changeset 0:dda9b2e72e2b draft

Uploaded
author davidvanzessen
date Tue, 03 May 2016 09:52:21 -0400
parents
children 326165da9ece
files CreateGermlines.py DefineClones.py IMGT_Human_IGHD.fasta IMGT_Human_IGHJ.fasta IMGT_Human_IGHV.fasta LICENSE MakeDb.py ParseDb.py create_germlines.sh create_germlines.xml define_clones.sh define_clones.xml makedb.sh makedb.xml parsedb.sh parsedb.xml
diffstat 16 files changed, 7182 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/CreateGermlines.py	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,582 @@
+#!/usr/bin/env python3
+"""
+Reconstructs germline sequences from alignment data
+"""
+# Info
+__author__ = 'Namita Gupta, Jason Anthony Vander Heiden'
+from changeo import __version__, __date__
+
+# Imports
+import os
+import sys
+from argparse import ArgumentParser
+from collections import OrderedDict
+from textwrap import dedent
+from time import time
+
+# Presto and change imports
+from presto.Defaults import default_out_args
+from presto.IO import getOutputHandle, printLog, printProgress
+from changeo.Commandline import CommonHelpFormatter, getCommonArgParser, parseCommonArgs
+from changeo.IO import getDbWriter, readDbFile, countDbFile, getRepo
+from changeo.Receptor import allele_regex, parseAllele
+
+# Defaults
+default_germ_types = 'dmask'
+default_v_field = 'V_CALL'
+default_seq_field = 'SEQUENCE_IMGT'
+
+    
+def joinGermline(align, repo_dict, germ_types, v_field, seq_field):
+    """
+    Join gapped germline sequences aligned with sample sequences
+    
+    Arguments:
+    align = iterable yielding dictionaries of sample sequence data
+    repo_dict = dictionary of IMGT gapped germline sequences
+    germ_types = types of germline sequences to be output
+                     (full germline, D-region masked, only V-region germline)
+    v_field = field in which to look for V call
+    seq_field = field in which to look for sequence
+    
+    Returns:
+    dictionary of germline_type: germline_sequence
+    """
+    j_field = 'J_CALL'
+    germlines = {'full': '', 'dmask': '', 'vonly': ''}
+    result_log = OrderedDict()
+    result_log['ID'] = align['SEQUENCE_ID']
+
+    # Find germline V-region gene
+    if v_field == 'V_CALL_GENOTYPED':
+        vgene = parseAllele(align[v_field], allele_regex, 'list')
+        vkey = vgene
+    else:
+        vgene = parseAllele(align[v_field], allele_regex, 'first')
+        vkey = (vgene, )
+
+    # Build V-region germline
+    if vgene is not None:
+        result_log['V_CALL'] = ','.join(vkey)
+        if vkey in repo_dict:
+            vseq = repo_dict[vkey]
+            # Germline start
+            try: vstart = int(align['V_GERM_START_IMGT']) - 1
+            except (TypeError, ValueError): vstart = 0
+            # Germline length
+            try: vlen = int(align['V_GERM_LENGTH_IMGT'])
+            except (TypeError, ValueError): vlen = 0
+            # TODO:  not sure what this line is doing here. it no make no sense.
+            vpad = vlen - len(vseq[vstart:])
+            if vpad < 0: vpad = 0
+            germ_vseq = vseq[vstart:(vstart + vlen)] + ('N' * vpad)
+        else:
+            result_log['ERROR'] = 'Germline %s not in repertoire' % ','.join(vkey)
+            return result_log, germlines
+    else:
+        result_log['V_CALL'] = None
+        try: vlen = int(align['V_GERM_LENGTH_IMGT'])
+        except (TypeError, ValueError): vlen = 0
+        germ_vseq = 'N' * vlen
+
+    # Find germline D-region gene
+    dgene = parseAllele(align['D_CALL'], allele_regex, 'first')
+
+    # Build D-region germline
+    if dgene is not None:
+        result_log['D_CALL'] = dgene
+        dkey = (dgene, )
+        if dkey in repo_dict:
+            dseq = repo_dict[dkey]
+            # Germline start
+            try: dstart = int(align['D_GERM_START']) - 1
+            except (TypeError, ValueError): dstart = 0
+            # Germline length
+            try: dlen = int(align['D_GERM_LENGTH'])
+            except (TypeError, ValueError): dlen = 0
+            germ_dseq = repo_dict[dkey][dstart:(dstart + dlen)]
+        else:
+            result_log['ERROR'] = 'Germline %s not in repertoire' % dgene
+            return result_log, germlines
+    else:
+        result_log['D_CALL'] = None
+        germ_dseq = ''
+
+    # Find germline J-region gene
+    jgene = parseAllele(align[j_field], allele_regex, 'first')
+
+    # Build D-region germline
+    if jgene is not None:
+        result_log['J_CALL'] = jgene
+        jkey = (jgene, )
+        if jkey in repo_dict:
+            jseq = repo_dict[jkey]
+            # Germline start
+            try: jstart = int(align['J_GERM_START']) - 1
+            except (TypeError, ValueError): jstart = 0
+            # Germline length
+            try: jlen = int(align['J_GERM_LENGTH'])
+            except (TypeError, ValueError): jlen = 0
+            # TODO:  not sure what this line is doing either
+            jpad = jlen - len(jseq[jstart:])
+            if jpad < 0: jpad = 0
+            germ_jseq = jseq[jstart:(jstart + jlen)] + ('N' * jpad)
+        else:
+            result_log['ERROR'] = 'Germline %s not in repertoire' % jgene
+            return result_log, germlines
+    else:
+        result_log['J_CALL'] = None
+        try: jlen = int(align['J_GERM_LENGTH'])
+        except (TypeError, ValueError): jlen = 0
+        germ_jseq = 'N' * jlen
+
+    # Assemble pieces starting with V-region
+    germ_seq = germ_vseq
+    regions = 'V' * len(germ_vseq)
+
+    # Nucleotide additions before D (before J for light chains)
+    try: n1_len = int(align['N1_LENGTH'])
+    except (TypeError, ValueError): n1_len = 0
+    if n1_len < 0:
+        result_log['ERROR'] = 'N1_LENGTH is negative'
+        return result_log, germlines
+
+    germ_seq += 'N' * n1_len
+    regions += 'N' * n1_len
+
+    # Add D-region
+    germ_seq += germ_dseq
+    regions += 'D' * len(germ_dseq)
+    #print 'VD>', germ_seq, '\nVD>', regions
+
+    # Nucleotide additions after D (heavy chains only)
+    try: n2_len = int(align['N2_LENGTH'])
+    except (TypeError, ValueError): n2_len = 0
+    if n2_len < 0:
+        result_log['ERROR'] = 'N2_LENGTH is negative'
+        return result_log, germlines
+
+    germ_seq += 'N' * n2_len
+    regions += 'N' * n2_len
+
+    # Add J-region
+    germ_seq += germ_jseq
+    regions += 'J' * len(germ_jseq)
+
+    # Define return germlines
+    germlines['full'] = germ_seq
+    germlines['regions'] = regions
+    if 'dmask' in germ_types:
+        germlines['dmask'] = germ_seq[:len(germ_vseq)] + \
+                             'N' * (len(germ_seq) - len(germ_vseq) - len(germ_jseq)) + \
+                             germ_seq[-len(germ_jseq):]
+    if 'vonly' in germ_types:
+        germlines['vonly'] = germ_vseq
+
+    # Check that input and germline sequence match
+    if len(align[seq_field]) == 0:
+        result_log['ERROR'] = 'Sequence is missing from %s column' % seq_field
+    elif len(germlines['full']) != len(align[seq_field]):
+        result_log['ERROR'] = 'Germline sequence is %d nucleotides longer than input sequence' % \
+                              (len(germlines['full']) - len(align[seq_field]))
+
+    # Convert to uppercase
+    for k, v in germlines.items():  germlines[k] = v.upper()
+    
+    return result_log, germlines
+
+
+def assembleEachGermline(db_file, repo, germ_types, v_field, seq_field, out_args=default_out_args):
+    """
+    Write germline sequences to tab-delimited database file
+    
+    Arguments:
+    db_file = input tab-delimited database file
+    repo = folder with germline repertoire files
+    germ_types = types of germline sequences to be output
+                     (full germline, D-region masked, only V-region germline)
+    v_field = field in which to look for V call
+    seq_field = field in which to look for sequence
+    out_args = arguments for output preferences
+    
+    Returns:
+    None
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'CreateGermlines'
+    log['DB_FILE'] = os.path.basename(db_file)
+    log['GERM_TYPES'] = germ_types if isinstance(germ_types, str) else ','.join(germ_types)
+    log['CLONED'] = 'False'
+    log['V_FIELD'] = v_field
+    log['SEQ_FIELD'] = seq_field
+    printLog(log)
+    
+    # Get repertoire and open Db reader
+    repo_dict = getRepo(repo)
+    reader = readDbFile(db_file, ig=False)
+
+    # Exit if V call field does not exist in reader
+    if v_field not in reader.fieldnames:
+        sys.exit('Error: V field does not exist in input database file.')
+    
+    # Define log handle
+    if out_args['log_file'] is None:  
+        log_handle = None
+    else:  
+        log_handle = open(out_args['log_file'], 'w')
+
+    add_fields = []
+    seq_type = seq_field.split('_')[-1]
+    if 'full' in germ_types: add_fields +=  ['GERMLINE_' + seq_type]
+    if 'dmask' in germ_types: add_fields += ['GERMLINE_' + seq_type + '_D_MASK']
+    if 'vonly' in germ_types: add_fields += ['GERMLINE_' + seq_type + '_V_REGION']
+
+    # Create output file handle and Db writer
+    pass_handle = getOutputHandle(db_file, 'germ-pass',
+                                  out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'],
+                                  out_type=out_args['out_type'])
+    pass_writer = getDbWriter(pass_handle, db_file, add_fields=add_fields)
+
+    if out_args['failed']:
+        fail_handle = getOutputHandle(db_file, 'germ-fail',
+                                      out_dir=out_args['out_dir'],
+                                      out_name=out_args['out_name'],
+                                      out_type=out_args['out_type'])
+        fail_writer = getDbWriter(fail_handle, db_file, add_fields=add_fields)
+    else:
+        fail_handle = None
+        fail_writer = None
+
+    # Initialize time and total count for progress bar
+    start_time = time()
+    rec_count = countDbFile(db_file)
+    pass_count = fail_count = 0
+    # Iterate over rows
+    for i,row in enumerate(reader):
+        # Print progress
+        printProgress(i, rec_count, 0.05, start_time)
+        
+        result_log, germlines = joinGermline(row, repo_dict, germ_types, v_field, seq_field)
+        
+        # Add germline field(s) to dictionary
+        if 'full' in germ_types: row['GERMLINE_' + seq_type] = germlines['full']
+        if 'dmask' in germ_types: row['GERMLINE_' + seq_type + '_D_MASK'] = germlines['dmask']
+        if 'vonly' in germ_types: row['GERMLINE_' + seq_type + '_V_REGION'] = germlines['vonly']
+
+        # Write row to pass or fail file
+        if 'ERROR' in result_log:
+            fail_count += 1
+            if fail_writer is not None: fail_writer.writerow(row)
+        else:
+            result_log['SEQUENCE'] = row[seq_field]
+            result_log['GERMLINE'] = germlines['full']
+            result_log['REGIONS'] = germlines['regions']
+            
+            pass_count += 1
+            pass_writer.writerow(row)
+        printLog(result_log, handle=log_handle)
+    
+    # Print log
+    printProgress(i+1, rec_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['PASS'] = pass_count
+    log['FAIL'] = fail_count
+    log['END'] = 'CreateGermlines'
+    printLog(log)
+        
+    # Close file handles
+    pass_handle.close()
+    if fail_handle is not None: fail_handle.close()
+    if log_handle is not None:  log_handle.close()
+
+
+def makeCloneGermline(clone, clone_dict, repo_dict, germ_types, v_field, seq_field, counts, writers, out_args):
+    """
+    Determine consensus clone sequence and create germline for clone
+
+    Arguments:
+    clone = clone ID
+    clone_dict = iterable yielding dictionaries of sequence data from clone
+    repo_dict = dictionary of IMGT gapped germline sequences
+    germ_types = types of germline sequences to be output
+                     (full germline, D-region masked, only V-region germline)
+    v_field = field in which to look for V call
+    seq_field = field in which to look for sequence
+    counts = dictionary of pass counter and fail counter
+    writers = dictionary with pass and fail DB writers
+    out_args = arguments for output preferences
+
+    Returns:
+    None
+    """
+    seq_type = seq_field.split('_')[-1]
+    j_field = 'J_CALL'
+    
+    # Create dictionaries to count observed V/J calls
+    v_dict = OrderedDict()
+    j_dict = OrderedDict()
+    
+    # Find longest sequence in clone
+    max_length = 0
+    for val in clone_dict.values():
+        v = val[v_field]
+        v_dict[v] = v_dict.get(v,0) + 1
+        j = val[j_field]
+        j_dict[j] = j_dict.get(j,0) + 1
+        if len(val[seq_field]) > max_length: max_length = len(val[seq_field])
+    
+    # Consensus V and J having most observations
+    v_cons = [k for k in list(v_dict.keys()) if v_dict[k] == max(v_dict.values())]
+    j_cons = [k for k in list(j_dict.keys()) if j_dict[k] == max(j_dict.values())]
+    # Consensus sequence(s) with consensus V/J calls and longest sequence
+    cons = [val for val in list(clone_dict.values()) if val.get(v_field,'') in v_cons and \
+                                                  val.get(j_field,'') in j_cons and \
+                                                  len(val[seq_field])==max_length]
+    # Sequence(s) with consensus V/J are not longest
+    if not cons:
+        # Sequence(s) with consensus V/J (not longest)
+        cons = [val for val in list(clone_dict.values()) if val.get(v_field,'') in v_cons and val.get(j_field,'') in j_cons]
+        
+        # No sequence has both consensus V and J call
+        if not cons: 
+            result_log = OrderedDict()
+            result_log['ID'] = clone
+            result_log['V_CALL'] = ','.join(v_cons)
+            result_log['J_CALL'] = ','.join(j_cons)
+            result_log['ERROR'] = 'No consensus sequence for clone found'
+        else:
+            # Pad end of consensus sequence with gaps to make it the max length
+            cons = cons[0]
+            cons['J_GERM_LENGTH'] = str(int(cons['J_GERM_LENGTH'] or 0) + max_length - len(cons[seq_field]))
+            cons[seq_field] += '.'*(max_length - len(cons[seq_field]))
