiX174:3580 0 0.00 0 +phiX174:3581 0 0.00 0 +phiX174:3582 0 0.00 0 +phiX174:3583 0 0.00 0 +phiX174:3584 0 0.00 0 +phiX174:3585 0 0.00 0 +phiX174:3586 0 0.00 0 +phiX174:3587 0 0.00 0 +phiX174:3588 0 0.00 0 +phiX174:3589 0 0.00 0 +phiX174:3590 0 0.00 0 +phiX174:3591 0 0.00 0 +phiX174:3592 0 0.00 0 +phiX174:3593 0 0.00 0 +phiX174:3594 0 0.00 0 +phiX174:3595 0 0.00 0 +phiX174:3596 0 0.00 0 +phiX174:3597 0 0.00 0 +phiX174:3598 0 0.00 0 +phiX174:3599 0 0.00 0 +phiX174:3600 0 0.00 0 +phiX174:3601 0 0.00 0 +phiX174:3602 0 0.00 0 +phiX174:3603 0 0.00 0 +phiX174:3604 0 0.00 0 +phiX174:3605 0 0.00 0 +phiX174:3606 0 0.00 0 +phiX174:3607 0 0.00 0 +phiX174:3608 0 0.00 0 +phiX174:3609 0 0.00 0 +phiX174:3610 0 0.00 0 +phiX174:3611 0 0.00 0 +phiX174:3612 0 0.00 0 +phiX174:3613 0 0.00 0 +phiX174:3614 0 0.00 0 +phiX174:3615 0 0.00 0 +phiX174:3616 0 0.00 0 +phiX174:3617 0 0.00 0 +phiX174:3618 0 0.00 0 +phiX174:3619 0 0.00 0 +phiX174:3620 0 0.00 0 +phiX174:3621 0 0.00 0 +phiX174:3622 0 0.00 0 +phiX174:3623 0 0.00 0 +phiX174:3624 0 0.00 0 +phiX174:3625 0 0.00 0 +phiX174:3626 0 0.00 0 +phiX174:3627 0 0.00 0 +phiX174:3628 0 0.00 0 +phiX174:3629 0 0.00 0 +phiX174:3630 0 0.00 0 +phiX174:3631 0 0.00 0 +phiX174:3632 0 0.00 0 +phiX174:3633 0 0.00 0 +phiX174:3634 0 0.00 0 +phiX174:3635 0 0.00 0 +phiX174:3636 0 0.00 0 +phiX174:3637 0 0.00 0 +phiX174:3638 0 0.00 0 +phiX174:3639 0 0.00 0 +phiX174:3640 0 0.00 0 +phiX174:3641 0 0.00 0 +phiX174:3642 0 0.00 0 +phiX174:3643 0 0.00 0 +phiX174:3644 0 0.00 0 +phiX174:3645 0 0.00 0 +phiX174:3646 0 0.00 0 +phiX174:3647 0 0.00 0 +phiX174:3648 0 0.00 0 +phiX174:3649 0 0.00 0 +phiX174:3650 0 0.00 0 +phiX174:3651 0 0.00 0 +phiX174:3652 0 0.00 0 +phiX174:3653 0 0.00 0 +phiX174:3654 0 0.00 0 +phiX174:3655 0 0.00 0 +phiX174:3656 0 0.00 0 +phiX174:3657 0 0.00 0 +phiX174:3658 0 0.00 0 +phiX174:3659 0 0.00 0 +phiX174:3660 0 0.00 0 +phiX174:3661 0 0.00 0 +phiX174:3662 0 0.00 0 +phiX174:3663 0 0.00 0 +phiX174:3664 0 0.00 0 +phiX174:3665 0 0.00 0 +phiX174:3666 0 0.00 0 +phiX174:3667 0 0.00 0 +phiX174:3668 0 0.00 0 +phiX174:3669 0 0.00 0 +phiX174:3670 0 0.00 0 +phiX174:3671 0 0.00 0 +phiX174:3672 0 0.00 0 +phiX174:3673 0 0.00 0 +phiX174:3674 0 0.00 0 +phiX174:3675 0 0.00 0 +phiX174:3676 0 0.00 0 +phiX174:3677 0 0.00 0 +phiX174:3678 0 0.00 0 +phiX174:3679 0 0.00 0 +phiX174:3680 0 0.00 0 +phiX174:3681 0 0.00 0 +phiX174:3682 0 0.00 0 +phiX174:3683 0 0.00 0 +phiX174:3684 0 0.00 0 +phiX174:3685 0 0.00 0 +phiX174:3686 0 0.00 0 +phiX174:3687 0 0.00 0 +phiX174:3688 0 0.00 0 +phiX174:3689 0 0.00 0 +phiX174:3690 0 0.00 0 +phiX174:3691 0 0.00 0 +phiX174:3692 0 0.00 0 +phiX174:3693 0 0.00 0 +phiX174:3694 0 0.00 0 +phiX174:3695 0 0.00 0 +phiX174:3696 0 0.00 0 +phiX174:3697 0 0.00 0 +phiX174:3698 0 0.00 0 +phiX174:3699 0 0.00 0 +phiX174:3700 0 0.00 0 +phiX174:3701 0 0.00 0 +phiX174:3702 0 0.00 0 +phiX174:3703 0 0.00 0 +phiX174:3704 0 0.00 0 +phiX174:3705 0 0.00 0 +phiX174:3706 0 0.00 0 +phiX174:3707 0 0.00 0 +phiX174:3708 0 0.00 0 +phiX174:3709 0 0.00 0 +phiX174:3710 0 0.00 0 +phiX174:3711 0 0.00 0 +phiX174:3712 0 0.00 0 +phiX174:3713 0 0.00 0 +phiX174:3714 0 0.00 0 +phiX174:3715 0 0.00 0 +phiX174:3716 0 0.00 0 +phiX174:3717 0 0.00 0 +phiX174:3718 0 0.00 0 +phiX174:3719 0 0.00 0 +phiX174:3720 0 0.00 0 +phiX174:3721 0 0.00 0 +phiX174:3722 0 0.00 0 +phiX174:3723 0 0.00 0 +phiX174:3724 0 0.00 0 +phiX174:3725 0 0.00 0 +phiX174:3726 0 0.00 0 +phiX174:3727 0 0.00 0 +phiX174:3728 0 0.00 0 +phiX174:3729 0 0.00 0 +phiX174:3730 0 0.00 0 +phiX174:3731 0 0.00 0 +phiX174:3732 0 0.00 0 +phiX174:3733 0 0.00 0 +phiX174:3734 0 0.00 0 +phiX174:3735 0 0.00 0 +phiX174:3736 0 0.00 0 +phiX174:3737 0 0.00 0 +phiX174:3738 0 0.00 0 +phiX174:3739 0 0.00 0 +phiX174:3740 0 0.00 0 +phiX174:3741 0 0.00 0 +phiX174:3742 0 0.00 0 +phiX174:3743 0 0.00 0 +phiX174:3744 0 0.00 0 +phiX174:3745 0 0.00 0 +phiX174:3746 0 0.00 0 +phiX174:3747 0 0.00 0 +phiX174:3748 0 0.00 0 +phiX174:3749 0 0.00 0 +phiX174:3750 0 0.00 0 +phiX174:3751 0 0.00 0 +phiX174:3752 0 0.00 0 +phiX174:3753 0 0.00 0 +phiX174:3754 0 0.00 0 +phiX174:3755 0 0.00 0 +phiX174:3756 0 0.00 0 +phiX174:3757 0 0.00 0 +phiX174:3758 0 0.00 0 +phiX174:3759 0 0.00 0 +phiX174:3760 0 0.00 0 +phiX174:3761 0 0.00 0 +phiX174:3762 0 0.00 0 +phiX174:3763 0 0.00 0 +phiX174:3764 0 0.00 0 +phiX174:3765 0 0.00 0 +phiX174:3766 0 0.00 0 +phiX174:3767 0 0.00 0 +phiX174:3768 0 0.00 0 +phiX174:3769 0 0.00 0 +phiX174:3770 0 0.00 0 +phiX174:3771 0 0.00 0 +phiX174:3772 0 0.00 0 +phiX174:3773 0 0.00 0 +phiX174:3774 0 0.00 0 +phiX174:3775 0 0.00 0 +phiX174:3776 0 0.00 0 +phiX174:3777 0 0.00 0 +phiX174:3778 0 0.00 0 +phiX174:3779 0 0.00 0 +phiX174:3780 0 0.00 0 +phiX174:3781 0 0.00 0 +phiX174:3782 0 0.00 0 +phiX174:3783 0 0.00 0 +phiX174:3784 0 0.00 0 +phiX174:3785 0 0.00 0 +phiX174:3786 0 0.00 0 +phiX174:3787 0 0.00 0 +phiX174:3788 0 0.00 0 +phiX174:3789 0 0.00 0 +phiX174:3790 0 0.00 0 +phiX174:3791 0 0.00 0 +phiX174:3792 0 0.00 0 +phiX174:3793 0 0.00 0 +phiX174:3794 0 0.00 0 +phiX174:3795 0 0.00 0 +phiX174:3796 0 0.00 0 +phiX174:3797 0 0.00 0 +phiX174:3798 0 0.00 0 +phiX174:3799 0 0.00 0 +phiX174:3800 0 0.00 0 +phiX174:3801 0 0.00 0 +phiX174:3802 0 0.00 0 +phiX174:3803 0 0.00 0 +phiX174:3804 0 0.00 0 +phiX174:3805 0 0.00 0 +phiX174:3806 0 0.00 0 +phiX174:3807 0 0.00 0 +phiX174:3808 0 0.00 0 +phiX174:3809 0 0.00 0 +phiX174:3810 0 0.00 0 +phiX174:3811 0 0.00 0 +phiX174:3812 0 0.00 0 +phiX174:3813 0 0.00 0 +phiX174:3814 0 0.00 0 +phiX174:3815 0 0.00 0 +phiX174:3816 0 0.00 0 +phiX174:3817 0 0.00 0 +phiX174:3818 0 0.00 0 +phiX174:3819 0 0.00 0 +phiX174:3820 0 0.00 0 +phiX174:3821 0 0.00 0 +phiX174:3822 0 0.00 0 +phiX174:3823 0 0.00 0 +phiX174:3824 0 0.00 0 +phiX174:3825 0 0.00 0 +phiX174:3826 0 0.00 0 +phiX174:3827 0 0.00 0 +phiX174:3828 0 0.00 0 +phiX174:3829 0 0.00 0 +phiX174:3830 0 0.00 0 +phiX174:3831 0 0.00 0 +phiX174:3832 0 0.00 0 +phiX174:3833 0 0.00 0 +phiX174:3834 0 0.00 0 +phiX174:3835 0 0.00 0 +phiX174:3836 0 0.00 0 +phiX174:3837 0 0.00 0 +phiX174:3838 0 0.00 0 +phiX174:3839 0 0.00 0 +phiX174:3840 0 0.00 0 +phiX174:3841 0 0.00 0 +phiX174:3842 0 0.00 0 +phiX174:3843 0 0.00 0 +phiX174:3844 0 0.00 0 +phiX174:3845 0 0.00 0 +phiX174:3846 0 0.00 0 +phiX174:3847 0 0.00 0 +phiX174:3848 0 0.00 0 +phiX174:3849 0 0.00 0 +phiX174:3850 0 0.00 0 +phiX174:3851 0 0.00 0 +phiX174:3852 0 0.00 0 +phiX174:3853 0 0.00 0 +phiX174:3854 0 0.00 0 +phiX174:3855 0 0.00 0 +phiX174:3856 0 0.00 0 +phiX174:3857 0 0.00 0 +phiX174:3858 0 0.00 0 +phiX174:3859 0 0.00 0 +phiX174:3860 0 0.00 0 +phiX174:3861 0 0.00 0 +phiX174:3862 0 0.00 