+            result_log, germlines = joinGermline(cons, repo_dict, germ_types, v_field, seq_field)
+            result_log['ID'] = clone
+            result_log['CONSENSUS'] = cons['SEQUENCE_ID']
+    else:
+        cons = cons[0]
+        result_log, germlines = joinGermline(cons, repo_dict, germ_types, v_field, seq_field)
+        result_log['ID'] = clone
+        result_log['CONSENSUS'] = cons['SEQUENCE_ID']
+
+    # Write sequences of clone
+    for val in clone_dict.values():
+        if 'ERROR' not in result_log:
+            # Update lengths padded to longest sequence in clone
+            val['J_GERM_LENGTH'] = str(int(val['J_GERM_LENGTH'] or 0) + max_length - len(val[seq_field]))
+            val[seq_field] += '.'*(max_length - len(val[seq_field]))
+            
+            # Add column(s) to tab-delimited database file
+            if 'full' in germ_types: val['GERMLINE_' + seq_type] = germlines['full']
+            if 'dmask' in germ_types: val['GERMLINE_' + seq_type + '_D_MASK'] = germlines['dmask']
+            if 'vonly' in germ_types: val['GERMLINE_' + seq_type + '_V_REGION'] = germlines['vonly']
+            
+            result_log['SEQUENCE'] = cons[seq_field]
+            result_log['GERMLINE'] = germlines['full']
+            result_log['REGIONS'] = germlines['regions']
+            
+            # Write to pass file
+            counts['pass'] += 1
+            writers['pass'].writerow(val)
+        else:
+            # Write to fail file
+            counts['fail'] += 1
+            if writers['fail'] is not None: writers['fail'].writerow(val)
+    # Return log
+    return result_log
+        
+        
+def assembleCloneGermline(db_file, repo, germ_types, v_field, seq_field, out_args=default_out_args):
+    """
+    Assemble one germline sequence for each clone in a tab-delimited database file
+    
+    Arguments:
+    db_file = input tab-delimited database file
+    repo = folder with germline repertoire files
+    germ_types = types of germline sequences to be output
+                     (full germline, D-region masked, only V-region germline)
+    v_field = field in which to look for V call
+    seq_field = field in which to look for sequence
+    out_args = arguments for output preferences
+    
+    Returns:
+    None
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'CreateGermlines'
+    log['DB_FILE'] = os.path.basename(db_file)
+    log['GERM_TYPES'] = germ_types if isinstance(germ_types, str) else ','.join(germ_types)
+    log['CLONED'] = 'True'
+    log['V_FIELD'] = v_field
+    log['SEQ_FIELD'] = seq_field
+    printLog(log)
+    
+    # Get repertoire and open Db reader
+    repo_dict = getRepo(repo)
+    reader = readDbFile(db_file, ig=False)
+
+    # Exit if V call field does not exist in reader
+    if v_field not in reader.fieldnames:
+        sys.exit('Error: V field does not exist in input database file.')
+    
+    # Define log handle
+    if out_args['log_file'] is None:  
+        log_handle = None
+    else:  
+        log_handle = open(out_args['log_file'], 'w')
+
+    add_fields = []
+    seq_type = seq_field.split('_')[-1]
+    if 'full' in germ_types: add_fields +=  ['GERMLINE_' + seq_type]
+    if 'dmask' in germ_types: add_fields += ['GERMLINE_' + seq_type + '_D_MASK']
+    if 'vonly' in germ_types: add_fields += ['GERMLINE_' + seq_type + '_V_REGION']
+
+    # Create output file handle and Db writer
+    writers = {}
+    pass_handle = getOutputHandle(db_file, 'germ-pass', out_dir=out_args['out_dir'],
+                                 out_name=out_args['out_name'], out_type=out_args['out_type'])
+    writers['pass'] = getDbWriter(pass_handle, db_file, add_fields=add_fields)
+
+    if out_args['failed']:
+        fail_handle = getOutputHandle(db_file, 'germ-fail', out_dir=out_args['out_dir'],
+                                     out_name=out_args['out_name'], out_type=out_args['out_type'])
+        writers['fail'] = getDbWriter(fail_handle, db_file, add_fields=add_fields)
+    else:
+        fail_handle = None
+        writers['fail'] = None
+
+    # Initialize time and total count for progress bar
+    start_time = time()
+    rec_count = countDbFile(db_file)
+    counts = {}
+    clone_count = counts['pass'] = counts['fail'] = 0
+    # Iterate over rows
+    clone = 'initial'
+    clone_dict = OrderedDict()
+    for i,row in enumerate(reader):
+        # Print progress
+        printProgress(i, rec_count, 0.05, start_time)
+        
+        # Clone isn't over yet
+        if row.get('CLONE','') == clone: 
+            clone_dict[row["SEQUENCE_ID"]] = row
+        # Clone just finished
+        elif clone_dict:
+            clone_count += 1
+            result_log = makeCloneGermline(clone, clone_dict, repo_dict, germ_types,
+                                           v_field, seq_field, counts, writers, out_args)
+            printLog(result_log, handle=log_handle)
+            # Now deal with current row (first of next clone)
+            clone = row['CLONE']
+            clone_dict = OrderedDict([(row['SEQUENCE_ID'],row)])
+        # Last case is only for first row of file
+        else:
+            clone = row['CLONE']
+            clone_dict = OrderedDict([(row['SEQUENCE_ID'],row)])
+    clone_count += 1
+    result_log = makeCloneGermline(clone, clone_dict, repo_dict, germ_types, v_field,
+                                   seq_field, counts, writers, out_args)
+    printLog(result_log, handle=log_handle)
+    
+    # Print log
+    printProgress(i+1, rec_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['CLONES'] = clone_count
+    log['RECORDS'] = rec_count
+    log['PASS'] = counts['pass']
+    log['FAIL'] = counts['fail']
+    log['END'] = 'CreateGermlines'
+    printLog(log)
+        
+    # Close file handles
+    pass_handle.close()
+    if fail_handle is not None: fail_handle.close()
+    if log_handle is not None:  log_handle.close()
+
+
+def getArgParser():
+    """
+    Defines the ArgumentParser
+
+    Arguments: 
+    None
+                      
+    Returns: 
+    an ArgumentParser object
+    """
+    # Define input and output field help message
+    fields = dedent(
+             '''
+             output files:
+                 germ-pass
+                    database with assigned germline sequences.
+                 germ-fail
+                    database with records failing germline assignment.
+
+             required fields:
+                 SEQUENCE_ID, SEQUENCE_INPUT, SEQUENCE_VDJ or SEQUENCE_IMGT,
+                 V_CALL or V_CALL_GENOTYPED, D_CALL, J_CALL,
+                 V_SEQ_START, V_SEQ_LENGTH, V_GERM_START_IMGT, V_GERM_LENGTH_IMGT,
+                 D_SEQ_START, D_SEQ_LENGTH, D_GERM_START, D_GERM_LENGTH,
+                 J_SEQ_START, J_SEQ_LENGTH, J_GERM_START, J_GERM_LENGTH
+              
+             optional fields:
+                 CLONE
+                
+             output fields:
+                 GERMLINE_VDJ, GERMLINE_VDJ_D_MASK, GERMLINE_VDJ_V_REGION,
+                 GERMLINE_IMGT, GERMLINE_IMGT_D_MASK, GERMLINE_IMGT_V_REGION
+              ''')
+
+    # Parent parser
+    parser_parent = getCommonArgParser(seq_in=False, seq_out=False, db_in=True,
+                                       annotation=False)
+    # Define argument parser
+    parser = ArgumentParser(description=__doc__, epilog=fields,
+                            parents=[parser_parent],
+                            formatter_class=CommonHelpFormatter)
+    parser.add_argument('--version', action='version',
+                        version='%(prog)s:' + ' %s-%s' %(__version__, __date__))
+                                     
+    parser.add_argument('-r', nargs='+', action='store', dest='repo', required=True,
+                        help='List of folders and/or fasta files with germline sequences.')
+    parser.add_argument('-g', action='store', dest='germ_types', default=default_germ_types,
+                        nargs='+', choices=('full', 'dmask', 'vonly'),
+                        help='Specify type(s) of germlines to include full germline, \
+                              germline with D-region masked, or germline for V region only.')
+    parser.add_argument('--cloned', action='store_true', dest='cloned',
+                        help='Specify to create only one germline per clone \
+                             (assumes input file is sorted by clone column)')
+    parser.add_argument('--vf', action='store', dest='v_field', default=default_v_field,
+                        help='Specify field to use for germline V call')
+    parser.add_argument('--sf', action='store', dest='seq_field', default=default_seq_field,
+                        help='Specify field to use for sequence')
+
+    return parser
+
+
+if __name__ == "__main__":
+    """
+    Parses command line arguments and calls main
+    """
+
+    # Parse command line arguments
+    parser = getArgParser()    
+    args = parser.parse_args()
+    args_dict = parseCommonArgs(args)
+    del args_dict['db_files']
+    del args_dict['cloned']
+    args_dict['v_field'] = args_dict['v_field'].upper()
+    args_dict['seq_field'] = args_dict['seq_field'].upper()
+    
+    for f in args.__dict__['db_files']:
+        args_dict['db_file'] = f
+        if args.__dict__['cloned']:
+            assembleCloneGermline(**args_dict)
+        else:
+            assembleEachGermline(**args_dict)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/DefineClones.py	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,1052 @@
+#!/usr/bin/env python3
+"""
+Assign Ig sequences into clones
+"""
+# Info
+__author__ = 'Namita Gupta, Jason Anthony Vander Heiden, Gur Yaari, Mohamed Uduman'
+from changeo import __version__, __date__
+
+# Imports
+import os
+import re
+import sys
+import numpy as np
+from argparse import ArgumentParser
+from collections import OrderedDict
+from itertools import chain
+from textwrap import dedent
+from time import time
+from Bio import pairwise2
+from Bio.Seq import translate
+
+# Presto and changeo imports
+from presto.Defaults import default_out_args
+from presto.IO import getFileType, getOutputHandle, printLog, printProgress
+from presto.Multiprocessing import manageProcesses
+from presto.Sequence import getDNAScoreDict
+from changeo.Commandline import CommonHelpFormatter, getCommonArgParser, parseCommonArgs
+from changeo.Distance import getDNADistMatrix, getAADistMatrix, \
+                             hs1f_model, m1n_model, hs5f_model, \
+                             calcDistances, formClusters
+from changeo.IO import getDbWriter, readDbFile, countDbFile
+from changeo.Multiprocessing import DbData, DbResult
+
+# Defaults
+default_translate = False
+default_distance = 0.0
+default_bygroup_model = 'hs1f'
+default_hclust_model = 'chen2010'
+default_seq_field = 'JUNCTION'
+default_norm = 'len'
+default_sym = 'avg'
+default_linkage = 'single'
+
+# TODO:  should be in Distance, but need to be after function definitions
+# Amino acid Hamming distance
+aa_model = getAADistMatrix(mask_dist=1, gap_dist=0)
+
+# DNA Hamming distance
+ham_model = getDNADistMatrix(mask_dist=0, gap_dist=0)
+
+
+# TODO:  this function is an abstraction to facilitate later cleanup
+def getModelMatrix(model):
+    """
+    Simple wrapper to get distance matrix from model name
+
+    Arguments:
+    model = model name
+
+    Return:
+    a pandas.DataFrame containing the character distance matrix
+    """
+    if model == 'aa':
+        return(aa_model)
+    elif model == 'ham':
+        return(ham_model)
+    elif model == 'm1n':
+        return(m1n_model)
+    elif model == 'hs1f':
+        return(hs1f_model)
+    elif model == 'hs5f':
+        return(hs5f_model)
+    else:
+        sys.stderr.write('Unrecognized distance model: %s.\n' % model)
+
+
+def indexJunctions(db_iter, fields=None, mode='gene', action='first'):
+    """
+    Identifies preclonal groups by V, J and junction length
+
+    Arguments: 
+    db_iter = an iterator of IgRecords defined by readDbFile
+    fields = additional annotation fields to use to group preclones;
+             if None use only V, J and junction length
+    mode = specificity of alignment call to use for assigning preclones;
+           one of ('allele', 'gene')
+    action = how to handle multiple value fields when assigning preclones;
+             one of ('first', 'set')
+    
+    Returns: 
+    a dictionary of {(V, J, junction length):[IgRecords]}
+    """
+    # Define functions for grouping keys
+    if mode == 'allele' and fields is None:
+        def _get_key(rec, act):
+            return (rec.getVAllele(act), rec.getJAllele(act),
+                    None if rec.junction is None else len(rec.junction))
+    elif mode == 'gene' and fields is None:
+        def _get_key(rec, act):  
+            return (rec.getVGene(act), rec.getJGene(act),
+                    None if rec.junction is None else len(rec.junction))
+    elif mode == 'allele' and fields is not None:
+        def _get_key(rec, act):
+            vdj = [rec.getVAllele(act), rec.getJAllele(act),
+                    None if rec.junction is None else len(rec.junction)]
+            ann = [rec.toDict().get(k, None) for k in fields]
+            return tuple(chain(vdj, ann))
+    elif mode == 'gene' and fields is not None:
+        def _get_key(rec, act):
+            vdj = [rec.getVGene(act), rec.getJGene(act),
+                    None if rec.junction is None else len(rec.junction)]
+            ann = [rec.toDict().get(k, None) for k in fields]
+            return tuple(chain(vdj, ann))
+
+    start_time = time()
+    clone_index = {}
+    rec_count = 0
+    for rec in db_iter:
+        key = _get_key(rec, action)
+
+        # Print progress
+        if rec_count == 0:
+            print('PROGRESS> Grouping sequences')
+
+        printProgress(rec_count, step=1000, start_time=start_time)
+        rec_count += 1
+
+        # Assigned passed preclone records to key and failed to index None
+        if all([k is not None and k != '' for k in key]):
+            #print key
+            # TODO:  Has much slow. Should have less slow.
+            if action == 'set':
+                
+                f_range = list(range(2, 3 + (len(fields) if fields else 0)))
+                vdj_range = list(range(2))
+                
+                # Check for any keys that have matching columns and junction length and overlapping genes/alleles
+                to_remove = []
+                if len(clone_index) > (1 if None in clone_index else 0) and key not in clone_index:
+                    key = list(key)
+                    for k in clone_index:
+                        if k is not None and all([key[i] == k[i] for i in f_range]):
+                            if all([not set(key[i]).isdisjoint(set(k[i])) for i in vdj_range]):
+                                for i in vdj_range:  key[i] = tuple(set(key[i]).union(set(k[i])))
+                                to_remove.append(k)
+                
+                # Remove original keys, replace with union of all genes/alleles and append values to new key
+                val = [rec]
+                val += list(chain(*(clone_index.pop(k) for k in to_remove)))
+                clone_index[tuple(key)] = clone_index.get(tuple(key),[]) + val 
+
+            elif action == 'first':
+                clone_index.setdefault(key, []).append(rec)
+        else:
+            clone_index.setdefault(None, []).append(rec)
+
+    printProgress(rec_count, step=1000, start_time=start_time, end=True)
+
+    return clone_index
+
+
+def distanceClones(records, model=default_bygroup_model, distance=default_distance,
+                   dist_mat=None, norm=default_norm, sym=default_sym,
+                   linkage=default_linkage, seq_field=default_seq_field):
+    """
+    Separates a set of IgRecords into clones
+
+    Arguments: 
+    records = an iterator of IgRecords
+    model = substitution model used to calculate distance
+    distance = the distance threshold to assign clonal groups
+    dist_mat = pandas DataFrame of pairwise nucleotide or amino acid distances
+    norm = normalization method
+    sym = symmetry method
+    linkage = type of linkage
+    seq_field = sequence field used to calculate distance between records
+
+    Returns: 
+    a dictionary of lists defining {clone number: [IgRecords clonal group]}
+    """
+    # Get distance matrix if not provided
+    if dist_mat is None:  dist_mat = getModelMatrix(model)
+
+    # Determine length of n-mers
+    if model in ['hs1f', 'm1n', 'aa', 'ham']:
+        nmer_len = 1
+    elif model in ['hs5f']:
+        nmer_len = 5
+    else:
+        sys.stderr.write('Unrecognized distance model: %s.\n' % model)
+
+    # Define unique junction mapping
+    seq_map = {}
+    for ig in records:
+        seq = ig.getSeqField(seq_field)
+        # Check if sequence length is 0
+        if len(seq) == 0:
+            return None
+
+        seq = re.sub('[\.-]','N', str(seq))
+        if model == 'aa':  seq = translate(seq)
+
+        seq_map.setdefault(seq, []).append(ig)
+
+    # Process records
+    if len(seq_map) == 1:
+        return {1:records}
+
+    # Define sequences
+    seqs = list(seq_map.keys())
+
+    # Calculate pairwise distance matrix
+    dists = calcDistances(seqs, nmer_len, dist_mat, norm, sym)
+
+    # Perform hierarchical clustering
+    clusters = formClusters(dists, linkage, distance)
+
+    # Turn clusters into clone dictionary
+    clone_dict = {}
+    for i, c in enumerate(clusters):
+        clone_dict.setdefault(c, []).extend(seq_map[seqs[i]])
+
+    return clone_dict
+
+
+def distChen2010(records):
+    """
+    Calculate pairwise distances as defined in Chen 2010
+    
+    Arguments:
+    records = list of IgRecords where first is query to be compared to others in list
+    
+    Returns:
+    list of distances
+    """
+    # Pull out query sequence and V/J information
+    query = records.popitem(last=False)
+    query_cdr3 = query.junction[3:-3]
+    query_v_allele = query.getVAllele()
+    query_v_gene = query.getVGene()
+    query_v_family = query.getVFamily()
+    query_j_allele = query.getJAllele()
+    query_j_gene = query.getJGene()
+    # Create alignment scoring dictionary
+    score_dict = getDNAScoreDict()
+    
+    scores = [0]*len(records)    
+    for i in range(len(records)):
+        ld = pairwise2.align.globalds(query_cdr3, records[i].junction[3:-3],
+                                      score_dict, -1, -1, one_alignment_only=True)
+        # Check V similarity
+        if records[i].getVAllele() == query_v_allele: ld += 0
+        elif records[i].getVGene() == query_v_gene: ld += 1
+        elif records[i].getVFamily() == query_v_family: ld += 3
+        else: ld += 5
+        # Check J similarity
+        if records[i].getJAllele() == query_j_allele: ld += 0
+        elif records[i].getJGene() == query_j_gene: ld += 1
+        else: ld += 3
+        # Divide by length
+        scores[i] = ld/max(len(records[i].junction[3:-3]), query_cdr3)
+        
+    return scores
+
+
+def distAdemokun2011(records):
+    """
+    Calculate pairwise distances as defined in Ademokun 2011
+    
+    Arguments:
+    records = list of IgRecords where first is query to be compared to others in list
+    
+    Returns:
+    list of distances
+    """
+    # Pull out query sequence and V family information
+    query = records.popitem(last=False)
+    query_cdr3 = query.junction[3:-3]
+    query_v_family = query.getVFamily()
+    # Create alignment scoring dictionary
+    score_dict = getDNAScoreDict()
+    
+    scores = [0]*len(records)    
+    for i in range(len(records)):
+        
+        if abs(len(query_cdr3) - len(records[i].junction[3:-3])) > 10:
+            scores[i] = 1
+        elif query_v_family != records[i].getVFamily(): 
+            scores[i] = 1
+        else: 
+            ld = pairwise2.align.globalds(query_cdr3, records[i].junction[3:-3], 
+                                          score_dict, -1, -1, one_alignment_only=True)
+            scores[i] = ld/min(len(records[i].junction[3:-3]), query_cdr3)
+    
+    return scores
+
+
+def hierClust(dist_mat, method='chen2010'):
+    """
+    Calculate hierarchical clustering
+    
+    Arguments:
+    dist_mat = square-formed distance matrix of pairwise CDR3 comparisons
+    
+    Returns:
+    list of cluster ids
+    """
+    if method == 'chen2010':
+        clusters = formClusters(dist_mat, 'average', 0.32)
+    elif method == 'ademokun2011':
+        clusters = formClusters(dist_mat, 'complete', 0.25)
+    else: clusters = np.ones(dist_mat.shape[0])
+        
+    return clusters
+
+# TODO:  Merge duplicate feed, process and collect functions.
+def feedQueue(alive, data_queue, db_file, group_func, group_args={}):
+    """
+    Feeds the data queue with Ig records
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue to hold data for processing
+    db_file = the Ig record database file
+    group_func = the function to use for assigning preclones
+    group_args = a dictionary of arguments to pass to group_func
+    
+    Returns: 
+    None
+    """
+    # Open input file and perform grouping
+    try:
+        # Iterate over Ig records and assign groups
+        db_iter = readDbFile(db_file)
+        clone_dict = group_func(db_iter, **group_args)
+    except:
+        #sys.stderr.write('Exception in feeder grouping step\n')
+        alive.value = False
+        raise
+    
+    # Add groups to data queue
+    try:
+        #print 'START FEED', alive.value
+        # Iterate over groups and feed data queue
+        clone_iter = iter(clone_dict.items())
+        while alive.value:
+            # Get data from queue
+            if data_queue.full():  continue
+            else:  data = next(clone_iter, None)
+            # Exit upon reaching end of iterator
+            if data is None:  break
+            #print "FEED", alive.value, k
+            
+            # Feed queue
+            data_queue.put(DbData(*data))
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in feeder queue feeding step\n')
+        alive.value = False
+        raise
+
+    return None
+
+
+def feedQueueClust(alive, data_queue, db_file, group_func=None, group_args={}):
+    """
+    Feeds the data queue with Ig records
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue to hold data for processing
+    db_file = the Ig record database file
+    
+    Returns: 
+    None
+    """
+    # Open input file and perform grouping
+    try:
+        # Iterate over Ig records and order by junction length
+        records = {}
+        db_iter = readDbFile(db_file)
+        for rec in db_iter:
+            records[rec.id] = rec
+        records = OrderedDict(sorted(list(records.items()), key=lambda i: i[1].junction_length))
+        dist_dict = {}
+        for __ in range(len(records)):
+            k,v = records.popitem(last=False)
+            dist_dict[k] = [v].append(list(records.values()))
+    except:
+        #sys.stderr.write('Exception in feeder grouping step\n')
+        alive.value = False
+        raise
+    
+    # Add groups to data queue
+    try:
+        # print 'START FEED', alive.value
+        # Iterate over groups and feed data queue
+        dist_iter = iter(dist_dict.items())
+        while alive.value:
+            # Get data from queue
+            if data_queue.full():  continue
+            else:  data = next(dist_iter, None)
+            # Exit upon reaching end of iterator
+            if data is None:  break
+            #print "FEED", alive.value, k
+            
+            # Feed queue
+            data_queue.put(DbData(*data))
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in feeder queue feeding step\n')
+        alive.value = False
+        raise
+
+    return None
+
+
+def processQueue(alive, data_queue, result_queue, clone_func, clone_args):
+    """
+    Pulls from data queue, performs calculations, and feeds results queue
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue holding data to process
+    result_queue = a multiprocessing.Queue to hold processed results
+    clone_func = the function to call for clonal assignment
+    clone_args = a dictionary of arguments to pass to clone_func
+
+    Returns: 
+    None
+    """
+    try:
+        # Iterator over data queue until sentinel object reached
+        while alive.value:
+            # Get data from queue
+            if data_queue.empty():  continue
+            else:  data = data_queue.get()
+            # Exit upon reaching sentinel
+            if data is None:  break
+
+            # Define result object for iteration and get data records
+            records = data.data
+            result = DbResult(data.id, records)
+
+            # Check for invalid data (due to failed indexing) and add failed result
+            if not data:
+                result_queue.put(result)
+                continue
+
+            # Add V(D)J to log
+            result.log['ID'] = ','.join([str(x) for x in data.id])
+            result.log['VALLELE'] = ','.join(set([(r.getVAllele() or '') for r in records]))
+            result.log['DALLELE'] = ','.join(set([(r.getDAllele() or '') for r in records]))
+            result.log['JALLELE'] = ','.join(set([(r.getJAllele() or '') for r in records]))
+            result.log['JUNCLEN'] = ','.join(set([(str(len(r.junction)) or '0') for r in records]))
+            result.log['SEQUENCES'] = len(records)
+             
+            # Checking for preclone failure and assign clones
+            clones = clone_func(records, **clone_args) if data else None
+
+            # import cProfile
+            # prof = cProfile.Profile()
+            # clones = prof.runcall(clone_func, records, **clone_args)
+            # prof.dump_stats('worker-%d.prof' % os.getpid())
+
+            if clones is not None:
+                result.results = clones
+                result.valid = True
+                result.log['CLONES'] = len(clones)
+            else:
+                result.log['CLONES'] = 0
+  
+            # Feed results to result queue
+            result_queue.put(result)
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in worker\n')
+        alive.value = False
+        raise
+    
+    return None
+
+
+def processQueueClust(alive, data_queue, result_queue, clone_func, clone_args):
+    """
+    Pulls from data queue, performs calculations, and feeds results queue
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue holding data to process
+    result_queue = a multiprocessing.Queue to hold processed results
+    clone_func = the function to call for calculating pairwise distances between sequences
+    clone_args = a dictionary of arguments to pass to clone_func
+
+    Returns: 
+    None
+    """
+    
+    try:
+        # print 'START WORK', alive.value
+        # Iterator over data queue until sentinel object reached
+        while alive.value:
+            # Get data from queue
+            if data_queue.empty():  continue
+            else:  data = data_queue.get()
+            # Exit upon reaching sentinel
+            if data is None:  break
+            # print "WORK", alive.value, data['id']
+
+            # Define result object for iteration and get data records
+            records = data.data
+            result = DbResult(data.id, records)
+             
+            # Create row of distance matrix and check for error
+            dist_row = clone_func(records, **clone_args) if data else None
+            if dist_row is not None:
+                result.results = dist_row
+                result.valid = True
+  
+            # Feed results to result queue
+            result_queue.put(result)
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in worker\n')
+        alive.value = False
+        raise
+    
+    return None
+
+
+def collectQueue(alive, result_queue, collect_queue, db_file, out_args, cluster_func=None, cluster_args={}):
+    """
+    Assembles results from a queue of individual sequence results and manages log/file I/O
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    result_queue = a multiprocessing.Queue holding processQueue results
+    collect_queue = a multiprocessing.Queue to store collector return values
+    db_file = the input database file name
+    out_args = common output argument dictionary from parseCommonArgs
+    cluster_func = the function to call for carrying out clustering on distance matrix
+    cluster_args = a dictionary of arguments to pass to cluster_func
+    