0 +phiX174:3863 0 0.00 0 +phiX174:3864 0 0.00 0 +phiX174:3865 0 0.00 0 +phiX174:3866 0 0.00 0 +phiX174:3867 0 0.00 0 +phiX174:3868 0 0.00 0 +phiX174:3869 0 0.00 0 +phiX174:3870 0 0.00 0 +phiX174:3871 0 0.00 0 +phiX174:3872 0 0.00 0 +phiX174:3873 0 0.00 0 +phiX174:3874 0 0.00 0 +phiX174:3875 0 0.00 0 +phiX174:3876 0 0.00 0 +phiX174:3877 0 0.00 0 +phiX174:3878 0 0.00 0 +phiX174:3879 0 0.00 0 +phiX174:3880 0 0.00 0 +phiX174:3881 0 0.00 0 +phiX174:3882 0 0.00 0 +phiX174:3883 0 0.00 0 +phiX174:3884 0 0.00 0 +phiX174:3885 0 0.00 0 +phiX174:3886 0 0.00 0 +phiX174:3887 0 0.00 0 +phiX174:3888 0 0.00 0 +phiX174:3889 0 0.00 0 +phiX174:3890 0 0.00 0 +phiX174:3891 0 0.00 0 +phiX174:3892 0 0.00 0 +phiX174:3893 0 0.00 0 +phiX174:3894 0 0.00 0 +phiX174:3895 0 0.00 0 +phiX174:3896 0 0.00 0 +phiX174:3897 0 0.00 0 +phiX174:3898 0 0.00 0 +phiX174:3899 0 0.00 0 +phiX174:3900 0 0.00 0 +phiX174:3901 0 0.00 0 +phiX174:3902 0 0.00 0 +phiX174:3903 0 0.00 0 +phiX174:3904 0 0.00 0 +phiX174:3905 0 0.00 0 +phiX174:3906 0 0.00 0 +phiX174:3907 0 0.00 0 +phiX174:3908 0 0.00 0 +phiX174:3909 0 0.00 0 +phiX174:3910 0 0.00 0 +phiX174:3911 0 0.00 0 +phiX174:3912 0 0.00 0 +phiX174:3913 0 0.00 0 +phiX174:3914 0 0.00 0 +phiX174:3915 0 0.00 0 +phiX174:3916 0 0.00 0 +phiX174:3917 0 0.00 0 +phiX174:3918 0 0.00 0 +phiX174:3919 0 0.00 0 +phiX174:3920 0 0.00 0 +phiX174:3921 0 0.00 0 +phiX174:3922 0 0.00 0 +phiX174:3923 0 0.00 0 +phiX174:3924 0 0.00 0 +phiX174:3925 0 0.00 0 +phiX174:3926 0 0.00 0 +phiX174:3927 0 0.00 0 +phiX174:3928 0 0.00 0 +phiX174:3929 0 0.00 0 +phiX174:3930 0 0.00 0 +phiX174:3931 0 0.00 0 +phiX174:3932 0 0.00 0 +phiX174:3933 0 0.00 0 +phiX174:3934 0 0.00 0 +phiX174:3935 0 0.00 0 +phiX174:3936 0 0.00 0 +phiX174:3937 0 0.00 0 +phiX174:3938 0 0.00 0 +phiX174:3939 0 0.00 0 +phiX174:3940 0 0.00 0 +phiX174:3941 0 0.00 0 +phiX174:3942 0 0.00 0 +phiX174:3943 0 0.00 0 +phiX174:3944 0 0.00 0 +phiX174:3945 0 0.00 0 +phiX174:3946 0 0.00 0 +phiX174:3947 0 0.00 0 +phiX174:3948 0 0.00 0 +phiX174:3949 0 0.00 0 +phiX174:3950 0 0.00 0 +phiX174:3951 0 0.00 0 +phiX174:3952 0 0.00 0 +phiX174:3953 0 0.00 0 +phiX174:3954 0 0.00 0 +phiX174:3955 0 0.00 0 +phiX174:3956 0 0.00 0 +phiX174:3957 0 0.00 0 +phiX174:3958 0 0.00 0 +phiX174:3959 0 0.00 0 +phiX174:3960 0 0.00 0 +phiX174:3961 0 0.00 0 +phiX174:3962 0 0.00 0 +phiX174:3963 0 0.00 0 +phiX174:3964 0 0.00 0 +phiX174:3965 0 0.00 0 +phiX174:3966 0 0.00 0 +phiX174:3967 0 0.00 0 +phiX174:3968 0 0.00 0 +phiX174:3969 0 0.00 0 +phiX174:3970 0 0.00 0 +phiX174:3971 0 0.00 0 +phiX174:3972 0 0.00 0 +phiX174:3973 0 0.00 0 +phiX174:3974 0 0.00 0 +phiX174:3975 0 0.00 0 +phiX174:3976 0 0.00 0 +phiX174:3977 0 0.00 0 +phiX174:3978 0 0.00 0 +phiX174:3979 0 0.00 0 +phiX174:3980 0 0.00 0 +phiX174:3981 0 0.00 0 +phiX174:3982 0 0.00 0 +phiX174:3983 0 0.00 0 +phiX174:3984 0 0.00 0 +phiX174:3985 0 0.00 0 +phiX174:3986 0 0.00 0 +phiX174:3987 0 0.00 0 +phiX174:3988 0 0.00 0 +phiX174:3989 0 0.00 0 +phiX174:3990 0 0.00 0 +phiX174:3991 0 0.00 0 +phiX174:3992 0 0.00 0 +phiX174:3993 0 0.00 0 +phiX174:3994 0 0.00 0 +phiX174:3995 0 0.00 0 +phiX174:3996 0 0.00 0 +phiX174:3997 0 0.00 0 +phiX174:3998 0 0.00 0 +phiX174:3999 0 0.00 0 +phiX174:4000 0 0.00 0 +phiX174:4001 0 0.00 0 +phiX174:4002 0 0.00 0 +phiX174:4003 0 0.00 0 +phiX174:4004 0 0.00 0 +phiX174:4005 0 0.00 0 +phiX174:4006 0 0.00 0 +phiX174:4007 0 0.00 0 +phiX174:4008 0 0.00 0 +phiX174:4009 0 0.00 0 +phiX174:4010 0 0.00 0 +phiX174:4011 0 0.00 0 +phiX174:4012 0 0.00 0 +phiX174:4013 0 0.00 0 +phiX174:4014 0 0.00 0 +phiX174:4015 0 0.00 0 +phiX174:4016 0 0.00 0 +phiX174:4017 0 0.00 0 +phiX174:4018 0 0.00 0 +phiX174:4019 0 0.00 0 +phiX174:4020 0 0.00 0 +phiX174:4021 0 0.00 0 +phiX174:4022 0 0.00 0 +phiX174:4023 0 0.00 0 +phiX174:4024 0 0.00 0 +phiX174:4025 0 0.00 0 +phiX174:4026 0 0.00 0 +phiX174:4027 0 0.00 0 +phiX174:4028 0 0.00 0 +phiX174:4029 0 0.00 0 +phiX174:4030 0 0.00 0 +phiX174:4031 0 0.00 0 +phiX174:4032 0 0.00 0 +phiX174:4033 0 0.00 0 +phiX174:4034 0 0.00 0 +phiX174:4035 0 0.00 0 +phiX174:4036 0 0.00 0 +phiX174:4037 0 0.00 0 +phiX174:4038 0 0.00 0 +phiX174:4039 0 0.00 0 +phiX174:4040 0 0.00 0 +phiX174:4041 0 0.00 0 +phiX174:4042 0 0.00 0 +phiX174:4043 0 0.00 0 +phiX174:4044 0 0.00 0 +phiX174:4045 0 0.00 0 +phiX174:4046 0 0.00 0 +phiX174:4047 0 0.00 0 +phiX174:4048 0 0.00 0 +phiX174:4049 0 0.00 0 +phiX174:4050 0 0.00 0 +phiX174:4051 0 0.00 0 +phiX174:4052 0 0.00 0 +phiX174:4053 0 0.00 0 +phiX174:4054 0 0.00 0 +phiX174:4055 0 0.00 0 +phiX174:4056 0 0.00 0 +phiX174:4057 0 0.00 0 +phiX174:4058 0 0.00 0 +phiX174:4059 0 0.00 0 +phiX174:4060 0 0.00 0 +phiX174:4061 0 0.00 0 +phiX174:4062 0 0.00 0 +phiX174:4063 0 0.00 0 +phiX174:4064 0 0.00 0 +phiX174:4065 0 0.00 0 +phiX174:4066 0 0.00 0 +phiX174:4067 0 0.00 0 +phiX174:4068 0 0.00 0 +phiX174:4069 0 0.00 0 +phiX174:4070 0 0.00 0 +phiX174:4071 0 0.00 0 +phiX174:4072 0 0.00 0 +phiX174:4073 0 0.00 0 +phiX174:4074 0 0.00 0 +phiX174:4075 0 0.00 0 +phiX174:4076 0 0.00 0 +phiX174:4077 0 0.00 0 +phiX174:4078 0 0.00 0 +phiX174:4079 0 0.00 0 +phiX174:4080 0 0.00 0 +phiX174:4081 0 0.00 0 +phiX174:4082 0 0.00 0 +phiX174:4083 0 0.00 0 +phiX174:4084 0 0.00 0 +phiX174:4085 0 0.00 0 +phiX174:4086 0 0.00 0 +phiX174:4087 0 0.00 0 +phiX174:4088 0 0.00 0 +phiX174:4089 0 0.00 0 +phiX174:4090 0 0.00 0 +phiX174:4091 0 0.00 0 +phiX174:4092 0 0.00 0 +phiX174:4093 0 0.00 0 +phiX174:4094 0 0.00 0 +phiX174:4095 0 0.00 0 +phiX174:4096 0 0.00 0 +phiX174:4097 0 0.00 0 +phiX174:4098 0 0.00 0 +phiX174:4099 0 0.00 0 +phiX174:4100 0 0.00 0 +phiX174:4101 0 0.00 0 +phiX174:4102 0 0.00 0 +phiX174:4103 0 0.00 0 +phiX174:4104 0 0.00 0 +phiX174:4105 0 0.00 0 +phiX174:4106 0 0.00 0 +phiX174:4107 0 0.00 0 +phiX174:4108 0 0.00 0 +phiX174:4109 0 0.00 0 +phiX174:4110 0 0.00 0 +phiX174:4111 0 0.00 0 +phiX174:4112 0 0.00 0 +phiX174:4113 0 0.00 0 +phiX174:4114 0 0.00 0 +phiX174:4115 0 0.00 0 +phiX174:4116 0 0.00 0 +phiX174:4117 0 0.00 0 +phiX174:4118 0 0.00 0 +phiX174:4119 0 0.00 0 +phiX174:4120 0 0.00 0 +phiX174:4121 0 0.00 0 +phiX174:4122 0 0.00 0 +phiX174:4123 0 0.00 0 +phiX174:4124 0 0.00 0 +phiX174:4125 0 0.00 0 +phiX174:4126 0 0.00 0 +phiX174:4127 0 0.00 0 +phiX174:4128 0 0.00 0 +phiX174:4129 0 0.00 0 +phiX174:4130 0 0.00 0 +phiX174:4131 0 0.00 0 +phiX174:4132 0 0.00 0 +phiX174:4133 0 0.00 0 +phiX174:4134 0 0.00 0 +phiX174:4135 0 0.00 0 +phiX174:4136 0 0.00 0 +phiX174:4137 0 0.00 0 +phiX174:4138 0 0.00 0 +phiX174:4139 0 0.00 0 +phiX174:4140 0 0.00 0 +phiX174:4141 0 0.00 0 +phiX174:4142 0 0.00 0 +phiX174:4143 0 0.00 0 +phiX174:4144 0 0.00 0 +phiX174:4145 0 0.00 0 +phiX174:4146 0 0.00 0 +phiX174:4147 0 0.00 0 +phiX174:4148 0 0.00 0 +phiX174:4149 0 0.00 0 +phiX174:4150 0 0.00 0 +phiX174:4151 0 0.00 0 +phiX174:4152 0 0.00 0 +phiX174:4153 0 0.00 0 +phiX174:4154 0 0.00 0 +phiX174:4155 0 0.00 0 +phiX174:4156 0 0.00 0 +phiX174:4157 0 0.00 0 +phiX174:4158 0 0.00 0 +phiX174:4159 0 0.00 0 +phiX174:4160 0 0.00 0 +phiX174:4161 0 0.00 0 +phiX174:4162 0 0.00 0 +phiX174:4163 0 0.00 0 +phiX174:4164 0 0.00 0 +phiX174:4165 0 0.00 0 +phiX174:4166 0 0.00 0 +phiX174:4167 0 0.00 0 +phiX174:4168 0 0.00 0 +phiX174:4169 0 0.00 0 +phiX174:4170 0 0.00 0 +phiX174:4171 0 0.00 0 +phiX174:4172 0 0.00 0 +phiX174:4173 0 0.00 0 +phiX174:4174 0 0.00 0 +phiX174:4175 0 0.00 0 +phiX174:4176 0 0.00 0 +phiX174:4177 0 0.00 0 +phiX174:4178 0 0.00 0 +phiX174:4179 0 0.00 0 +phiX174:4180 0 0.00 0 +phiX174:4181 0 0.00 0 +phiX174:4182 0 0.00 0 +phiX174:4183 0 0.00 0 +phiX174:4184 0 0.00 0 +phiX174:4185 0 0.00 0 +phiX174:4186 0 0.00 0 +phiX174:4187 0 0.00 0 +phiX174:4188 0 0.00 0 +phiX174:4189 0 0.00 0 +phiX174:4190 0 0.00 0 +phiX174:4191 0 0.00 0 +phiX174:4192 0 0.00 0 +phiX174:4193 0 0.00 0 +phiX174:4194 0 0.00 0 +phiX174:4195 0 0.00 0 +phiX174:4196 0 0.00 0 +phiX174:4197 0 0.00 0 +phiX174:4198 0 0.00 0 +phiX174:4199 0 0.00 0 +phiX174:4200 0 0.00 0 +phiX174:4201 0 0.00 0 +phiX174:4202 0 0.00 0 +phiX174:4203 0 0.00 0 +phiX174:4204 0 0.00 0 +phiX174:4205 0 0.00 0 +phiX174:4206 0 0.00 0 +phiX174:4207 0 0.00 0 +phiX174:4208 0 0.00 0 +phiX174:4209 0 0.00 0 +phiX174:4210 0 0.00 0 +phiX174:4211 0 0.00 0 +phiX174:4212 0 0.00 0 +phiX174:4213 0 0.00 0 +phiX174:4214 0 0.00 0 +phiX174:4215 0 0.00 0 +phiX174:4216 0 0.00 0 +phiX174:4217 0 0.00 0 +phiX174:4218 0 0.00 0 +phiX174:4219 0 0.00 0 +phiX174:4220 0 0.00 0 +phiX174:4221 0 0.00 0 +phiX174:4222 0 0.00 0 +phiX174:4223 0 0.00 0 +phiX174:4224 0 0.00 0 +phiX174:4225 0 0.00 0 +phiX174:4226 0 0.00 0 +phiX174:4227 0 0.00 0 +phiX174:4228 0 0.00 0 +phiX174:4229 0 0.00 0 +phiX174:4230 0 0.00 0 +phiX174:4231 0 0.00 0 +phiX174:4232 0 0.00 0 +phiX174:4233 0 0.00 0 +phiX174:4234 0 0.00 0 +phiX174:4235 0 0.00 0 +phiX174:4236 0 0.00 0 +phiX174:4237 0 0.00 0 +phiX174:4238 0 0.00 0 +phiX174:4239 0 0.00 0 +phiX174:4240 0 0.00 0 +phiX174:4241 0 0.00 0 +phiX174:4242 0 0.00 0 +phiX174:4243 0 0.00 0 +phiX174:4244 0 0.00 0 +phiX174:4245 0 0.00 0 +phiX174:4246 0 0.00 0 +phiX174:4247 0 0.00 0 +phiX174:4248 0 0.00 0 +phiX174:4249 0 0.00 0 +phiX174:4250 0 0.00 0 +phiX174:4251 0 0.00 0 +phiX174:4252 0 0.00 0 +phiX174:4253 0 0.00 0 +phiX174:4254 0 0.00 0 +phiX174:4255 0 0.00 0 +phiX174:4256 0 0.00 0 +phiX174:4257 0 0.00 0 +phiX174:4258 0 0.00 0 +phiX174:4259 0 0.00 0 +phiX174:4260 0 0.00 0 +phiX174:4261 0 0.00 0 +phiX174:4262 0 0.00 0 +phiX174:4263 0 0.00 0 +phiX174:4264 0 0.00 0 +phiX174:4265 0 0.00 0 +phiX174:4266 0 0.00 0 +phiX174:4267 0 0.00 0 +phiX174:4268 0 0.00 0 +phiX174:4269 0 0.00 0 +phiX174:4270 0 0.00 0 +phiX174:4271 0 0.00 0 +phiX174:4272 0 0.00 0 +phiX174:4273 0 0.00 0 +phiX174:4274 0 0.00 0 +phiX174:4275 0 0.00 0 +phiX174:4276 0 0.00 0 +phiX174:4277 0 0.00 0 +phiX174:4278 0 0.00 0 +phiX174:4279 0 0.00 0 +phiX174:4280 0 0.00 0 +phiX174:4281 0 0.00 0 +phiX174:4282 0 0.00 0 +phiX174:4283 0 0.00 0 +phiX174:4284 0 0.00 0 +phiX174:4285 0 0.00 0 +phiX174:4286 0 0.00 0 +phiX174:4287 0 0.00 0 +phiX174:4288 0 0.00 0 +phiX174:4289 0 0.00 0 +phiX174:4290 0 0.00 0 +phiX174:4291 0 0.00 0 +phiX174:4292 0 0.00 0 +phiX174:4293 0 0.00 0 +phiX174:4294 0 0.00 0 +phiX174:4295 0 0.00 0 +phiX174:4296 0 0.00 0 +phiX174:4297 0 0.00 0 +phiX174:4298 0 0.00 0 +phiX174:4299 0 0.00 0 +phiX174:4300 0 0.00 0 +phiX174:4301 0 0.00 0 +phiX174:4302 0 0.00 0 +phiX174:4303 0 0.00 0 +phiX174:4304 0 0.00 0 +phiX174:4305 0 0.00 0 +phiX174:4306 0 0.00 0 +phiX174:4307 0 0.00 0 +phiX174:4308 0 0.00 0 +phiX174:4309 0 0.00 0 +phiX174:4310 0 0.00 0 +phiX174:4311 0 0.00 0 +phiX174:4312 0 0.00 0 +phiX174:4313 0 0.00 0 +phiX174:4314 0 0.00 0 +phiX174:4315 0 0.00 0 +phiX174:4316 0 0.00 0 +phiX174:4317 0 0.00 0 +phiX174:4318 0 0.00 0 +phiX174:4319 0 0.00 0 +phiX174:4320 0 0.00 0 +phiX174:4321 0 0.00 0 +phiX174:4322 0 0.00 0 +phiX174:4323 0 0.00 0 +phiX174:4324 0 0.00 0 +phiX174:4325 0 0.00 0 +phiX174:4326 0 0.00 0 +phiX174:4327 0 0.00 0 +phiX174:4328 0 0.00 0 +phiX174:4329 0 0.00 0 +phiX174:4330 0 0.00 0 +phiX174:4331 0 0.00 0 +phiX174:4332 0 0.00 0 +phiX174:4333 0 0.00 0 +phiX174:4334 0 0.00 0 +phiX174:4335 0 0.00 0 +phiX174:4336 0 0.00 0 +phiX174:4337 0 0.00 0 +phiX174:4338 0 0.00 0 +phiX174:4339 0 0.00 0 +phiX174:4340 0 0.00 0 +phiX174:4341 0 0.00 0 +phiX174:4342 0 0.00 0 +phiX174:4343 0 0.00 0 +phiX174:4344 0 0.00 0 +phiX174:4345 0 0.00 0 +phiX174:4346 0 0.00 0 +phiX174:4347 0 0.00 0 +phiX174:4348 0 0.00 0 +phiX174:4349 0 0.00 0 +phiX174:4350 0 0.00 0 +phiX174:4351 0 0.00 0 +phiX174:4352 0 0.00 0 +phiX174:4353 0 0.00 0 +phiX174:4354 0 0.00 0 +phiX174:4355 0 0.00 0 +phiX174:4356 0 0.00 0 +phiX174:4357 0 0.00 0 +phiX174:4358 0 0.00 0 +phiX174:4359 0 0.00 0 +phiX174:4360 0 0.00 0 +phiX174:4361 0 0.00 0 +phiX174:4362 0 0.00 0 +phiX174:4363 0 0.00 0 +phiX174:4364 0 0.00 0 +phiX174:4365 0 0.00 0 +phiX174:4366 0 0.00 0 +phiX174:4367 0 0.00 0 +phiX174:4368 0 0.00 0 +phiX174:4369 0 0.00 0 +phiX174:4370 0 0.00 0 +phiX174:4371 0 0.00 0 +phiX174:4372 0 0.00 0 +phiX174:4373 0 0.00 0 +phiX174:4374 0 0.00 0 +phiX174:4375 0 0.00 0 +phiX174:4376 0 0.00 0 +phiX174:4377 0 0.00 0 +phiX174:4378 0 0.00 0 +phiX174:4379 0 0.00 0 +phiX174:4380 0 0.00 0 +phiX174:4381 0 0.00 0 +phiX174:4382 0 0.00 0 +phiX174:4383 0 0.00 0 +phiX174:4384 0 0.00 0 +phiX174:4385 0 0.00 0 +phiX174:4386 0 0.00 0 +phiX174:4387 0 0.00 0 +phiX174:4388 0 0.00 0 +phiX174:4389 0 0.00 0 +phiX174:4390 0 0.00 0 +phiX174:4391 0 0.00 0 +phiX174:4392 0 0.00 0 +phiX174:4393 0 0.00 0 +phiX174:4394 0 0.00 0 +phiX174:4395 0 0.00 0 +phiX174:4396 0 0.00 0 +phiX174:4397 0 0.00 0 +phiX174:4398 0 0.00 0 +phiX174:4399 0 0.00 0 +phiX174:4400 0 0.00 0 +phiX174:4401 0 0.00 0 +phiX174:4402 0 0.00 0 +phiX174:4403 0 0.00 0 +phiX174:4404 0 0.00 0 +phiX174:4405 0 0.00 0 +phiX174:4406 0 0.00 0 +phiX174:4407 0 0.00 0 +phiX174:4408 0 0.00 0 +phiX174:4409 0 0.00 0 +phiX174:4410 0 0.00 0 +phiX174:4411 0 0.00 0 +phiX174:4412 0 0.00 0 +phiX174:4413 0 0.00 0 +phiX174:4414 0 0.00 0 +phiX174:4415 0 0.00 0 +phiX174:4416 0 0.00 0 +phiX174:4417 0 0.00 0 +phiX174:4418 0 0.00 0 +phiX174:4419 0 0.00 0 +phiX174:4420 0 0.00 0 +phiX174:4421 0 0.00 0 +phiX174:4422 0 0.00 0 +phiX174:4423 0 0.00 0 +phiX174:4424 0 0.00 0 +phiX174:4425 0 0.00 0 +phiX174:4426 0 0.00 0 +phiX174:4427 0 0.00 0 +phiX174:4428 