+    Returns: 
+    None
+    (adds 'log' and 'out_files' to collect_dict)
+    """
+    # Open output files
+    try:
+        # Count records and define output format 
+        out_type = getFileType(db_file) if out_args['out_type'] is None \
+                   else out_args['out_type']
+        result_count = countDbFile(db_file)
+        
+        # Defined successful output handle
+        pass_handle = getOutputHandle(db_file, 
+                                      out_label='clone-pass', 
+                                      out_dir=out_args['out_dir'], 
+                                      out_name=out_args['out_name'], 
+                                      out_type=out_type)
+        pass_writer = getDbWriter(pass_handle, db_file, add_fields='CLONE')
+        
+        # Defined failed alignment output handle
+        if out_args['failed']:
+            fail_handle = getOutputHandle(db_file,
+                                          out_label='clone-fail', 
+                                          out_dir=out_args['out_dir'], 
+                                          out_name=out_args['out_name'], 
+                                          out_type=out_type)
+            fail_writer = getDbWriter(fail_handle, db_file)
+        else:
+            fail_handle = None
+            fail_writer = None
+
+        # Define log handle
+        if out_args['log_file'] is None:  
+            log_handle = None
+        else:  
+            log_handle = open(out_args['log_file'], 'w')
+    except:
+        #sys.stderr.write('Exception in collector file opening step\n')
+        alive.value = False
+        raise
+
+    # Get results from queue and write to files
+    try:
+        #print 'START COLLECT', alive.value
+        # Iterator over results queue until sentinel object reached
+        start_time = time()
+        rec_count = clone_count = pass_count = fail_count = 0
+        while alive.value:
+            # Get result from queue
+            if result_queue.empty():  continue
+            else:  result = result_queue.get()
+            # Exit upon reaching sentinel
+            if result is None:  break
+            #print "COLLECT", alive.value, result['id']
+            
+            # Print progress for previous iteration and update record count
+            if rec_count == 0:
+                print('PROGRESS> Assigning clones')
+            printProgress(rec_count, result_count, 0.05, start_time) 
+            rec_count += len(result.data)
+            
+            # Write passed and failed records
+            if result:
+                for clone in result.results.values():
+                    clone_count += 1
+                    for i, rec in enumerate(clone):
+                        rec.annotations['CLONE'] = clone_count
+                        pass_writer.writerow(rec.toDict())
+                        pass_count += 1
+                        result.log['CLONE%i-%i' % (clone_count, i + 1)] = str(rec.junction)
+    
+            else:
+                for i, rec in enumerate(result.data):
+                    if fail_writer is not None: fail_writer.writerow(rec.toDict())
+                    fail_count += 1
+                    result.log['CLONE0-%i' % (i + 1)] = str(rec.junction)
+                    
+            # Write log
+            printLog(result.log, handle=log_handle)
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+        
+        # Print total counts
+        printProgress(rec_count, result_count, 0.05, start_time)
+
+        # Close file handles
+        pass_handle.close()
+        if fail_handle is not None:  fail_handle.close()
+        if log_handle is not None:  log_handle.close()
+                
+        # Update return list
+        log = OrderedDict()
+        log['OUTPUT'] = os.path.basename(pass_handle.name)
+        log['CLONES'] = clone_count
+        log['RECORDS'] = rec_count
+        log['PASS'] = pass_count
+        log['FAIL'] = fail_count
+        collect_dict = {'log':log, 'out_files': [pass_handle.name]}
+        collect_queue.put(collect_dict)
+    except:
+        #sys.stderr.write('Exception in collector result processing step\n')
+        alive.value = False
+        raise
+
+    return None
+
+
+def collectQueueClust(alive, result_queue, collect_queue, db_file, out_args, cluster_func, cluster_args):
+    """
+    Assembles results from a queue of individual sequence results and manages log/file I/O
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    result_queue = a multiprocessing.Queue holding processQueue results
+    collect_queue = a multiprocessing.Queue to store collector return values
+    db_file = the input database file name
+    out_args = common output argument dictionary from parseCommonArgs
+    cluster_func = the function to call for carrying out clustering on distance matrix
+    cluster_args = a dictionary of arguments to pass to cluster_func
+    
+    Returns: 
+    None
+    (adds 'log' and 'out_files' to collect_dict)
+    """
+    # Open output files
+    try:
+               
+        # Iterate over Ig records to count and order by junction length
+        result_count = 0
+        records = {}
+        # print 'Reading file...'
+        db_iter = readDbFile(db_file)
+        for rec in db_iter:
+            records[rec.id] = rec
+            result_count += 1
+        records = OrderedDict(sorted(list(records.items()), key=lambda i: i[1].junction_length))
+                
+        # Define empty matrix to store assembled results
+        dist_mat = np.zeros((result_count,result_count))
+        
+        # Count records and define output format 
+        out_type = getFileType(db_file) if out_args['out_type'] is None \
+                   else out_args['out_type']
+                   
+        # Defined successful output handle
+        pass_handle = getOutputHandle(db_file, 
+                                      out_label='clone-pass', 
+                                      out_dir=out_args['out_dir'], 
+                                      out_name=out_args['out_name'], 
+                                      out_type=out_type)
+        pass_writer = getDbWriter(pass_handle, db_file, add_fields='CLONE')
+        
+        # Defined failed cloning output handle
+        if out_args['failed']:
+            fail_handle = getOutputHandle(db_file,
+                                          out_label='clone-fail', 
+                                          out_dir=out_args['out_dir'], 
+                                          out_name=out_args['out_name'], 
+                                          out_type=out_type)
+            fail_writer = getDbWriter(fail_handle, db_file)
+        else:
+            fail_handle = None
+            fail_writer = None
+
+        # Open log file
+        if out_args['log_file'] is None:
+            log_handle = None
+        else:
+            log_handle = open(out_args['log_file'], 'w')
+    except:
+        alive.value = False
+        raise
+    
+    try:
+        # Iterator over results queue until sentinel object reached
+        start_time = time()
+        row_count = rec_count = 0
+        while alive.value:
+            # Get result from queue
+            if result_queue.empty():  continue
+            else:  result = result_queue.get()
+            # Exit upon reaching sentinel
+            if result is None:  break
+
+            # Print progress for previous iteration
+            if row_count == 0:
+                print('PROGRESS> Assigning clones')
+            printProgress(row_count, result_count, 0.05, start_time)
+            
+            # Update counts for iteration
+            row_count += 1
+            rec_count += len(result)
+            
+            # Add result row to distance matrix
+            if result:
+                dist_mat[list(range(result_count-len(result),result_count)),result_count-len(result)] = result.results
+                
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None    
+        
+        # Calculate linkage and carry out clustering
+        # print dist_mat
+        clusters = cluster_func(dist_mat, **cluster_args) if dist_mat is not None else None
+        clones = {}
+        # print clusters
+        for i, c in enumerate(clusters):
+            clones.setdefault(c, []).append(records[list(records.keys())[i]])
+        
+        # Write passed and failed records
+        clone_count = pass_count = fail_count = 0
+        if clones:
+            for clone in clones.values():
+                clone_count += 1
+                for i, rec in enumerate(clone):
+                    rec.annotations['CLONE'] = clone_count
+                    pass_writer.writerow(rec.toDict())
+                    pass_count += 1
+                    #result.log['CLONE%i-%i' % (clone_count, i + 1)] = str(rec.junction)
+
+        else:
+            for i, rec in enumerate(result.data):
+                fail_writer.writerow(rec.toDict())
+                fail_count += 1
+                #result.log['CLONE0-%i' % (i + 1)] = str(rec.junction)
+        
+        # Print final progress
+        printProgress(row_count, result_count, 0.05, start_time)
+    
+        # Close file handles
+        pass_handle.close()
+        if fail_handle is not None:  fail_handle.close()
+        if log_handle is not None:  log_handle.close()
+                
+        # Update return list
+        log = OrderedDict()
+        log['OUTPUT'] = os.path.basename(pass_handle.name)
+        log['CLONES'] = clone_count
+        log['RECORDS'] = rec_count
+        log['PASS'] = pass_count
+        log['FAIL'] = fail_count
+        collect_dict = {'log':log, 'out_files': [pass_handle.name]}
+        collect_queue.put(collect_dict)
+    except:
+        alive.value = False
+        raise
+    
+    return None
+
+
+def defineClones(db_file, feed_func, work_func, collect_func, clone_func, cluster_func=None,
+                 group_func=None, group_args={}, clone_args={}, cluster_args={}, 
+                 out_args=default_out_args, nproc=None, queue_size=None):
+    """
+    Define clonally related sequences
+    
+    Arguments:
+    db_file = filename of input database
+    feed_func = the function that feeds the queue
+    work_func = the worker function that will run on each CPU
+    collect_func = the function that collects results from the workers
+    group_func = the function to use for assigning preclones
+    clone_func = the function to use for determining clones within preclonal groups
+    group_args = a dictionary of arguments to pass to group_func
+    clone_args = a dictionary of arguments to pass to clone_func
+    out_args = common output argument dictionary from parseCommonArgs
+    nproc = the number of processQueue processes;
+            if None defaults to the number of CPUs
+    queue_size = maximum size of the argument queue;
+                 if None defaults to 2*nproc    
+    
+    Returns:
+    a list of successful output file names
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'DefineClones'
+    log['DB_FILE'] = os.path.basename(db_file)
+    if group_func is not None:
+        log['GROUP_FUNC'] = group_func.__name__
+        log['GROUP_ARGS'] = group_args
+    log['CLONE_FUNC'] = clone_func.__name__
+
+    # TODO:  this is yucky, but can be fixed by using a model class
+    clone_log = clone_args.copy()
+    if 'dist_mat' in clone_log:  del clone_log['dist_mat']
+    log['CLONE_ARGS'] = clone_log
+
+    if cluster_func is not None:
+        log['CLUSTER_FUNC'] = cluster_func.__name__
+        log['CLUSTER_ARGS'] = cluster_args
+    log['NPROC'] = nproc
+    printLog(log)
+    
+    # Define feeder function and arguments
+    feed_args = {'db_file': db_file,
+                 'group_func': group_func, 
+                 'group_args': group_args}
+    # Define worker function and arguments
+    work_args = {'clone_func': clone_func, 
+                 'clone_args': clone_args}
+    # Define collector function and arguments
+    collect_args = {'db_file': db_file,
+                    'out_args': out_args,
+                    'cluster_func': cluster_func,
+                    'cluster_args': cluster_args}
+    
+    # Call process manager
+    result = manageProcesses(feed_func, work_func, collect_func, 
+                             feed_args, work_args, collect_args, 
+                             nproc, queue_size)
+        
+    # Print log
+    result['log']['END'] = 'DefineClones'
+    printLog(result['log'])
+    
+    return result['out_files']
+
+
+def getArgParser():
+    """
+    Defines the ArgumentParser
+
+    Arguments: 
+    None
+                      
+    Returns: 
+    an ArgumentParser object
+    """
+    # Define input and output fields
+    fields = dedent(
+             '''
+             output files:
+                 clone-pass
+                     database with assigned clonal group numbers.
+                 clone-fail
+                     database with records failing clonal grouping.
+
+             required fields:
+                 SEQUENCE_ID, V_CALL or V_CALL_GENOTYPED, D_CALL, J_CALL, JUNCTION_LENGTH
+
+                 <field>
+                     sequence field specified by the --sf parameter
+                
+             output fields:
+                 CLONE
+              ''')
+
+    # Define ArgumentParser
+    parser = ArgumentParser(description=__doc__, epilog=fields,
+                            formatter_class=CommonHelpFormatter)
+    parser.add_argument('--version', action='version',
+                        version='%(prog)s:' + ' %s-%s' %(__version__, __date__))
+    subparsers = parser.add_subparsers(title='subcommands', dest='command', metavar='',
+                                       help='Cloning method')
+    # TODO:  This is a temporary fix for Python issue 9253
+    subparsers.required = True
+    
+    # Parent parser    
+    parser_parent = getCommonArgParser(seq_in=False, seq_out=False, db_in=True, 
+                                       multiproc=True)
+    
+    # Distance cloning method
+    parser_bygroup = subparsers.add_parser('bygroup', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='''Defines clones as having same V assignment,
+                                              J assignment, and junction length with
+                                              specified substitution distance model.''')
+    parser_bygroup.add_argument('-f', nargs='+', action='store', dest='fields', default=None,
+                             help='Additional fields to use for grouping clones (non VDJ)')
+    parser_bygroup.add_argument('--mode', action='store', dest='mode', 
+                             choices=('allele', 'gene'), default='gene', 
+                             help='''Specifies whether to use the V(D)J allele or gene for
+                                  initial grouping.''')
+    parser_bygroup.add_argument('--act', action='store', dest='action', default='set',
+                             choices=('first', 'set'),
+                             help='''Specifies how to handle multiple V(D)J assignments
+                                  for initial grouping.''')
+    parser_bygroup.add_argument('--model', action='store', dest='model', 
+                             choices=('aa', 'ham', 'm1n', 'hs1f', 'hs5f'),
+                             default=default_bygroup_model,
+                             help='''Specifies which substitution model to use for
+                                  calculating distance between sequences. Where m1n is the
+                                  mouse single nucleotide transition/trasversion model
+                                  of Smith et al, 1996; hs1f is the human single
+                                  nucleotide model derived from Yaari et al, 2013; hs5f
+                                  is the human S5F model of Yaari et al, 2013; ham is
+                                  nucleotide Hamming distance; and aa is amino acid
+                                  Hamming distance. The hs5f data should be
+                                  considered experimental.''')
+    parser_bygroup.add_argument('--dist', action='store', dest='distance', type=float, 
+                             default=default_distance,
+                             help='The distance threshold for clonal grouping')
+    parser_bygroup.add_argument('--norm', action='store', dest='norm',
+                             choices=('len', 'mut', 'none'), default=default_norm,
+                             help='''Specifies how to normalize distances. One of none
+                                  (do not normalize), len (normalize by length),
+                                  or mut (normalize by number of mutations between sequences).''')
+    parser_bygroup.add_argument('--sym', action='store', dest='sym',
+                             choices=('avg', 'min'), default=default_sym,
+                             help='''Specifies how to combine asymmetric distances. One of avg
+                                  (average of A->B and B->A) or min (minimum of A->B and B->A).''')
+    parser_bygroup.add_argument('--link', action='store', dest='linkage',
+                             choices=('single', 'average', 'complete'), default=default_linkage,
+                             help='''Type of linkage to use for hierarchical clustering.''')
+    parser_bygroup.add_argument('--sf', action='store', dest='seq_field',
+                                default=default_seq_field,
+                                help='''The name of the field to be used to calculate
+                                     distance between records''')
+    parser_bygroup.set_defaults(feed_func=feedQueue)
+    parser_bygroup.set_defaults(work_func=processQueue)
+    parser_bygroup.set_defaults(collect_func=collectQueue)  
+    parser_bygroup.set_defaults(group_func=indexJunctions)  
+    parser_bygroup.set_defaults(clone_func=distanceClones)
+    
+    
+    # Hierarchical clustering cloning method
+    parser_hclust = subparsers.add_parser('hclust', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='Defines clones by specified distance metric on CDR3s and \
+                                              cutting of hierarchical clustering tree')
+#     parser_hclust.add_argument('-f', nargs='+', action='store', dest='fields', default=None,
+#                              help='Fields to use for grouping clones (non VDJ)')
+    parser_hclust.add_argument('--method', action='store', dest='method', 
+                             choices=('chen2010', 'ademokun2011'), default=default_hclust_model, 
+                             help='Specifies which cloning method to use for calculating distance \
+                                   between CDR3s, computing linkage, and cutting clusters')
+    parser_hclust.set_defaults(feed_func=feedQueueClust)
+    parser_hclust.set_defaults(work_func=processQueueClust)
+    parser_hclust.set_defaults(collect_func=collectQueueClust)
+    parser_hclust.set_defaults(cluster_func=hierClust)
+        
+    return parser
+
+
+if __name__ == '__main__':
+    """
+    Parses command line arguments and calls main function
+    """
+    # Parse arguments
+    parser = getArgParser()
+    args = parser.parse_args()
+    args_dict = parseCommonArgs(args)
+    # Convert case of fields
+    if 'seq_field' in args_dict:
+        args_dict['seq_field'] = args_dict['seq_field'].upper()
+    if 'fields' in args_dict and args_dict['fields'] is not None:  
+        args_dict['fields'] = [f.upper() for f in args_dict['fields']]
+    
+    # Define clone_args
+    if args.command == 'bygroup':
+        args_dict['group_args'] = {'fields': args_dict['fields'],
+                                   'action': args_dict['action'], 
+                                   'mode':args_dict['mode']}
+        args_dict['clone_args'] = {'model':  args_dict['model'],
+                                   'distance':  args_dict['distance'],
+                                   'norm': args_dict['norm'],
+                                   'sym': args_dict['sym'],
+                                   'linkage': args_dict['linkage'],
+                                   'seq_field': args_dict['seq_field']}
+
+        # TODO:  can be cleaned up with abstract model class
+        args_dict['clone_args']['dist_mat'] = getModelMatrix(args_dict['model'])
+
+        del args_dict['fields']
+        del args_dict['action']
+        del args_dict['mode']
+        del args_dict['model']
+        del args_dict['distance']
+        del args_dict['norm']
+        del args_dict['sym']
+        del args_dict['linkage']
+        del args_dict['seq_field']
+
+    # Define clone_args
+    if args.command == 'hclust':
+        dist_funcs = {'chen2010':distChen2010, 'ademokun2011':distAdemokun2011}
+        args_dict['clone_func'] = dist_funcs[args_dict['method']]
+        args_dict['cluster_args'] = {'method':  args_dict['method']}
+        #del args_dict['fields']
+        del args_dict['method']
+    
+    # Call defineClones
+    del args_dict['command']
+    del args_dict['db_files']
+    for f in args.__dict__['db_files']:
+        args_dict['db_file'] = f
+        defineClones(**args_dict)
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/IMGT_Human_IGHD.fasta	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,89 @@
+>X97051|IGHD1-1*01|Homo_sapiens|F|D-REGION|33714..33730|17 nt|1| | | | |17+0=17| | |
+ggtacaactggaacgac
+>X13972|IGHD1-14*01|Homo_sapiens|ORF|D-REGION|14518..14534|17 nt|1| | | | |17+0=17| | |
+ggtataaccggaaccac
+>X97051|IGHD1-20*01|Homo_sapiens|F|D-REGION|62015..62031|17 nt|1| | | | |17+0=17| | |
+ggtataactggaacgac
+>X97051|IGHD1-26*01|Homo_sapiens|F|D-REGION|72169..72188|20 nt|1| | | | |20+0=20| | |
+ggtatagtgggagctactac
+>X13972|IGHD1-7*01|Homo_sapiens|F|D-REGION|5266..5282|17 nt|1| | | | |17+0=17| | |
+ggtataactggaactac
+>X55575|IGHD1/OR15-1a*01|Homo_sapiens|ORF|D-REGION|63..79|17 nt|1| | | | |17+0=17| | |
+ggtataactggaacaac
+>X55576|IGHD1/OR15-1b*01|Homo_sapiens|ORF|D-REGION|63..79|17 nt|1| | | | |17+0=17| | |
+ggtataactggaacaac
+>J00234|IGHD2-15*01|Homo_sapiens|F|D-REGION|29..59|31 nt|1| | | | |31+0=31| | |
+aggatattgtagtggtggtagctgctactcc
+>J00232|IGHD2-2*01|Homo_sapiens|F|D-REGION|29..59|31 nt|1| | | | |31+0=31| | |
+aggatattgtagtagtaccagctgctatgcc
+>X97051|IGHD2-2*02|Homo_sapiens|F|D-REGION|36367..36397|31 nt|1| | | | |31+0=31| | |
+aggatattgtagtagtaccagctgctatacc
+>M35648|IGHD2-2*03|Homo_sapiens|F|D-REGION|70..100|31 nt|1| | | | |31+0=31| | |
+tggatattgtagtagtaccagctgctatgcc
+>J00235|IGHD2-21*01|Homo_sapiens|F|D-REGION|29..56|28 nt|1| | | | |28+0=28| | |
+agcatattgtggtggtgattgctattcc
+>X97051|IGHD2-21*02|Homo_sapiens|F|D-REGION|64644..64671|28 nt|1| | | | |28+0=28| | |
+agcatattgtggtggtgactgctattcc
+>X13972|IGHD2-8*01|Homo_sapiens|F|D-REGION|7949..7979|31 nt|1| | | | |31+0=31| | |
+aggatattgtactaatggtgtatgctatacc
+>J00233|IGHD2-8*02|Homo_sapiens|F|D-REGION|29..59|31 nt|1| | | | |31+0=31| | |
+aggatattgtactggtggtgtatgctatacc
+>X55577|IGHD2/OR15-2a*01|Homo_sapiens|ORF|D-REGION|68..98|31 nt|1| | | | |31+0=31| | |
+agaatattgtaatagtactactttctatgcc
+>X55578|IGHD2/OR15-2b*01|Homo_sapiens|ORF|D-REGION|68..98|31 nt|1| | | | |31+0=31| | |
+agaatattgtaatagtactactttctatgcc
+>X13972|IGHD3-10*01|Homo_sapiens|F|D-REGION|10659..10689|31 nt|1| | | | |31+0=31| | |
+gtattactatggttcggggagttattataac
+>X93615|IGHD3-10*02|Homo_sapiens|F|D-REGION|30..59|30 nt|1| | | | |30+0=30| | |
+gtattactatgttcggggagttattataac
+>X93614|IGHD3-16*01|Homo_sapiens|F|D-REGION|30..66|37 nt|1| | | | |37+0=37| | |
+gtattatgattacgtttgggggagttatgcttatacc
+>X97051|IGHD3-16*02|Homo_sapiens|F|D-REGION|57552..57588|37 nt|1| | | | |37+0=37| | |
+gtattatgattacgtttgggggagttatcgttatacc
+>X93616|IGHD3-22*01|Homo_sapiens|F|D-REGION|30..60|31 nt|1| | | | |31+0=31| | |
+gtattactatgatagtagtggttattactac
+>X13972|IGHD3-3*01|Homo_sapiens|F|D-REGION|804..834|31 nt|1| | | | |31+0=31| | |
+gtattacgatttttggagtggttattatacc
+>X93618|IGHD3-3*02|Homo_sapiens|F|D-REGION|30..60|31 nt|1| | | | |31+0=31| | |
+gtattagcatttttggagtggttattatacc
+>X13972|IGHD3-9*01|Homo_sapiens|F|D-REGION|10475..10505|31 nt|1| | | | |31+0=31| | |
+gtattacgatattttgactggttattataac
+>X55579|IGHD3/OR15-3a*01|Homo_sapiens|ORF|D-REGION|210..240|31 nt|1| | | | |31+0=31| | |
+gtattatgatttttggactggttattatacc
+>X55580|IGHD3/OR15-3b*01|Homo_sapiens|ORF|D-REGION|210..240|31 nt|1| | | | |31+0=31| | |
+gtattatgatttttggactggttattatacc
+>X13972|IGHD4-11*01|Homo_sapiens|ORF|D-REGION|11550..11565|16 nt|1| | | | |16+0=16| | |
+tgactacagtaactac
+>X97051|IGHD4-17*01|Homo_sapiens|F|D-REGION|58699..58714|16 nt|1| | | | |16+0=16| | |
+tgactacggtgactac
+>X97051|IGHD4-23*01|Homo_sapiens|ORF|D-REGION|68334..68352|19 nt|1| | | | |19+0=19| | |
+tgactacggtggtaactcc
+>X13972|IGHD4-4*01|Homo_sapiens|F|D-REGION|1952..1967|16 nt|1| | | | |16+0=16| | |
+tgactacagtaactac
+>X55581|IGHD4/OR15-4a*01|Homo_sapiens|ORF|D-REGION|83..101|19 nt|1| | | | |19+0=19| | |
+tgactatggtgctaactac
+>X55582|IGHD4/OR15-4b*01|Homo_sapiens|ORF|D-REGION|82..100|19 nt|1| | | | |19+0=19| | |
+tgactatggtgctaactac
+>X13972|IGHD5-12*01|Homo_sapiens|F|D-REGION|12506..12528|23 nt|1| | | | |23+0=23| | |
+gtggatatagtggctacgattac
+>X97051|IGHD5-18*01|Homo_sapiens|F|D-REGION|59661..59680|20 nt|1| | | | |20+0=20| | |
+gtggatacagctatggttac
+>X97051|IGHD5-24*01|Homo_sapiens|ORF|D-REGION|69300..69319|20 nt|1| | | | |20+0=20| | |
+gtagagatggctacaattac
+>X13972|IGHD5-5*01|Homo_sapiens|F|D-REGION|2913..2932|20 nt|1| | | | |20+0=20| | |
+gtggatacagctatggttac
+>X55583|IGHD5/OR15-5a*01|Homo_sapiens|ORF|D-REGION|94..116|23 nt|1| | | | |23+0=23| | |
+gtggatatagtgtctacgattac
+>X55584|IGHD5/OR15-5b*01|Homo_sapiens|ORF|D-REGION|94..116|23 nt|1| | | | |23+0=23| | |
+gtggatatagtgtctacgattac
+>X13972|IGHD6-13*01|Homo_sapiens|F|D-REGION|14011..14031|21 nt|1| | | | |21+0=21| | |
+gggtatagcagcagctggtac
+>X97051|IGHD6-19*01|Homo_sapiens|F|D-REGION|61503..61523|21 nt|1| | | | |21+0=21| | |
+gggtatagcagtggctggtac
+>X97051|IGHD6-25*01|Homo_sapiens|F|D-REGION|71666..71683|18 nt|1| | | | |18+0=18| | |
+gggtatagcagcggctac
+>X13972|IGHD6-6*01|Homo_sapiens|F|D-REGION|4762..4779|18 nt|1| | | | |18+0=18| | |
+gagtatagcagctcgtcc
+>J00256|IGHD7-27*01|Homo_sapiens|F|D-REGION|621..631|11 nt|1| | | | |11+0=11| | |
+ctaactgggga
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/IMGT_Human_IGHJ.fasta	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,31 @@
+>J00256|IGHJ1*01|Homo_sapiens|F|J-REGION|723..774|52 nt|1| | | | |52+0=52| | |
+gctgaatacttccagcactggggccagggcaccctggtcaccgtctcctcag
+>J00256|IGHJ2*01|Homo_sapiens|F|J-REGION|932..984|53 nt|2| | | | |53+0=53| | |
+ctactggtacttcgatctctggggccgtggcaccctggtcactgtctcctcag
+>J00256|IGHJ3*01|Homo_sapiens|F|J-REGION|1537..1586|50 nt|2| | | | |50+0=50| | |
+tgatgcttttgatgtctggggccaagggacaatggtcaccgtctcttcag
+>X86355|IGHJ3*02|Homo_sapiens|F|J-REGION|1107..1156|50 nt|2| | | | |50+0=50| | |
+tgatgcttttgatatctggggccaagggacaatggtcaccgtctcttcag
+>J00256|IGHJ4*01|Homo_sapiens|F|J-REGION|1912..1959|48 nt|3| | | | |48+0=48| | |
+actactttgactactggggccaaggaaccctggtcaccgtctcctcag
+>X86355|IGHJ4*02|Homo_sapiens|F|J-REGION|1480..1527|48 nt|3| | | | |48+0=48| | |
+actactttgactactggggccagggaaccctggtcaccgtctcctcag
+>M25625|IGHJ4*03|Homo_sapiens|F|J-REGION|446..493|48 nt|3| | | | |48+0=48| | |
+gctactttgactactggggccaagggaccctggtcaccgtctcctcag
+>J00256|IGHJ5*01|Homo_sapiens|F|J-REGION|2354..2404|51 nt|3| | | | |51+0=51| | |
+acaactggttcgactcctggggccaaggaaccctggtcaccgtctcctcag
+>X86355|IGHJ5*02|Homo_sapiens|F|J-REGION|1878..1928|51 nt|3| | | | |51+0=51| | |
+acaactggttcgacccctggggccagggaaccctggtcaccgtctcctcag
+>J00256|IGHJ6*01|Homo_sapiens|F|J-REGION|2947..3009|63 nt|3| | | | |63+0=63| | |
+attactactactactacggtatggacgtctgggggcaagggaccacggtcaccgtctcct
+cag
+>X86355|IGHJ6*02|Homo_sapiens|F|J-REGION|2482..2543|62 nt|3| | | | |62+0=62| | |
+attactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcct
+ca
+>X86356|IGHJ6*03|Homo_sapiens|F|J-REGION|2482..2543|62 nt|3| | | | |62+0=62| | |
+attactactactactactacatggacgtctggggcaaagggaccacggtcaccgtctcct
+ca
+>AJ879487|IGHJ6*04|Homo_sapiens|F|J-REGION|39..101|63 nt|3| | | | |63+0=63| | |
+attactactactactacggtatggacgtctggggcaaagggaccacggtcaccgtctcct
+cag
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/IMGT_Human_IGHV.fasta	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,2442 @@
+>M99641|IGHV1-18*01|Homo_sapiens|F|V-REGION|188..483|296 nt|1| | | | |296+24=320| | |
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctatggtatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac...