0 0.00 0 +phiX174:4429 0 0.00 0 +phiX174:4430 0 0.00 0 +phiX174:4431 0 0.00 0 +phiX174:4432 0 0.00 0 +phiX174:4433 0 0.00 0 +phiX174:4434 0 0.00 0 +phiX174:4435 0 0.00 0 +phiX174:4436 0 0.00 0 +phiX174:4437 0 0.00 0 +phiX174:4438 0 0.00 0 +phiX174:4439 0 0.00 0 +phiX174:4440 0 0.00 0 +phiX174:4441 0 0.00 0 +phiX174:4442 0 0.00 0 +phiX174:4443 0 0.00 0 +phiX174:4444 0 0.00 0 +phiX174:4445 0 0.00 0 +phiX174:4446 0 0.00 0 +phiX174:4447 0 0.00 0 +phiX174:4448 0 0.00 0 +phiX174:4449 0 0.00 0 +phiX174:4450 0 0.00 0 +phiX174:4451 0 0.00 0 +phiX174:4452 0 0.00 0 +phiX174:4453 0 0.00 0 +phiX174:4454 0 0.00 0 +phiX174:4455 0 0.00 0 +phiX174:4456 0 0.00 0 +phiX174:4457 0 0.00 0 +phiX174:4458 0 0.00 0 +phiX174:4459 0 0.00 0 +phiX174:4460 0 0.00 0 +phiX174:4461 0 0.00 0 +phiX174:4462 0 0.00 0 +phiX174:4463 0 0.00 0 +phiX174:4464 0 0.00 0 +phiX174:4465 0 0.00 0 +phiX174:4466 0 0.00 0 +phiX174:4467 0 0.00 0 +phiX174:4468 0 0.00 0 +phiX174:4469 0 0.00 0 +phiX174:4470 0 0.00 0 +phiX174:4471 0 0.00 0 +phiX174:4472 0 0.00 0 +phiX174:4473 0 0.00 0 +phiX174:4474 0 0.00 0 +phiX174:4475 0 0.00 0 +phiX174:4476 0 0.00 0 +phiX174:4477 0 0.00 0 +phiX174:4478 0 0.00 0 +phiX174:4479 0 0.00 0 +phiX174:4480 0 0.00 0 +phiX174:4481 0 0.00 0 +phiX174:4482 0 0.00 0 +phiX174:4483 0 0.00 0 +phiX174:4484 0 0.00 0 +phiX174:4485 0 0.00 0 +phiX174:4486 0 0.00 0 +phiX174:4487 0 0.00 0 +phiX174:4488 0 0.00 0 +phiX174:4489 0 0.00 0 +phiX174:4490 0 0.00 0 +phiX174:4491 0 0.00 0 +phiX174:4492 0 0.00 0 +phiX174:4493 0 0.00 0 +phiX174:4494 0 0.00 0 +phiX174:4495 0 0.00 0 +phiX174:4496 0 0.00 0 +phiX174:4497 0 0.00 0 +phiX174:4498 0 0.00 0 +phiX174:4499 0 0.00 0 +phiX174:4500 0 0.00 0 +phiX174:4501 0 0.00 0 +phiX174:4502 0 0.00 0 +phiX174:4503 0 0.00 0 +phiX174:4504 0 0.00 0 +phiX174:4505 0 0.00 0 +phiX174:4506 0 0.00 0 +phiX174:4507 0 0.00 0 +phiX174:4508 0 0.00 0 +phiX174:4509 0 0.00 0 +phiX174:4510 0 0.00 0 +phiX174:4511 0 0.00 0 +phiX174:4512 0 0.00 0 +phiX174:4513 0 0.00 0 +phiX174:4514 0 0.00 0 +phiX174:4515 0 0.00 0 +phiX174:4516 0 0.00 0 +phiX174:4517 0 0.00 0 +phiX174:4518 0 0.00 0 +phiX174:4519 0 0.00 0 +phiX174:4520 0 0.00 0 +phiX174:4521 0 0.00 0 +phiX174:4522 0 0.00 0 +phiX174:4523 0 0.00 0 +phiX174:4524 0 0.00 0 +phiX174:4525 0 0.00 0 +phiX174:4526 0 0.00 0 +phiX174:4527 0 0.00 0 +phiX174:4528 0 0.00 0 +phiX174:4529 0 0.00 0 +phiX174:4530 0 0.00 0 +phiX174:4531 0 0.00 0 +phiX174:4532 0 0.00 0 +phiX174:4533 0 0.00 0 +phiX174:4534 0 0.00 0 +phiX174:4535 0 0.00 0 +phiX174:4536 0 0.00 0 +phiX174:4537 0 0.00 0 +phiX174:4538 0 0.00 0 +phiX174:4539 0 0.00 0 +phiX174:4540 0 0.00 0 +phiX174:4541 0 0.00 0 +phiX174:4542 0 0.00 0 +phiX174:4543 0 0.00 0 +phiX174:4544 0 0.00 0 +phiX174:4545 0 0.00 0 +phiX174:4546 0 0.00 0 +phiX174:4547 0 0.00 0 +phiX174:4548 0 0.00 0 +phiX174:4549 0 0.00 0 +phiX174:4550 0 0.00 0 +phiX174:4551 0 0.00 0 +phiX174:4552 0 0.00 0 +phiX174:4553 0 0.00 0 +phiX174:4554 0 0.00 0 +phiX174:4555 0 0.00 0 +phiX174:4556 0 0.00 0 +phiX174:4557 0 0.00 0 +phiX174:4558 0 0.00 0 +phiX174:4559 0 0.00 0 +phiX174:4560 0 0.00 0 +phiX174:4561 0 0.00 0 +phiX174:4562 0 0.00 0 +phiX174:4563 0 0.00 0 +phiX174:4564 0 0.00 0 +phiX174:4565 0 0.00 0 +phiX174:4566 0 0.00 0 +phiX174:4567 0 0.00 0 +phiX174:4568 0 0.00 0 +phiX174:4569 0 0.00 0 +phiX174:4570 0 0.00 0 +phiX174:4571 0 0.00 0 +phiX174:4572 0 0.00 0 +phiX174:4573 0 0.00 0 +phiX174:4574 0 0.00 0 +phiX174:4575 0 0.00 0 +phiX174:4576 0 0.00 0 +phiX174:4577 0 0.00 0 +phiX174:4578 0 0.00 0 +phiX174:4579 0 0.00 0 +phiX174:4580 0 0.00 0 +phiX174:4581 0 0.00 0 +phiX174:4582 0 0.00 0 +phiX174:4583 0 0.00 0 +phiX174:4584 0 0.00 0 +phiX174:4585 0 0.00 0 +phiX174:4586 0 0.00 0 +phiX174:4587 0 0.00 0 +phiX174:4588 0 0.00 0 +phiX174:4589 0 0.00 0 +phiX174:4590 0 0.00 0 +phiX174:4591 0 0.00 0 +phiX174:4592 0 0.00 0 +phiX174:4593 0 0.00 0 +phiX174:4594 0 0.00 0 +phiX174:4595 0 0.00 0 +phiX174:4596 0 0.00 0 +phiX174:4597 0 0.00 0 +phiX174:4598 0 0.00 0 +phiX174:4599 0 0.00 0 +phiX174:4600 0 0.00 0 +phiX174:4601 0 0.00 0 +phiX174:4602 0 0.00 0 +phiX174:4603 0 0.00 0 +phiX174:4604 0 0.00 0 +phiX174:4605 0 0.00 0 +phiX174:4606 0 0.00 0 +phiX174:4607 0 0.00 0 +phiX174:4608 0 0.00 0 +phiX174:4609 0 0.00 0 +phiX174:4610 0 0.00 0 +phiX174:4611 0 0.00 0 +phiX174:4612 0 0.00 0 +phiX174:4613 0 0.00 0 +phiX174:4614 0 0.00 0 +phiX174:4615 0 0.00 0 +phiX174:4616 0 0.00 0 +phiX174:4617 0 0.00 0 +phiX174:4618 0 0.00 0 +phiX174:4619 0 0.00 0 +phiX174:4620 0 0.00 0 +phiX174:4621 0 0.00 0 +phiX174:4622 0 0.00 0 +phiX174:4623 0 0.00 0 +phiX174:4624 0 0.00 0 +phiX174:4625 0 0.00 0 +phiX174:4626 0 0.00 0 +phiX174:4627 0 0.00 0 +phiX174:4628 0 0.00 0 +phiX174:4629 0 0.00 0 +phiX174:4630 0 0.00 0 +phiX174:4631 0 0.00 0 +phiX174:4632 0 0.00 0 +phiX174:4633 0 0.00 0 +phiX174:4634 0 0.00 0 +phiX174:4635 0 0.00 0 +phiX174:4636 0 0.00 0 +phiX174:4637 0 0.00 0 +phiX174:4638 0 0.00 0 +phiX174:4639 0 0.00 0 +phiX174:4640 0 0.00 0 +phiX174:4641 0 0.00 0 +phiX174:4642 0 0.00 0 +phiX174:4643 0 0.00 0 +phiX174:4644 0 0.00 0 +phiX174:4645 0 0.00 0 +phiX174:4646 0 0.00 0 +phiX174:4647 0 0.00 0 +phiX174:4648 0 0.00 0 +phiX174:4649 0 0.00 0 +phiX174:4650 0 0.00 0 +phiX174:4651 0 0.00 0 +phiX174:4652 0 0.00 0 +phiX174:4653 0 0.00 0 +phiX174:4654 0 0.00 0 +phiX174:4655 0 0.00 0 +phiX174:4656 0 0.00 0 +phiX174:4657 0 0.00 0 +phiX174:4658 0 0.00 0 +phiX174:4659 0 0.00 0 +phiX174:4660 0 0.00 0 +phiX174:4661 0 0.00 0 +phiX174:4662 0 0.00 0 +phiX174:4663 0 0.00 0 +phiX174:4664 0 0.00 0 +phiX174:4665 0 0.00 0 +phiX174:4666 0 0.00 0 +phiX174:4667 0 0.00 0 +phiX174:4668 0 0.00 0 +phiX174:4669 0 0.00 0 +phiX174:4670 0 0.00 0 +phiX174:4671 0 0.00 0 +phiX174:4672 0 0.00 0 +phiX174:4673 0 0.00 0 +phiX174:4674 0 0.00 0 +phiX174:4675 0 0.00 0 +phiX174:4676 0 0.00 0 +phiX174:4677 0 0.00 0 +phiX174:4678 0 0.00 0 +phiX174:4679 0 0.00 0 +phiX174:4680 0 0.00 0 +phiX174:4681 0 0.00 0 +phiX174:4682 0 0.00 0 +phiX174:4683 0 0.00 0 +phiX174:4684 0 0.00 0 +phiX174:4685 0 0.00 0 +phiX174:4686 0 0.00 0 +phiX174:4687 0 0.00 0 +phiX174:4688 0 0.00 0 +phiX174:4689 0 0.00 0 +phiX174:4690 0 0.00 0 +phiX174:4691 0 0.00 0 +phiX174:4692 0 0.00 0 +phiX174:4693 0 0.00 0 +phiX174:4694 0 0.00 0 +phiX174:4695 0 0.00 0 +phiX174:4696 0 0.00 0 +phiX174:4697 0 0.00 0 +phiX174:4698 0 0.00 0 +phiX174:4699 0 0.00 0 +phiX174:4700 0 0.00 0 +phiX174:4701 0 0.00 0 +phiX174:4702 0 0.00 0 +phiX174:4703 0 0.00 0 +phiX174:4704 0 0.00 0 +phiX174:4705 0 0.00 0 +phiX174:4706 0 0.00 0 +phiX174:4707 0 0.00 0 +phiX174:4708 0 0.00 0 +phiX174:4709 0 0.00 0 +phiX174:4710 0 0.00 0 +phiX174:4711 