+...aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccaca
+gacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggcc
+gtgtattactgtgcgagaga
+>X60503|IGHV1-18*02|Homo_sapiens|F|V-REGION|142..417|276 nt|1| | | | |276+24=300|partial in 3'| |
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctatggtatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac...
+...aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccaca
+gacacatccacgagcacagcctacatggagctgaggagcctaagatctgacgacacggcc
+>HM855463|IGHV1-18*03|Homo_sapiens|F|V-REGION|21..316|296 nt|1| | | | |296+24=320| | |
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctatggtatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac...
+...aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccaca
+gacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacatggcc
+gtgtattactgtgcgagaga
+>KC713938|IGHV1-18*04|Homo_sapiens|F|V-REGION|392..687|296 nt|1| | | | |296+24=320| | |
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctacggtatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac...
+...aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccaca
+gacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggcc
+gtgtattactgtgcgagaga
+>X07448|IGHV1-2*01|Homo_sapiens|F|V-REGION|269..564|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accggctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccagtaccagg
+gacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtc
+gtgtattactgtgcgagaga
+>X62106|IGHV1-2*02|Homo_sapiens|F|V-REGION|163..458|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accggctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccatgaccagg
+gacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggcc
+gtgtattactgtgcgagaga
+>X92208|IGHV1-2*03|Homo_sapiens|F|V-REGION|160..455|296 nt|1| | || |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcttggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accggctactatatgcac
+tgggtgcnacaggcccctggacaagggcttgagtggatgggatggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccatgaccagg
+gacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggcc
+gtgtattactgtgcgagaga
+>KF698733|IGHV1-2*04|Homo_sapiens|F|V-REGION|393..688|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accggctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggctgggtcaccatgaccagg
+gacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggcc
+gtgtattactgtgcgagaga
+>HM855674|IGHV1-2*05|Homo_sapiens|F|V-REGION|24..319|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accggctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccatgaccagg
+gacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtc
+gtgtattactgtgcgagaga
+>M99642|IGHV1-24*01|Homo_sapiens|F|V-REGION|210..505|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtacagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggtttccggatacaccctc............actgaattatccatgcac
+tgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaa...
+...gatggtgaaacaatctacgcacagaagttccag...ggcagagtcaccatgaccgag
+gacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcaacaga
+>X62109|IGHV1-3*01|Homo_sapiens|F|V-REGION|163..458|296 nt|1| | | | |296+24=320| | |
+caggtccagcttgtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgcat
+tgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggc...
+...aatggtaacacaaaatattcacagaagttccag...ggcagagtcaccattaccagg
+gacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggct
+gtgtattactgtgcgagaga
+>X62107|IGHV1-3*02|Homo_sapiens|F|V-REGION|157..452|296 nt|1| | | | |296+24=320| | |
+caggttcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgcat
+tgggtgcgccaggcccccggacaaaggcttgagtggatgggatggagcaacgctggc...
+...aatggtaacacaaaatattcacaggagttccag...ggcagagtcaccattaccagg
+gacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaggacatggct
+gtgtattactgtgcgagaga
+>KF698736|IGHV1-38-4*01|Homo_sapiens|ORF|V-REGION|391..686|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtcttgggct...gaggtgaggaagtctggggcctcagtgaaa
+gtctcctgtagtttttctgggtttaccatc............accagctacggtatacat
+tgggtgcaacagtcccctggacaagggcttgagtggatgggatggatcaaccctggc...
+...aatggtagcccaagctatgccaagaagtttcag...ggcagattcaccatgaccagg
+gacatgtccacaaccacagcctacacagacctgagcagcctgacatctgaggacatggct
+gtgtattactatgcaagaca
+>X92209|IGHV1-45*01|Homo_sapiens|F|V-REGION|144..439|296 nt|1| | || |296+24=320| | |
+cagatgcagctggtgcagtctggggct...gaggtgaagaagactgggtcctcagtgaag
+gtttcctgcaaggcttccggatacaccttc............acctaccgctacctgcac
+tgggtgcgacaggcccccggacaagcgcttgagtggatgggatggatcacacctttc...
+...aatggtaacaccaactacgcacagaaattccag...gacagagtcaccattactagg
+gacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagcc
+atgtattactgtgcaagana
+>AB019438|IGHV1-45*02|Homo_sapiens|F|V-REGION|126317..126612|296 nt|1| | | | |296+24=320| | |
+cagatgcagctggtgcagtctggggct...gaggtgaagaagactgggtcctcagtgaag
+gtttcctgcaaggcttccggatacaccttc............acctaccgctacctgcac
+tgggtgcgacaggcccccggacaagcgcttgagtggatgggatggatcacacctttc...
+...aatggtaacaccaactacgcacagaaattccag...gacagagtcaccattaccagg
+gacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagcc
+atgtattactgtgcaagata
+>Z17391|IGHV1-45*03|Homo_sapiens|F|V-REGION|1..260|260 nt|1| | | | |260+58=318|partial in 5'| |
+.....................................agaagactgggtcctcagtgaag
+gtttcctgcaaggcttccggatacaccttc............acctaccgctacctgcac
+tgggtgcgacaggcccccagacaagcgcttgagtggatgggatggatcacacctttc...
+...aatggtaacaccaactacgcacagaaattccag...gacagagtcaccattaccagg
+gacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagcc
+atgtattactgtgcaaga
+>X92343|IGHV1-46*01|Homo_sapiens|F|V-REGION|295..590|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcatctggatacaccttc............accagctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagt...
+...ggtggtagcacaagctacgcacagaagttccag...ggcagagtcaccatgaccagg
+gacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>J00240|IGHV1-46*02|Homo_sapiens|F|V-REGION|402..697|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcatctggatacaccttc............aacagctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagt...
+...ggtggtagcacaagctacgcacagaagttccag...ggcagagtcaccatgaccagg
+gacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>L06612|IGHV1-46*03|Homo_sapiens|F|V-REGION|266..561|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcatctggatacaccttc............accagctactatatgcac
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagt...
+...ggtggtagcacaagctacgcacagaagttccag...ggcagagtcaccatgaccagg
+gacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgctagaga
+>M29809|IGHV1-58*01|Homo_sapiens|F|V-REGION|293..588|296 nt|1| | | | |296+24=320| | |
+caaatgcagctggtgcagtctgggcct...gaggtgaagaagcctgggacctcagtgaag
+gtctcctgcaaggcttctggattcaccttt............actagctctgctgtgcag
+tgggtgcgacaggctcgtggacaacgccttgagtggataggatggatcgtcgttggc...
+...agtggtaacacaaactacgcacagaagttccag...gaaagagtcaccattaccagg
+gacatgtccacaagcacagcctacatggagctgagcagcctgagatccgaggacacggcc
+gtgtattactgtgcggcaga
+>AB019438|IGHV1-58*02|Homo_sapiens|F|V-REGION|10875..11170|296 nt|1| | | | |296+24=320| | |
+caaatgcagctggtgcagtctgggcct...gaggtgaagaagcctgggacctcagtgaag
+gtctcctgcaaggcttctggattcaccttt............actagctctgctatgcag
+tgggtgcgacaggctcgtggacaacgccttgagtggataggatggatcgtcgttggc...
+...agtggtaacacaaactacgcacagaagttccag...gaaagagtcaccattaccagg
+gacatgtccacaagcacagcctacatggagctgagcagcctgagatccgaggacacggcc
+gtgtattactgtgcggcaga
+>AB019437|IGHV1-68*01|Homo_sapiens|P|V-REGION|129383..129678|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggggcagtctgaggct...gaggtaaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttccggatacaccttc............acttgctgctccttgcac
+tggttgcaacaggcccctggacaagggcttgaaaggatgagatggatcacactttac...
+...aatggtaacaccaactatgcaaagaagttccag...ggcagagtcaccattaccagg
+gacatgtccctgaggacagcctacatagagctgagcagcctgagatctgaggactcggct
+gtgtattactgggcaagata
+>L22582|IGHV1-69*01|Homo_sapiens|F|V-REGION|376..671|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z27506|IGHV1-69*02|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtccagctggtgcaatctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatactatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc...
+...cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgaga
+>X92340|IGHV1-69*03|Homo_sapiens|F|V-REGION|133..407|275 nt|1| | | | |275+24=299|partial in 3'| |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgatgacacggc
+>M83132|IGHV1-69*04|Homo_sapiens|F|V-REGION|406..701|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc...
+...cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>X67905|IGHV1-69*05|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccacg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgaga
+>L22583|IGHV1-69*06|Homo_sapiens|F|V-REGION|376..671|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z29978|IGHV1-69*07|Homo_sapiens|F|V-REGION|1..233|233 nt|1| | | | |233+58=291|partial in 5' and in 3' | |
+.....................................agaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgag
+>Z14309|IGHV1-69*08|Homo_sapiens|F|V-REGION|97..392|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcaatctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatactatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc...
+...cttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z14307|IGHV1-69*09|Homo_sapiens|F|V-REGION|97..392|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc...
+...cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z14300|IGHV1-69*10|Homo_sapiens|F|V-REGION|97..392|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z14296|IGHV1-69*11|Homo_sapiens|F|V-REGION|97..392|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc...
+...cttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z14301|IGHV1-69*12|Homo_sapiens|F|V-REGION|97..392|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>Z14214|IGHV1-69*13|Homo_sapiens|(F)|V-REGION|55..350|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>KC713948|IGHV1-69*14|Homo_sapiens|F|V-REGION|394..689|296 nt|1| | | | |296+24=320| | |
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>KF698734|IGHV1-69-2*01|Homo_sapiens|F|V-REGION|393..688|296 nt|1| | | | |296+24=320| | |
+gaggtccagctggtacagtctggggct...gaggtgaagaagcctggggctacagtgaaa
+atctcctgcaaggtttctggatacaccttc............accgactactacatgcac
+tgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaa...
+...gatggtgaaacaatatacgcagagaagttccag...ggcagagtcaccataaccgcg
+gacacgtctacagacacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcaacaga
+>Z29977|IGHV1-69-2*02|Homo_sapiens|F|V-REGION|1..233|233 nt|1| | | | |233+58=291|partial in 5'| |
+.....................................agaagcctggggctacagtgaaa
+atctcctgcaaggtttctggatacaccttc............accgactactacatgcac
+tgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaa...
+...gatggtgaaacaatatatgcagagaagttccag...ggcagagtcaccataaccgcg
+gacacgtctacagacacagcctacatggagctgagcagcctgagatctgag
+>KC713934|IGHV1-69D*01|Homo_sapiens|F|V-REGION|394..689|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaag
+gtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagc
+tgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc...
+...tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcg
+gacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>M99637|IGHV1-8*01|Homo_sapiens|F|V-REGION|201..496|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accagttatgatatcaac
+tgggtgcgacaggccactggacaagggcttgagtggatgggatggatgaaccctaac...
+...agtggtaacacaggctatgcacagaagttccag...ggcagagtcaccatgaccagg
+aacacctccataagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagagg
+>HM855457|IGHV1-8*02|Homo_sapiens|F|V-REGION|24..319|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accagctatgatatcaac
+tgggtgcgacaggccactggacaagggcttgagtggatgggatggatgaaccctaac...
+...agtggtaacacaggctatgcacagaagttccag...ggcagagtcaccatgaccagg
+aacacctccataagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagagg
+>M13911|IGHV1-NL1*01|Homo_sapiens|P|V-REGION|125..420|296 nt|1| | | | |296+24=320| | |
+caggttcagctgttgcagcctggggtc...caggtgaagaagcctgggtcctcagtgaag
+gtctcctgctaggcttccagatacaccttc............accaaatactttacacgg
+tgggtgtgacaaagccctggacaagggcatnagtggatgggatgaatcaacccttac...
+...aacgataacacacactacgcacagacgttctgg...ggcagagtcaccattaccagt
+gacaggtccatgagcacagcctacatggagctgagcngcctgagatccgaagacatggtc
+gtgtattactgtgtgagaga
+>Z29631|IGHV1/OR15-1*01|Homo_sapiens|ORF|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacatcttc............accgactactatatgcac
+tgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagg
+gacacgtccatcagcacagcctacacggagctgagcagcctgagatctgaggacacggcc
+acgtattactgtgcgaga
+>AJ004954|IGHV1/OR15-1*02|Homo_sapiens|ORF|V-REGION|25..320|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacatcttc............accgactactatatgcac
+tgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagg
+gacacgtccatcagcacagcctgcacggagctgagcagcctgagatctgaggacacggcc
+acgtattactgtgcgagaga
+>HM855589|IGHV1/OR15-1*03|Homo_sapiens|ORF|V-REGION|23..318|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacatcttc............accgactactatatgcac
+tgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagg
+gacacgtccatcagcacagcctacacggagctgagcagcctgagatctgaggacacagcc
+acgtattactgtgcgagaga
+>HM855394|IGHV1/OR15-1*04|Homo_sapiens|ORF|V-REGION|24..319|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacatcttc............accgactactatatgcac
+tgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac...
+...agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagg
+gacacgtccatcagcacagcctacatggagctgagcagcctgagatctgaggacacggcc
+acgtattactgtgcgagaga
+>L25543|IGHV1/OR15-2*01|Homo_sapiens|P|V-REGION|229..524|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggagct...gaggtgaagaagcctagagcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctactatatgcac
+tgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttac...
+...aatggtaacacaaactacccacagaagctccag...ggcagagtcaccatgaccaga
+gacacatccacgagcacagcctacatggagctgagcaggctgagatctgacgacatggcc
+gtgtattactgtgcgagaga
+>HM855297|IGHV1/OR15-2*02|Homo_sapiens|P|V-REGION|24..319|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggagct...gaggtgaagaagcctggagcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctactatatgcac
+tgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttac...
+...aatggtaacacaaactacccacagaagctccag...ggcagagtcaccatgaccaga
+gacacatccacgagcacagcctacatggagctgagcagcctgagatctgacgacatggcc
+gtgtattactgtgcgagaga
+>HM855556|IGHV1/OR15-2*03|Homo_sapiens|P|V-REGION|20..315|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggagct...gaggtgaagaagcctagagcctcagtgaag
+gtctcctgcaaggcttctggttacaccttt............accagctactatatgcac
+tgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttac...
+...aatggtaacacaaactacccacagaagctccag...ggcagagtcaccatgaccaga
+gacacatccacgagcacagcctacatggagctgagcagcctgagatctgacgacatggcc
+gtgtattactgtgcgagaga
+>Z29595|IGHV1/OR15-3*01|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtccaactggtgtagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accgactactttatgaac
+tggatgcgccaggcccctggacaaaggcttgagtggatgggatggatcaacgctggc...
+...aatggtaacacaaaatattcacagaagctccag...ggcagagtcaccattaccagg
+gacacatcttcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgaga
+>HM855458|IGHV1/OR15-3*02|Homo_sapiens|P|V-REGION|21..316|296 nt|1| | | | |296+24=320| | |
+caggtccaactggtgtagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accgactactttatgaac
+tggatgcgccaggcccctggacaaaggcttgagtggatgggatggatcaacgctggc...
+...aatggtaacacaaaatattcacagaagctccag...ggcagagtcaccattaccagg
+gacacatctgcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgagaga
+>J00238|IGHV1/OR15-3*03|Homo_sapiens|P|V-REGION|375..668|294 nt|1| | | | |294+24=318| | |
+caggtccaactggtgtagtctggagct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accagctactatatgaac
+tggatgcgccaggcccctggacaaggcttcgagtggatgggatggatcaacgctggc...
+...aatggtaacacaaagtattcacagaagctccag...ggcagagtcaccattaccagg
+gacacatctgcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgaga
+>Z29596|IGHV1/OR15-4*01|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggaccagttggtgcagtctggggct...gaggtgaagaagcctctgtcctcagtgaag
+gtctccttcaaggcttctggatacaccttc............accaacaactttatgcac
+tgggtgtgacaggcccctggacaaggacttgagtggatgggatggatcaatgctggc...
+...aatggtaacacaacatatgcacagaagttccag...ggcagagtcaccataaccagg
+gacacgtccatgagcacagcctacacggagctgagcagcctgagatctgaggacacggcc
+gtgtattactgtgcgaga
+>Z29633|IGHV1/OR15-5*01|Homo_sapiens|ORF|V-REGION|1..260|260 nt|1| | | | |260+58=318|partial in 5'| |
+.....................................agaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accagctactgtatgcac
+tgggtgcaccaggtccatgcacaagggcttgagtggatgggattggtgtgccctagt...
+...gatggcagcacaagctatgcacagaagttccag...gccagagtcaccataaccagg
+gacacatccatgagcacagcctacatggagctaagcagtctgagatctgaggacacggcc
+atgtattactgtgtgaga
+>Z12314|IGHV1/OR15-5*02|Homo_sapiens|ORF|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtacagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccttc............accaactactgtatgcac
+tgggtgcgccaggtccatgcacaagggcttgagtggatgggattggtgtgccctagt...
+...gatggcagcacaagctatgcacaaaagttccag...gccagagtcaccataaccagg
+gacacatccatgagcacagcctacatggagctaagcagtctgagatctgaggacacggcc
+atgtattactgtgtgaga
+>L25542|IGHV1/OR15-9*01|Homo_sapiens|ORF|V-REGION|188..483|296 nt|1| | | | |296+24=320| | |
+caggtacagctgatgcagtctggggct...gaggtgaagaagcctggggcctcagtgagg
+atctcctgcaaggcttctggatacaccttc............accagctactgtatgcac
+tgggtgtgccaggcccatgcacaagggcttgagtggatgggattggtgtgccctagt...
+...gatggcagcacaagctatgcacagaagttccag...ggcagagtcaccataaccagg
+gacacatccatgggcacagcctacatggagctaagcagcctgagatctgaggacacggcc
+atgtattactgtgtgagaga
+>AF254982|IGHV1/OR21-1*01|Homo_sapiens|ORF|V-REGION|164866..165161|296 nt|1| | | | |296+24=320| | |
+caggtacagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctgcaaggcttctggatacaccatc............accagctactgtatgcac
+tgggtgcaccaggtccatgcacaagggcttgagtggatgggattggtgtgccctagt...
+...gatggcagcacaagctatgcacagaagttccag...gccagagtcaccataaccagg
+gacacatccatgagcacagcctacatggagctaagcagtctgagatctgaggacacggcc
+atgtattactgtgtgagaga
+>M99647|IGHV2-10*01|Homo_sapiens|P|V-REGION|211..511|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gcactggtgaaacccacacagaccctcatg
+ctgacctgcaccttctctgggttctcactcagc......acttctggaatgggtgtgggt
+tagatctgtcagccctcagcaaaggccctggagtggcttgcacacatttattagaat...
+......gataataaatactacagcccatctctgaag...agtaggctcattatctccaag
+gacacctccaagaatgaagtggttctaacagtgatcaacatggacattgtggacacagcc
+acacattactgtgcaaggagac
+>M99648|IGHV2-26*01|Homo_sapiens|F|V-REGION|164..464|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gtgctggtgaaacccacagagaccctcacg
+ctgacctgcaccgtctctgggttctcactcagc......aatgctagaatgggtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacacattttttcgaat...
+......gacgaaaaatcctacagcacatctctgaag...agcaggctcaccatctccaag
+gacacctccaaaagccaggtggtccttaccatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacggatac
+>X62111|IGHV2-5*01|Homo_sapiens|F|V-REGION|214..514|301 nt|1| | | | |301+21=322| | |
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattggaat...
+......gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacagac
+>KF698731|IGHV2-5*02|Homo_sapiens|F|V-REGION|394..694|301 nt|1| | | | |301+21=322| | |
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat...
+......gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacagac
+>X93619|IGHV2-5*03|Homo_sapiens|F|V-REGION|1..210|210 nt|1| | | | |210+50=260|partial in 5' and in 3' | |
+................................gctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat...
+......gatgataagcgctacagcccatctctgaag...agcaggctcaccattaccaag
+gacacctccaaaaaccaggt
+>L21963|IGHV2-5*04|Homo_sapiens|F|V-REGION|144..438|295 nt|1| | | | |295+21=316| | |
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattggaat...
+......gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacaggc
+acatattactgtgtac
+>L21964|IGHV2-5*05|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat...
+......gatgataagcgctacggcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacagac
+>L21966|IGHV2-5*06|Homo_sapiens|F|V-REGION|143..442|300 nt|1| | | | |300+21=321| | |
+cagatcaccttgaaggagtctggtcct...acgctggtaaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat...
+......gatgataagcgctacggcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacaga
+>L21971|IGHV2-5*08|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat...
+......gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacagac
+>L21972|IGHV2-5*09|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggc
+tggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat...
+......gatgataagcgctacggcccatctctgaag...agcaggctcaccatcaccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacagac
+>L21969|IGHV2-70*01|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattactgtgcacggatac
+>X92241|IGHV2-70*02|Homo_sapiens|F|V-REGION|144..433|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggcc
+gtgtattactg
+>X92238|IGHV2-70*03|Homo_sapiens|F|V-REGION|144..433|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaattctacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggcc
+gtgtattactg
+>Z12330|IGHV2-70*04|Homo_sapiens|F|V-REGION|1..288|288 nt|1| | | | |288+21=309|partial in 3'| |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaattctacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattac
+>Z27502|IGHV2-70*05|Homo_sapiens|F|V-REGION|1..237|237 nt|1| | | | |237+47=284|partial in 5' and in 3' | |
+..........................t...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgcgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaattctacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatgga
+>X92239|IGHV2-70*06|Homo_sapiens|F|V-REGION|144..433|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaattctacagcacatccctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggcc
+gtgtattactg
+>X92243|IGHV2-70*07|Homo_sapiens|F|V-REGION|144..433|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccggggaaggccctggagtggcttgcactcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggcc
+gtgtattactg
+>X92245|IGHV2-70*08|Homo_sapiens|F|V-REGION|144..433|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcgccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggcc
+gtgtattactg
+>L21962|IGHV2-70*09|Homo_sapiens|ORF|V-REGION|144..440|297 nt|1| | | | |297+21=318| | |
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacccgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat...
+......gatgataaatactacagcacatctctgaac...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacaggc
+acatattactgtgtacgg
+>L21965|IGHV2-70*10|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggattgcacgcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattactgtgcacggatac
+>L21967|IGHV2-70*11|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+cgggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattactgtgcacggatac
+>L21970|IGHV2-70*12|Homo_sapiens|F|V-REGION|144..444|301 nt|1| | | | |301+21=322| | |
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacg
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acatattactgtgcacacagac
+>AB019437|IGHV2-70*13|Homo_sapiens|F|V-REGION|110422..110722|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat...