0 0.00 0 +phiX174:4712 0 0.00 0 +phiX174:4713 0 0.00 0 +phiX174:4714 0 0.00 0 +phiX174:4715 0 0.00 0 +phiX174:4716 0 0.00 0 +phiX174:4717 0 0.00 0 +phiX174:4718 0 0.00 0 +phiX174:4719 0 0.00 0 +phiX174:4720 0 0.00 0 +phiX174:4721 0 0.00 0 +phiX174:4722 0 0.00 0 +phiX174:4723 0 0.00 0 +phiX174:4724 0 0.00 0 +phiX174:4725 0 0.00 0 +phiX174:4726 0 0.00 0 +phiX174:4727 0 0.00 0 +phiX174:4728 0 0.00 0 +phiX174:4729 0 0.00 0 +phiX174:4730 0 0.00 0 +phiX174:4731 0 0.00 0 +phiX174:4732 0 0.00 0 +phiX174:4733 0 0.00 0 +phiX174:4734 0 0.00 0 +phiX174:4735 0 0.00 0 +phiX174:4736 0 0.00 0 +phiX174:4737 0 0.00 0 +phiX174:4738 0 0.00 0 +phiX174:4739 0 0.00 0 +phiX174:4740 0 0.00 0 +phiX174:4741 0 0.00 0 +phiX174:4742 0 0.00 0 +phiX174:4743 0 0.00 0 +phiX174:4744 0 0.00 0 +phiX174:4745 0 0.00 0 +phiX174:4746 0 0.00 0 +phiX174:4747 0 0.00 0 +phiX174:4748 0 0.00 0 +phiX174:4749 0 0.00 0 +phiX174:4750 0 0.00 0 +phiX174:4751 0 0.00 0 +phiX174:4752 0 0.00 0 +phiX174:4753 0 0.00 0 +phiX174:4754 0 0.00 0 +phiX174:4755 0 0.00 0 +phiX174:4756 0 0.00 0 +phiX174:4757 0 0.00 0 +phiX174:4758 0 0.00 0 +phiX174:4759 0 0.00 0 +phiX174:4760 0 0.00 0 +phiX174:4761 0 0.00 0 +phiX174:4762 0 0.00 0 +phiX174:4763 0 0.00 0 +phiX174:4764 0 0.00 0 +phiX174:4765 0 0.00 0 +phiX174:4766 0 0.00 0 +phiX174:4767 0 0.00 0 +phiX174:4768 0 0.00 0 +phiX174:4769 0 0.00 0 +phiX174:4770 0 0.00 0 +phiX174:4771 0 0.00 0 +phiX174:4772 0 0.00 0 +phiX174:4773 0 0.00 0 +phiX174:4774 0 0.00 0 +phiX174:4775 0 0.00 0 +phiX174:4776 0 0.00 0 +phiX174:4777 0 0.00 0 +phiX174:4778 0 0.00 0 +phiX174:4779 0 0.00 0 +phiX174:4780 0 0.00 0 +phiX174:4781 0 0.00 0 +phiX174:4782 0 0.00 0 +phiX174:4783 0 0.00 0 +phiX174:4784 0 0.00 0 +phiX174:4785 0 0.00 0 +phiX174:4786 0 0.00 0 +phiX174:4787 0 0.00 0 +phiX174:4788 0 0.00 0 +phiX174:4789 0 0.00 0 +phiX174:4790 0 0.00 0 +phiX174:4791 0 0.00 0 +phiX174:4792 0 0.00 0 +phiX174:4793 0 0.00 0 +phiX174:4794 0 0.00 0 +phiX174:4795 0 0.00 0 +phiX174:4796 0 0.00 0 +phiX174:4797 0 0.00 0 +phiX174:4798 0 0.00 0 +phiX174:4799 0 0.00 0 +phiX174:4800 0 0.00 0 +phiX174:4801 0 0.00 0 +phiX174:4802 0 0.00 0 +phiX174:4803 0 0.00 0 +phiX174:4804 0 0.00 0 +phiX174:4805 0 0.00 0 +phiX174:4806 0 0.00 0 +phiX174:4807 0 0.00 0 +phiX174:4808 0 0.00 0 +phiX174:4809 0 0.00 0 +phiX174:4810 0 0.00 0 +phiX174:4811 0 0.00 0 +phiX174:4812 0 0.00 0 +phiX174:4813 0 0.00 0 +phiX174:4814 0 0.00 0 +phiX174:4815 0 0.00 0 +phiX174:4816 0 0.00 0 +phiX174:4817 0 0.00 0 +phiX174:4818 0 0.00 0 +phiX174:4819 0 0.00 0 +phiX174:4820 0 0.00 0 +phiX174:4821 0 0.00 0 +phiX174:4822 0 0.00 0 +phiX174:4823 0 0.00 0 +phiX174:4824 0 0.00 0 +phiX174:4825 0 0.00 0 +phiX174:4826 0 0.00 0 +phiX174:4827 0 0.00 0 +phiX174:4828 0 0.00 0 +phiX174:4829 0 0.00 0 +phiX174:4830 0 0.00 0 +phiX174:4831 0 0.00 0 +phiX174:4832 0 0.00 0 +phiX174:4833 0 0.00 0 +phiX174:4834 0 0.00 0 +phiX174:4835 0 0.00 0 +phiX174:4836 0 0.00 0 +phiX174:4837 0 0.00 0 +phiX174:4838 0 0.00 0 +phiX174:4839 0 0.00 0 +phiX174:4840 0 0.00 0 +phiX174:4841 0 0.00 0 +phiX174:4842 0 0.00 0 +phiX174:4843 0 0.00 0 +phiX174:4844 0 0.00 0 +phiX174:4845 0 0.00 0 +phiX174:4846 0 0.00 0 +phiX174:4847 0 0.00 0 +phiX174:4848 0 0.00 0 +phiX174:4849 0 0.00 0 +phiX174:4850 0 0.00 0 +phiX174:4851 0 0.00 0 +phiX174:4852 0 0.00 0 +phiX174:4853 0 0.00 0 +phiX174:4854 0 0.00 0 +phiX174:4855 0 0.00 0 +phiX174:4856 0 0.00 0 +phiX174:4857 0 0.00 0 +phiX174:4858 0 0.00 0 +phiX174:4859 0 0.00 0 +phiX174:4860 0 0.00 0 +phiX174:4861 0 0.00 0 +phiX174:4862 0 0.00 0 +phiX174:4863 0 0.00 0 +phiX174:4864 0 0.00 0 +phiX174:4865 0 0.00 0 +phiX174:4866 0 0.00 0 +phiX174:4867 0 0.00 0 +phiX174:4868 0 0.00 0 +phiX174:4869 0 0.00 0 +phiX174:4870 0 0.00 0 +phiX174:4871 0 0.00 0 +phiX174:4872 0 0.00 0 +phiX174:4873 0 0.00 0 +phiX174:4874 0 0.00 0 +phiX174:4875 0 0.00 0 +phiX174:4876 0 0.00 0 +phiX174:4877 0 0.00 0 +phiX174:4878 0 0.00 0 +phiX174:4879 0 0.00 0 +phiX174:4880 0 0.00 0 +phiX174:4881 0 0.00 0 +phiX174:4882 0 0.00 0 +phiX174:4883 0 0.00 0 +phiX174:4884 0 0.00 0 +phiX174:4885 0 0.00 0 +phiX174:4886 0 0.00 0 +phiX174:4887 0 0.00 0 +phiX174:4888 0 0.00 0 +phiX174:4889 0 0.00 0 +phiX174:4890 0 0.00 0 +phiX174:4891 0 0.00 0 +phiX174:4892 0 0.00 0 +phiX174:4893 0 0.00 0 +phiX174:4894 0 0.00 0 +phiX174:4895 0 0.00 0 +phiX174:4896 0 0.00 0 +phiX174:4897 0 0.00 0 +phiX174:4898 0 0.00 0 +phiX174:4899 0 0.00 0 +phiX174:4900 0 0.00 0 +phiX174:4901 0 0.00 0 +phiX174:4902 0 0.00 0 +phiX174:4903 0 0.00 0 +phiX174:4904 0 0.00 0 +phiX174:4905 0 0.00 0 +phiX174:4906 0 0.00 0 +phiX174:4907 0 0.00 0 +phiX174:4908 0 0.00 0 +phiX174:4909 0 0.00 0 +phiX174:4910 0 0.00 0 +phiX174:4911 0 0.00 0 +phiX174:4912 0 0.00 0 +phiX174:4913 0 0.00 0 +phiX174:4914 0 0.00 0 +phiX174:4915 0 0.00 0 +phiX174:4916 0 0.00 0 +phiX174:4917 0 0.00 0 +phiX174:4918 0 0.00 0 +phiX174:4919 0 0.00 0 +phiX174:4920 0 0.00 0 +phiX174:4921 0 0.00 0 +phiX174:4922 0 0.00 0 +phiX174:4923 0 0.00 0 +phiX174:4924 0 0.00 0 +phiX174:4925 0 0.00 0 +phiX174:4926 0 0.00 0 +phiX174:4927 0 0.00 0 +phiX174:4928 0 0.00 0 +phiX174:4929 0 0.00 0 +phiX174:4930 0 0.00 0 +phiX174:4931 0 0.00 0 +phiX174:4932 0 0.00 0 +phiX174:4933 0 0.00 0 +phiX174:4934 0 0.00 0 +phiX174:4935 0 0.00 0 +phiX174:4936 0 0.00 0 +phiX174:4937 0 0.00 0 +phiX174:4938 0 0.00 0 +phiX174:4939 0 0.00 0 +phiX174:4940 0 0.00 0 +phiX174:4941 0 0.00 0 +phiX174:4942 0 0.00 0 +phiX174:4943 0 0.00 0 +phiX174:4944 0 0.00 0 +phiX174:4945 0 0.00 0 +phiX174:4946 0 0.00 0 +phiX174:4947 0 0.00 0 +phiX174:4948 0 0.00 0 +phiX174:4949 0 0.00 0 +phiX174:4950 0 0.00 0 +phiX174:4951 0 0.00 0 +phiX174:4952 0 0.00 0 +phiX174:4953 0 0.00 0 +phiX174:4954 0 0.00 0 +phiX174:4955 0 0.00 0 +phiX174:4956 0 0.00 0 +phiX174:4957 0 0.00 0 +phiX174:4958 0 0.00 0 +phiX174:4959 0 0.00 0 +phiX174:4960 0 0.00 0 +phiX174:4961 0 0.00 0 +phiX174:4962 0 0.00 0 +phiX174:4963 0 0.00 0 +phiX174:4964 0 0.00 0 +phiX174:4965 0 0.00 0 +phiX174:4966 0 0.00 0 +phiX174:4967 0 0.00 0 +phiX174:4968 0 0.00 0 +phiX174:4969 0 0.00 0 +phiX174:4970 0 0.00 0 +phiX174:4971 0 0.00 0 +phiX174:4972 0 0.00 0 +phiX174:4973 0 0.00 0 +phiX174:4974 0 0.00 0 +phiX174:4975 0 0.00 0 +phiX174:4976 0 0.00 0 +phiX174:4977 0 0.00 0 +phiX174:4978 0 0.00 0 +phiX174:4979 0 0.00 0 +phiX174:4980 0 0.00 0 +phiX174:4981 0 0.00 0 +phiX174:4982 0 0.00 0 +phiX174:4983 0 0.00 0 +phiX174:4984 0 0.00 0 +phiX174:4985 0 0.00 0 +phiX174:4986 0 0.00 0 +phiX174:4987 0 0.00 0 +phiX174:4988 0 0.00 0 +phiX174:4989 0 0.00 0 +phiX174:4990 0 0.00 0 +phiX174:4991 0 0.00 0 +phiX174:4992 0 0.00 0 +phiX174:4993 0 0.00 0 +phiX174:4994 0 0.00 0 +phiX174:4995 0 0.00 0 +phiX174:4996 0 0.00 0 +phiX174:4997 0 0.00 0 +phiX174:4998 0 0.00 0 +phiX174:4999 0 0.00 0 +phiX174:5000 0 0.00 0 +phiX174:5001 0 0.00 0 +phiX174:5002 0 0.00 0 +phiX174:5003 0 0.00 0 +phiX174:5004 0 0.00 0 +phiX174:5005 0 0.00 0 +phiX174:5006 0 0.00 0 +phiX174:5007 0 0.00 0 +phiX174:5008 0 0.00 0 +phiX174:5009 0 0.00 0 +phiX174:5010 0 0.00 0 +phiX174:5011 0 0.00 0 +phiX174:5012 0 0.00 0 +phiX174:5013 0 0.00 0 +phiX174:5014 0 0.00 0 +phiX174:5015 0 0.00 0 +phiX174:5016 0 0.00 0 +phiX174:5017 0 0.00 0 +phiX174:5018 0 0.00 0 +phiX174:5019 0 0.00 0 +phiX174:5020 0 0.00 0 +phiX174:5021 0 0.00 0 +phiX174:5022 0 0.00 0 +phiX174:5023 0 0.00 0 +phiX174:5024 0 0.00 0 +phiX174:5025 0 0.00 0 +phiX174:5026 0 0.00 0 +phiX174:5027 0 0.00 0 +phiX174:5028 0 0.00 0 +phiX174:5029 0 0.00 0 +phiX174:5030 0 0.00 0 +phiX174:5031 0 0.00 0 +phiX174:5032 0 0.00 0 +phiX174:5033 0 0.00 0 +phiX174:5034 0 0.00 0 +phiX174:5035 0 0.00 0 +phiX174:5036 0 0.00 0 +phiX174:5037 0 0.00 0 +phiX174:5038 0 0.00 0 +phiX174:5039 0 0.00 0 +phiX174:5040 0 0.00 0 +phiX174:5041 0 0.00 0 +phiX174:5042 0 0.00 0 +phiX174:5043 0 0.00 0 +phiX174:5044 0 0.00 0 +phiX174:5045 0 0.00 0 +phiX174:5046 0 0.00 0 +phiX174:5047 0 0.00 0 +phiX174:5048 0 0.00 0 +phiX174:5049 0 0.00 0 +phiX174:5050 0 0.00 0 +phiX174:5051 0 0.00 0 +phiX174:5052 0 0.00 0 +phiX174:5053 0 0.00 0 +phiX174:5054 0 0.00 0 +phiX174:5055 0 0.00 0 +phiX174:5056 0 0.00 0 +phiX174:5057 0 0.00 0 +phiX174:5058 0 0.00 0 +phiX174:5059 0 0.00 0 +phiX174:5060 0 0.00 0 +phiX174:5061 0 0.00 0 +phiX174:5062 0 0.00 0 +phiX174:5063 0 0.00 0 +phiX174:5064 0 0.00 0 +phiX174:5065 0 0.00 0 +phiX174:5066 0 0.00 0 +phiX174:5067 0 0.00 0 +phiX174:5068 0 0.00 0 +phiX174:5069 0 0.00 0 +phiX174:5070 0 0.00 0 +phiX174:5071 0 0.00 0 +phiX174:5072 0 0.00 0 +phiX174:5073 0 0.00 0 +phiX174:5074 0 0.00 0 +phiX174:5075 0 0.00 0 +phiX174:5076 0 0.00 0 +phiX174:5077 0 0.00 0 +phiX174:5078 0 0.00 0 +phiX174:5079 0 0.00 0 +phiX174:5080 0 0.00 0 +phiX174:5081 0 0.00 0 +phiX174:5082 0 0.00 0 +phiX174:5083 0 0.00 0 +phiX174:5084 0 0.00 0 +phiX174:5085 0 0.00 0 +phiX174:5086 0 0.00 0 +phiX174:5087 0 0.00 0 +phiX174:5088 0 0.00 0 +phiX174:5089 0 0.00 0 +phiX174:5090 0 0.00 0 +phiX174:5091 0 0.00 0 +phiX174:5092 0 0.00 0 +phiX174:5093 0 0.00 0 +phiX174:5094 0 0.00 0 +phiX174:5095 0 0.00 0 +phiX174:5096 0 0.00 0 +phiX174:5097 0 0.00 0 +phiX174:5098 0 0.00 0 +phiX174:5099 0 0.00 0 +phiX174:5100 0 0.00 0 +phiX174:5101 0 0.00 0 +phiX174:5102 0 0.00 0 +phiX174:5103 0 0.00 0 +phiX174:5104 0 0.00 0 +phiX174:5105 0 0.00 0 +phiX174:5106 0 0.00 0 +phiX174:5107 0 0.00 0 +phiX174:5108 0 0.00 0 +phiX174:5109 0 0.00 0 +phiX174:5110 0 0.00 0 +phiX174:5111 0 0.00 0 +phiX174:5112 0 0.00 0 +phiX174:5113 0 0.00 0 +phiX174:5114 0 0.00 0 +phiX174:5115 0 0.00 0 +phiX174:5116 0 0.00 0 +phiX174:5117 0 0.00 0 +phiX174:5118 0 0.00 0 +phiX174:5119 0 0.00 0 +phiX174:5120 0 0.00 0 +phiX174:5121 0 0.00 0 +phiX174:5122 0 0.00 0 +phiX174:5123 0 0.00 0 +phiX174:5124 0 0.00 0 +phiX174:5125 0 0.00 0 +phiX174:5126 0 0.00 0 +phiX174:5127 0 0.00 0 +phiX174:5128 0 0.00 0 +phiX174:5129 0 0.00 0 +phiX174:5130 0 0.00 0 +phiX174:5131 0 0.00 0 +phiX174:5132 0 0.00 0 +phiX174:5133 0 0.00 0 +phiX174:5134 0 0.00 0 +phiX174:5135 0 0.00 0 +phiX174:5136 0 0.00 0 +phiX174:5137 0 0.00 0 +phiX174:5138 0 0.00 0 +phiX174:5139 0 0.00 0 +phiX174:5140 0 0.00 0 +phiX174:5141 0 0.00 0 +phiX174:5142 0 0.00 0 +phiX174:5143 0 0.00 0 +phiX174:5144 0 0.00 0 +phiX174:5145 0 0.00 0 +phiX174:5146 0 0.00 0 +phiX174:5147 0 0.00 0 +phiX174:5148 0 0.00 0 +phiX174:5149 0 0.00 0 +phiX174:5150 0 0.00 0 +phiX174:5151 0 0.00 0 +phiX174:5152 0 0.00 0 +phiX174:5153 0 0.00 0 +phiX174:5154 0 0.00 0 +phiX174:5155 0 0.00 0 +phiX174:5156 0 0.00 0 +phiX174:5157 0 0.00 0 +phiX174:5158 0 0.00 0 +phiX174:5159 0 0.00 0 +phiX174:5160 0 0.00 0 +phiX174:5161 0 0.00 0 +phiX174:5162 0 0.00 0 +phiX174:5163 0 0.00 0 +phiX174:5164 0 0.00 0 +phiX174:5165 0 0.00 0 +phiX174:5166 0 0.00 0 +phiX174:5167 0 0.00 0 +phiX174:5168 0 0.00 0 +phiX174:5169 0 0.00 0 +phiX174:5170 0 0.00 0 +phiX174:5171 0 0.00 0 +phiX174:5172 0 0.00 0 +phiX174:5173 0 0.00 0 +phiX174:5174 0 0.00 0 +phiX174:5175 0 0.00 0 +phiX174:5176 0 0.00 0 +phiX174:5177 0 0.00 0 +phiX174:5178 0 0.00 0 +phiX174:5179 0 0.00 0 +phiX174:5180 0 0.00 0 +phiX174:5181 0 0.00 0 +phiX174:5182 0 0.00 0 +phiX174:5183 0 0.00 0 +phiX174:5184 0 0.00 0 +phiX174:5185 0 0.00 0 +phiX174:5186 0 0.00 0 +phiX174:5187 0 0.00 0 +phiX174:5188 0 0.00 0 +phiX174:5189 0 0.00 0 +phiX174:5190 0 0.00 0 +phiX174:5191 0 0.00 0 +phiX174:5192 0 0.00 0 +phiX174:5193 0 0.00 0 +phiX174:5194 0 0.00 0 +phiX174:5195 0 0.00 0 +phiX174:5196 0 0.00 0 +phiX174:5197 0 0.00 0 +phiX174:5198 0 0.00 0 +phiX174:5199 0 0.00 0 +phiX174:5200 0 0.00 0 +phiX174:5201 0 0.00 0 +phiX174:5202 0 0.00 0 +phiX174:5203 0 0.00 0 +phiX174:5204 0 0.00 0 +phiX174:5205 0 0.00 0 +phiX174:5206 0 0.00 0 +phiX174:5207 0 0.00 0 +phiX174:5208 0 0.00 0 +phiX174:5209 0 0.00 0 +phiX174:5210 0 0.00 0 +phiX174:5211 0 0.00 0 +phiX174:5212 0 0.00 0 +phiX174:5213 0 0.00 0 +phiX174:5214 0 0.00 0 +phiX174:5215 0 0.00 0 +phiX174:5216 0 0.00 0 +phiX174:5217 0 0.00 0 +phiX174:5218 0 0.00 0 +phiX174:5219 0 0.00 0 +phiX174:5220 0 0.00 0 +phiX174:5221 0 0.00 0 +phiX174:5222 0 0.00 0 +phiX174:5223 0 0.00 0 +phiX174:5224 0 0.00 0 +phiX174:5225 0 0.00 0 +phiX174:5226 0 0.00 0 +phiX174:5227 0 0.00 0 +phiX174:5228 0 0.00 0 +phiX174:5229 0 0.00 0 +phiX174:5230 0 0.00 0 +phiX174:5231 0 0.00 0 +phiX174:5232 0 0.00 0 +phiX174:5233 0 0.00 0 +phiX174:5234 0 0.00 0 +phiX174:5235 0 0.00 0 +phiX174:5236 0 0.00 0 +phiX174:5237 0 0.00 0 +phiX174:5238 0 0.00 0 +phiX174:5239 0 0.00 0 +phiX174:5240 0 0.00 0 +phiX174:5241 0 0.00 0 +phiX174:5242 0 0.00 0 +phiX174:5243 0 0.00 0 +phiX174:5244 0 0.00 0 +phiX174:5245 0 0.00 0 +phiX174:5246 0 0.00 0 +phiX174:5247 0 0.00 0 +phiX174:5248 0 0.00 0 +phiX174:5249 0 0.00 0 +phiX174:5250 0 0.00 0 +phiX174:5251 0 0.00 0 +phiX174:5252 0 0.00 0 +phiX174:5253 0 0.00 0 +phiX174:5254 0 0.00 0 +phiX174:5255 0 0.00 0 +phiX174:5256 0 0.00 0 +phiX174:5257 0 0.00 0 +phiX174:5258 0 0.00 0 +phiX174:5259 0 0.00 0 +phiX174:5260 0 0.00 0 +phiX174:5261 0 0.00 0 +phiX174:5262 0 0.00 0 +phiX174:5263 0 0.00 0 +phiX174:5264 0 0.00 0 +phiX174:5265 0 0.00 0 +phiX174:5266 0 0.00 0 +phiX174:5267 0 0.00 0 +phiX174:5268 0 0.00 0 +phiX174:5269 0 0.00 0 +phiX174:5270 0 0.00 0 +phiX174:5271 0 0.00 0 +phiX174:5272 0 0.00 0 +phiX174:5273 0 0.00 0 +phiX174:5274 0 0.00 0 +phiX174:5275 0 0.00 0 +phiX174:5276 0 0.00 0 +phiX174:5277 0 0.00 0 +phiX174:5278 0 0.00 0 +phiX174:5279 0 0.00 0 +phiX174:5280 0 0.00 0 +phiX174:5281 0 0.00 0 +phiX174:5282 0 0.00 0 +phiX174:5283 0 0.00 0 +phiX174:5284 0 0.00 0 +phiX174:5285 0 0.00 0 +phiX174:5286 0 0.00 0 +phiX174:5287 0 0.00 0 +phiX174:5288 0 0.00 0 +phiX174:5289 0 0.00 0 +phiX174:5290 0 0.00 0 +phiX174:5291 0 0.00 0 +phiX174:5292 0 0.00 0 +phiX174:5293 0 0.00 0 +phiX174:5294 0 0.00 0 +phiX174:5295 0 0.00 0 +phiX174:5296 0 0.00 0 +phiX174:5297 0 0.00 0 +phiX174:5298 0 0.00 0 +phiX174:5299 0 0.00 0 +phiX174:5300 0 0.00 0 +phiX174:5301 0 0.00 0 +phiX174:5302 0 0.00 0 +phiX174:5303 0 0.00 0 +phiX174:5304 0 0.00 0 +phiX174:5305 0 0.00 0 +phiX174:5306 0 0.00 0 +phiX174:5307 0 0.00 0 +phiX174:5308 0 0.00 0 +phiX174:5309 0 0.00 0 +phiX174:5310 0 0.00 0 +phiX174:5311 0 0.00 0 +phiX174:5312 0 0.00 0 +phiX174:5313 0 0.00 0 +phiX174:5314 0 0.00 0 +phiX174:5315 0 0.00 0 +phiX174:5316 0 0.00 0 +phiX174:5317 0 0.00 0 +phiX174:5318 0 0.00 0 +phiX174:5319 0 0.00 0 +phiX174:5320 0 0.00 0 +phiX174:5321 0 0.00 0 +phiX174:5322 0 0.00 0 +phiX174:5323 0 0.00 0 +phiX174:5324 0 0.00 0 +phiX174:5325 0 0.00 0 +phiX174:5326 0 0.00 0 +phiX174:5327 0 0.00 0 +phiX174:5328 0 0.00 0 +phiX174:5329 0 0.00 0 +phiX174:5330 0 0.00 0 +phiX174:5331 0 0.00 0 +phiX174:5332 0 0.00 0 +phiX174:5333 0 0.00 0 +phiX174:5334 0 0.00 0 +phiX174:5335 0 0.00 0 +phiX174:5336 0 0.00 0 +phiX174:5337 0 0.00 0 +phiX174:5338 0 0.00 0 +phiX174:5339 0 0.00 0 +phiX174:5340 0 0.00 0 +phiX174:5341 0 0.00 0 +phiX174:5342 0 0.00 0 +phiX174:5343 0 0.00 0 +phiX174:5344 0 0.00 0 +phiX174:5345 0 0.00 0 +phiX174:5346 0 0.00 0 +phiX174:5347 0 0.00 0 +phiX174:5348 0 0.00 0 +phiX174:5349 0 0.00 0 +phiX174:5350 0 0.00 0 +phiX174:5351 0 0.00 0 +phiX174:5352 0 0.00 0 +phiX174:5353 0 0.00 0 +phiX174:5354 0 0.00 0 +phiX174:5355 0 0.00 0 +phiX174:5356 0 0.00 0 +phiX174:5357 0 0.00 0 +phiX174:5358 0 0.00 0 +phiX174:5359 0 0.00 0 +phiX174:5360 0 0.00 0 +phiX174:5361 0 0.00 0 +phiX174:5362 0 0.00 0 +phiX174:5363 0 0.00 0 +phiX174:5364 0 0.00 0 +phiX174:5365 0 0.00 0 +phiX174:5366 0 0.00 0 +phiX174:5367 0 0.00 0 +phiX174:5368 0 0.00 0 +phiX174:5369 0 0.00 0 +phiX174:5370 0 0.00 0 +phiX174:5371 0 0.00 0 +phiX174:5372 0 0.00 0 +phiX174:5373 0 0.00 0 +phiX174:5374 0 0.00 0 +phiX174:5375 0 0.00 0 +phiX174:5376 0 0.00 0 +phiX174:5377 0 0.00 0 +phiX174:5378 0 0.00 0 +phiX174:5379 0 0.00 0 +phiX174:5380 0 0.00 0 +phiX174:5381 0 0.00 0 +phiX174:5382 0 0.00 0 +phiX174:5383 0 0.00 0 +phiX174:5384 0 0.00 0 +phiX174:5385 0 0.00 0 +phiX174:5386 0 0.00 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,2 @@ +Source_of_reads from_0_to_1) from_1_to_2) from_2_to_3) from_3_to_4) from_4_to_5) from_5_to_6) from_6_to_7) from_7_to_8) from_8_to_9) from_9_to_10) from_10_to_11) from_11_to_12) from_12_to_13) from_13_to_14) from_14_to_15) from_15_to_16) from_16_to_17) from_17_to_18) from_18_to_19) from_19_to_20) from_20_to_21) from_21_to_22) from_22_to_23) from_23_to_24) from_24_to_25) from_25_to_26) from_26_to_27) from_27_to_28) from_28_to_29) from_29_to_30) from_30_to_31) from_31_to_32) from_32_to_33) from_33_to_34) from_34_to_35) from_35_to_36) from_36_to_37) from_37_to_38) from_38_to_39) from_39_to_40) from_40_to_41) from_41_to_42) from_42_to_43) from_43_to_44) from_44_to_45) from_45_to_46) from_46_to_47) from_47_to_48) from_48_to_49) from_49_to_50) from_50_to_51) from_51_to_52) from_52_to_53) from_53_to_54) from_54_to_55) from_55_to_56) from_56_to_57) from_57_to_58) from_58_to_59) from_59_to_60) from_60_to_61) from_61_to_62) from_62_to_63) from_63_to_64) from_64_to_65) from_65_to_66) from_66_to_67) from_67_to_68) from_68_to_69) from_69_to_70) from_70_to_71) from_71_to_72) from_72_to_73) from_73_to_74) from_74_to_75) from_75_to_76) from_76_to_77) from_77_to_78) from_78_to_79) from_79_to_80) from_80_to_81) from_81_to_82) from_82_to_83) from_83_to_84) from_84_to_85) from_85_to_86) from_86_to_87) from_87_to_88) from_88_to_89) from_89_to_90) from_90_to_91) from_91_to_92) from_92_to_93) from_93_to_94) from_94_to_95) from_95_to_96) from_96_to_97) from_97_to_98) from_98_to_99) from_99_to_100) from_100_to_101) from_101_to_102) from_102_to_103) from_103_to_104) from_104_to_105) from_105_to_106) from_106_to_107) from_107_to_108) from_108_to_109) from_109_to_110) from_110_to_111) from_111_to_112) from_112_to_113) from_113_to_114) from_114_to_115) from_115_to_116) from_116_to_117) from_117_to_118) from_118_to_119) from_119_to_120) from_120_to_121) from_121_to_122) from_122_to_123) from_123_to_124) from_124_to_125) from_125_to_126) from_126_to_127) from_127_to_128) from_128_to_129) from_129_to_130) from_130_to_131) from_131_to_132) from_132_to_133) from_133_to_134) from_134_to_135) from_135_to_136) from_136_to_137) from_137_to_138) from_138_to_139) from_139_to_140) from_140_to_141) from_141_to_142) from_142_to_143) from_143_to_144) from_144_to_145) from_145_to_146) from_146_to_147) from_147_to_148) from_148_to_149) from_149_to_150) from_150_to_151) from_151_to_152) from_152_to_153) from_153_to_154) from_154_to_155) from_155_to_156) from_156_to_157) from_157_to_158) from_158_to_159) from_159_to_160) from_160_to_161) from_161_to_162) from_162_to_163) from_163_to_164) from_164_to_165) from_165_to_166) from_166_to_167) from_167_to_168) from_168_to_169) from_169_to_170) from_170_to_171) from_171_to_172) from_172_to_173) from_173_to_174) from_174_to_175) from_175_to_176) from_176_to_177) from_177_to_178) from_178_to_179) from_179_to_180) from_180_to_181) from_181_to_182) from_182_to_183) from_183_to_184) from_184_to_185) from_185_to_186) from_186_to_187) from_187_to_188) from_188_to_189) from_189_to_190) from_190_to_191) from_191_to_192) from_192_to_193) from_193_to_194) from_194_to_195) from_195_to_196) from_196_to_197) from_197_to_198) from_198_to_199) from_199_to_200) from_200_to_201) from_201_to_202) from_202_to_203) from_203_to_204) from_204_to_205) from_205_to_206) from_206_to_207) from_207_to_208) from_208_to_209) from_209_to_210) from_210_to_211) from_211_to_212) from_212_to_213) from_213_to_214) from_214_to_215) from_215_to_216) from_216_to_217) from_217_to_218) from_218_to_219) from_219_to_220) from_220_to_221) from_221_to_222) from_222_to_223) from_223_to_224) from_224_to_225) from_225_to_226) from_226_to_227) from_227_to_228) from_228_to_229) from_229_to_230) from_230_to_231) from_231_to_232) from_232_to_233) from_233_to_234) from_234_to_235) from_235_to_236) from_236_to_237) from_237_to_238) from_238_to_239) from_239_to_240) from_240_to_241) from_241_to_242) from_242_to_243) from_243_to_244) from_244_to_245) from_245_to_246) from_246_to_247) from_247_to_248) from_248_to_249) from_249_to_250) from_250_to_251) from_251_to_252) from_252_to_253) from_253_to_254) from_254_to_255) from_255_to_256) from_256_to_257) from_257_to_258) from_258_to_259) from_259_to_260) from_260_to_261) from_261_to_262) from_262_to_263) from_263_to_264) from_264_to_265) from_265_to_266) from_266_to_267) from_267_to_268) from_268_to_269) from_269_to_270) from_270_to_271) from_271_to_272) from_272_to_273) from_273_to_274) from_274_to_275) from_275_to_276) from_276_to_277) from_277_to_278) from_278_to_279) from_279_to_280) from_280_to_281) from_281_to_282) from_282_to_283) from_283_to_284) from_284_to_285) from_285_to_286) from_286_to_287) from_287_to_288) from_288_to_289) from_289_to_290) from_290_to_291) from_291_to_292) from_292_to_293) from_293_to_294) from_294_to_295) from_295_to_296) from_296_to_297) from_297_to_298) from_298_to_299) from_299_to_300) from_300_to_301) from_301_to_302) from_302_to_303) from_303_to_304) from_304_to_305) from_305_to_306) from_306_to_307) from_307_to_308) from_308_to_309) from_309_to_310) from_310_to_311) from_311_to_312) from_312_to_313) from_313_to_314) from_314_to_315) from_315_to_316) from_316_to_317) from_317_to_318) from_318_to_319) from_319_to_320) from_320_to_321) from_321_to_322) from_322_to_323) from_323_to_324) from_324_to_325) from_325_to_326) from_326_to_327) from_327_to_328) from_328_to_329) from_329_to_330) from_330_to_331) from_331_to_332) from_332_to_333) from_333_to_334) from_334_to_335) from_335_to_336) from_336_to_337) from_337_to_338) from_338_to_339) from_339_to_340) from_340_to_341) from_341_to_342) from_342_to_343) from_343_to_344) from_344_to_345) from_345_to_346) from_346_to_347) from_347_to_348) from_348_to_349) from_349_to_350) from_350_to_351) from_351_to_352) from_352_to_353) from_353_to_354) from_354_to_355) from_355_to_356) from_356_to_357) from_357_to_358) from_358_to_359) from_359_to_360) from_360_to_361) from_361_to_362) from_362_to_363) from_363_to_364) from_364_to_365) from_365_to_366) from_366_to_367) from_367_to_368) from_368_to_369) from_369_to_370) from_370_to_371) from_371_to_372) from_372_to_373) from_373_to_374) from_374_to_375) from_375_to_376) from_376_to_377) from_377_to_378) from_378_to_379) from_379_to_380) from_380_to_381) from_381_to_382) from_382_to_383) from_383_to_384) from_384_to_385) from_385_to_386) from_386_to_387) from_387_to_388) from_388_to_389) from_389_to_390) from_390_to_391) from_391_to_392) from_392_to_393) from_393_to_394) from_394_to_395) from_395_to_396) from_396_to_397) from_397_to_398) from_398_to_399) from_399_to_400) from_400_to_401) from_401_to_402) from_402_to_403) from_403_to_404) from_404_to_405) from_405_to_406) from_406_to_407) from_407_to_408) from_408_to_409) from_409_to_410) from_410_to_411) from_411_to_412) from_412_to_413) from_413_to_414) from_414_to_415) from_415_to_416) from_416_to_417) from_417_to_418) from_418_to_419) from_419_to_420) from_420_to_421) from_421_to_422) from_422_to_423) from_423_to_424) from_424_to_425) from_425_to_426) from_426_to_427) from_427_to_428) from_428_to_429) from_429_to_430) from_430_to_431) from_431_to_432) from_432_to_433) from_433_to_434) from_434_to_435) from_435_to_436) from_436_to_437) from_437_to_438) from_438_to_439) from_439_to_440) from_440_to_441) from_441_to_442) from_442_to_443) from_443_to_444) from_444_to_445) from_445_to_446) from_446_to_447) from_447_to_448) from_448_to_449) from_449_to_450) from_450_to_451) from_451_to_452) from_452_to_453) from_453_to_454) from_454_to_455) from_455_to_456) from_456_to_457) from_457_to_458) from_458_to_459) from_459_to_460) from_460_to_461) from_461_to_462) from_462_to_463) from_463_to_464) from_464_to_465) from_465_to_466) from_466_to_467) from_467_to_468) from_468_to_469) from_469_to_470) from_470_to_471) from_471_to_472) from_472_to_473) from_473_to_474) from_474_to_475) from_475_to_476) from_476_to_477) from_477_to_478) from_478_to_479) from_479_to_480) from_480_to_481) from_481_to_482) from_482_to_483) from_483_to_484) from_484_to_485) from_485_to_486) from_486_to_487) from_487_to_488) from_488_to_489) from_489_to_490) from_490_to_491) from_491_to_492) from_492_to_493) from_493_to_494) from_494_to_495) from_495_to_496) from_496_to_497) from_497_to_498) from_498_to_499) from_499_to_500) from_500_to_inf +sample_A Fake phiX Sample 5343 2 1 2 1 1 2 2 2 1 29 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,3 @@ +sample_id total mean granular_third_quartile granular_median granular_first_quartile %_bases_above_15 +A Fake phiX Sample 360 0.07 1 1 1 0.0 +Total 360 0.07 N/A N/A N/A
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/gatk_sorted_picard_index.loc.sample Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Picard dict and associated files. You will need +#to create these data files and then create a picard_index.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The picard_index.loc +#file has this format (longer white space is the TAB character): +# +#<unique_build_id> <dbkey> <display_name> <fasta_file_path> +# +#So, for example, if you had hg18 indexed and stored in +#/depot/data2/galaxy/srma/hg18/, +#then the srma_index.loc entry would look like this: +# +#hg18 hg18 hg18 Pretty /depot/data2/galaxy/picard/hg18/hg18.fa +# +#and your /depot/data2/galaxy/srma/hg18/ directory +#would contain the following three files: +#hg18.fa +#hg18.dict +#hg18.fa.fai +# +#The dictionary file for each reference (ex. hg18.dict) must be +#created via Picard (http://picard.sourceforge.net). Note that +#the dict file does not have the .fa extension although the +#path list in the loc file does include it. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of Picard dict files valid for GATK --> + <table name="gatk_picard_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/gatk_sorted_picard_index.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue Apr 01 09:12:33 2014 -0400 @@ -0,0 +1,9 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="gatk" version="1.4"> + <repository changeset_revision="0cc94f66d00e" name="package_gatk_1_4" owner="devteam" prior_installation_required="False" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="samtools" version="0.1.18"> + <repository changeset_revision="c0f72bdba484" name="package_samtools_0_1_18" owner="devteam" prior_installation_required="False" toolshed="http://testtoolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>