+......gatgataaatactacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattattgtgcacggatac
+>KC713935|IGHV2-70D*04|Homo_sapiens|F|V-REGION|394..694|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaattctacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattactgtgcacggatac
+>KC713949|IGHV2-70D*14|Homo_sapiens|F|V-REGION|394..694|301 nt|1| | | | |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcaca
+ctgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagc
+tggatccgtcagcccccaggtaaggccctggagtggcttgcacgcattgattgggat...
+......gatgataaattctacagcacatctctgaag...accaggctcaccatctccaag
+gacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagcc
+acgtattactgtgcacggatac
+>L25544|IGHV2/OR16-5*01|Homo_sapiens|ORF|V-REGION|170..470|301 nt|1| | || |301+21=322| | |
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacagagaccctcacg
+ctgacctgcactctctctgggttctcactcagc......acttctggaatgggtatgagc
+tggatccgtcagcccccagggaaggccctggagtggcttgctcacatttttttgaat...
+......gacaaaaaatcctacagcacgtctctgaag...aacaggctcatcatctccaag
+gacacctccaaaagccaggtggtccttaccatgaccaacatggaccctgtggacacagcc
+acgtattactgtgcatggagag
+>M99652|IGHV3-11*01|Homo_sapiens|F|V-REGION|202..497|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...ggtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagg
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>X92287|IGHV3-11*03|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtgcagctgttggagtctggggga...ggcttggtcaagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...agtagttacacaaactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgaga
+>HM855329|IGHV3-11*04|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...ggtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagg
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>HM855583|IGHV3-11*05|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...agtagttacacaaactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>KC713940|IGHV3-11*06|Homo_sapiens|F|V-REGION|405..700|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...agtagttacacaaactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>X92217|IGHV3-13*01|Homo_sapiens|F|V-REGION|162..454|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctacgacatgcac
+tgggtccgccaagctacaggaaaaggtctggagtgggtctcagctattggtactgct...
+......ggtgacacatactatccaggctccgtgaag...ggccgattcaccatctccaga
+gaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggct
+gtgtattactgtgcaagaga
+>M99653|IGHV3-13*02|Homo_sapiens|F|V-REGION|467..759|293 nt|1| | | | |293+27=320| | |
+gaggtgcatctggtggagtctggggga...ggcttggtacagcctgggggggccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtaactacgacatgcac
+tgggtccgccaagctacaggaaaaggtctggagtgggtctcagccaatggtactgct...
+......ggtgacacatactatccaggctccgtgaag...gggcgattcaccatctccaga
+gaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggct
+gtgtattactgtgcaagaga
+>U29582|IGHV3-13*03|Homo_sapiens|F|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctgtggattcaccttc............agtagctacgacatgcac
+tgggtccgccaagctacaggaaaaggtctggagtgggtctcagctattggtactgct...
+......ggtgacacatactatccaggctccgtgaag...ggccaattcaccatctccaga
+gaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggct
+gtgtattactgtgcaaga
+>HM855616|IGHV3-13*04|Homo_sapiens|F|V-REGION|22..314|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctacgacatgcac
+tgggtccgccaagctacaggaaaaggtctggaatgggtctcagctattggtactgct...
+......ggtgacacatactatccaggctccgtgaag...ggccgattcaccatctccaga
+gaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggct
+gtgtattactgtgcaagaga
+>KC713939|IGHV3-13*05|Homo_sapiens|F|V-REGION|411..703|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctacgacatgcac
+tgggtccgccaagctacaggaaaaggtctggagtgggtctcagctattggtactgct...
+......ggtgacccatactatccaggctccgtgaag...ggccgattcaccatctccaga
+gaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggct
+gtgtattactgtgcaagaga
+>X92216|IGHV3-15*01|Homo_sapiens|F|V-REGION|162..463|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcactttc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaaact
+gatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99654|IGHV3-15*02|Homo_sapiens|F|V-REGION|176..477|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...gccttggtaaagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcactttc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaaact
+gatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99408|IGHV3-15*03|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctgccgga...gccttggtacagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcacttgc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaagct
+aatggtgggacaacagactacgctgcacctgtgaaa...ggcagattcaccatctcaaga
+gttgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99402|IGHV3-15*04|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcactttc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtattgaaagcaaaact
+gatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99403|IGHV3-15*05|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcactttc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaaact
+gatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgaacagtctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99404|IGHV3-15*06|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcactttc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtcggccgtattaaaagcaaaact
+gatggtgggacaacaaactacgctgcacccgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99406|IGHV3-15*07|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttaga
+ctctcctgtgcagcctctggtttcactttc............agtaacgcctggatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtcggccgtattaaaagcaaaact
+gatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtaccacaga
+>M99400|IGHV3-15*08|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctgcggga...ggcttggtacagcctggggggtcccttaga
+ctctcctgtgcagcctctggattcacttgc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggctgtattaaaagcaaagct
+aatggtgggacaacagactacgctgcacctgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgatcagcctgaaaaccgaggacacggcc
+gtgtattactgtaccacagg
+>M99655|IGHV3-16*01|Homo_sapiens|ORF|V-REGION|188..483|296 nt|1| | | | |296+24=320| | |
+gaggtacaactggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaac
+tgggcccgcaaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat...
+...ggcagtaggacgcactatgtggactccgtgaag...cgccgattcatcatctccaga
+gacaattccaggaactccctgtatctgcaaaagaacagacggagagccgaggacatggct
+gtgtattactgtgtgagaaa
+>AB019440|IGHV3-16*02|Homo_sapiens|ORF|V-REGION| |296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaac
+tgggcccgcaaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat...
+...ggcagtaggacgcactatgtggactccgtgaag...cgccgattcatcatctccaga
+gacaattccaggaactccctgtatctgcaaaagaacagacggagagccgaggacatggct
+gtgtattactgtgtgagaaa
+>M99656|IGHV3-19*01|Homo_sapiens|P|V-REGION|296..591|296 nt|1| | | | |296+24=320| | |
+acagtgcagctggtggagtctggggga...ggcttggtagagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaac
+tgggtccgccaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat...
+...ggcagtaggacgcactatgcagactctgtgaag...ggccgattcatcatctccaga
+gacaattccaggaacttcctgtatcagcaaatgaacagcctgaggcccgaggacatggct
+gtgtattactgtgtgagaaa
+>M99657|IGHV3-20*01|Homo_sapiens|F|V-REGION|170..465|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggtgtggtacggcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............gatgattatggcatgagc
+tgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaat...
+...ggtggtagcacaggttatgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggcc
+ttgtatcactgtgcgagaga
+>KC713937|IGHV3-20*02|Homo_sapiens|ORF|V-REGION|411..706|296 nt|1| | || |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggtgtggtacggcctggggggtccctgaga
+ctctcctttgcagcctctggattcaccttt............gatgattatggcatgagc
+tgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaat...
+...ggtggtagcacaggttatgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggcc
+ttgtatcactgtgcgagaga
+>AB019439|IGHV3-21*01|Homo_sapiens|F|V-REGION|197575..197870|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcctggtcaagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt...
+...agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M99658|IGHV3-21*02|Homo_sapiens|F|V-REGION|169..464|296 nt|1| | | | |296+24=320| | |
+gaggtgcaactggtggagtctggggga...ggcctggtcaagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt...
+...agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>HM855323|IGHV3-21*03|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcctggtcaagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt...
+...agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacagct
+gtgtattactgtgcgagaga
+>HM855688|IGHV3-21*04|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| |rev-compl|
+gaggtgcagctggtggagtctggggga...ggcctggtcaagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt...
+...agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>M99659|IGHV3-22*01|Homo_sapiens|P|V-REGION|245..546|302 nt|1| | | | |302+18=320| | |
+gaggtgcatctggtggagtctggggga...gccttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agttactactacatgagc
+ggggtccgccaggctcccgggaaggggctggaatgggtaggtttcattagaaacaaagct
+aatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaaga
+gatgattccaaaagcatcacctatctgcaaatgaagagcctgaaaaccgaggacacggcc
+gtgtattactgttccagaga
+>AB019439|IGHV3-22*02|Homo_sapiens|P|V-REGION|174880..175181|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agttactactacatgagc
+ggggtccgccaggctcccgggaaggggctggaatgggtaggtttcattagaaacaaagct
+aatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaaga
+gatgattccaaaagcatcacctatctgcaaatgaagagcctgaaaaccgaggacacggcc
+gtgtattactgttccagaga
+>M99660|IGHV3-23*01|Homo_sapiens|F|V-REGION|170..465|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agcagctatgccatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt...
+...ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtatattactgtgcgaaaga
+>M35415|IGHV3-23*02|Homo_sapiens|F|V-REGION|190..485|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agcagctatgccatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt...
+...ggtggtagcacatactacggagactccgtgaag...ggccggttcaccatctcaaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtatattactgtgcgaaaga
+>AM940223|IGHV3-23*03|Homo_sapiens|F|V-REGION|1..296|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agcagctatgccatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+...ggtagtagcacatactatgcagactccgtgaag...ggccggttcaccatctccaga
+gataattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtatattactgtgcgaaaga
+>AJ879486|IGHV3-23*04|Homo_sapiens|F|V-REGION|147..442|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agcagctatgccatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt...
+...ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtatattactgtgcgaaaga
+>AY757302|IGHV3-23*05|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318|partial in 3'| |
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agcagctatgccatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagctatttatagcagt...
+...ggtagtagcacatactatgcagactccgtgaag...ggccggttcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtatattactgtgcgaaa
+>AC244492|IGHV3-23D*01|Homo_sapiens|F|V-REGION|21795..22090|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agcagctatgccatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt...
+...ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtatattactgtgcgaaaga
+>M99661|IGHV3-25*01|Homo_sapiens|P|V-REGION|236..531|296 nt|1| | | | |296+24=320| | |
+gagatgcagctggtggagtctggggga...ggcttgcaaaagcctgcgtggtccccgaga
+ctctcctgtgcagcctctcaattcaccttc............agtagctactacatgaac
+tgtgtccgccaggctccagggaatgggctggagttggtttgacaagttaatcctaat...
+...gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccaga
+gataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggcc
+ctctattagtgtaccagaga
+>AB019439|IGHV3-25*02|Homo_sapiens|P|V-REGION|143626..143921|296 nt|1| | | | |296+24=320| | |
+gagatgcagctggtggagtctggggga...ggcttggcaaagcctgcgtggtccccgaga
+ctctcctgtgcagcctctcaattcaccttc............agtagctactacatgaac
+tgtgtccgccaggctccagggaatgggctggagttggtttgacaagttaatcctaat...
+...gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccaga
+gataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggcc
+ctctattagtgtaccagaga
+>Z12356|IGHV3-25*03|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gagatgcagctggtggagtctggggga...ggcttggcaaagcctgcgtggtccccgaga
+ctctcctgtgcagcctctcaattcaccttc............agtagctactacatgaac
+tgtgtccgccaggctccagggaatgggctggagttggttggacaagttaatcctaat...
+...gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccaga
+gataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggcc
+ctgtattagtgtaccaga
+>HM855898|IGHV3-25*04|Homo_sapiens|ORF|V-REGION|22..317|296 nt|1| | || |296+24=320| | |
+gagacgcagctggtggagtctggggga...ggcttggcaaagcctgggcggtccccgaga
+ctctcctgtgcagcctctcaattcaccttc............agtagctactacatgaac
+tgtgtccgccaggctccagggaatgggctggagttggttggacaagttaatcctaat...
+...gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccaga
+gataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggcc
+ctgtattactgtaccagaga
+>HM855413|IGHV3-25*05|Homo_sapiens|P|V-REGION|22..317|296 nt|1| | | | |296+24=320| |rev-compl|
+gagatgcagctggtggagtctggggga...ggcttggcaaagcctgcgtggtccccgaga
+ctctcctgtgcagcctctcaattcaccttc............agtagctactacatgaac
+tgtgtccgccaggctccagggaatgggctggagttggttggacaagttaatcctaat...
+...gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccaga
+gataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggcc
+ctctattagtgtaccagaga
+>AB019439|IGHV3-29*01|Homo_sapiens|P|V-REGION|101886..102183|298 nt|1| | || |298+24=322| | |
+gaggtggagctgatagagcccacagag...gacctgagacaacctgggaagttcctgaga
+ctctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagc
+ccagttcaccagtctgcaggcaaggggctggagtgagtaatagatataaaagatgat...
+...ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaa
+gacaatgctaagaactctctgtatctgcaaatgaacagtcagagaactgaggacatggct
+gtgtatggctgtacataaggtt
+>M83134|IGHV3-30*01|Homo_sapiens|F|V-REGION|1940..2235|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>L26401|IGHV3-30*02|Homo_sapiens|F|V-REGION|104..399|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctggggggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcatttatacggtatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaaaga
+>M99663|IGHV3-30*03|Homo_sapiens|F|V-REGION|168..463|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>L06615|IGHV3-30*04|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77323|IGHV3-30*05|Homo_sapiens|F|V-REGION|112..406|296 nt|1| | |+1| |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgagggcacggct
+gtgtattactgtgcgagaga
+>L06617|IGHV3-30*06|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>L06614|IGHV3-30*07|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M62737|IGHV3-30*08|Homo_sapiens|F|V-REGION|58..351|294 nt|1| | | | |294+24=318| | |
+caggtgcagctggtggactctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctgcattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaga
+>M77300|IGHV3-30*09|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcgccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77326|IGHV3-30*10|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacacagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77331|IGHV3-30*11|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77338|IGHV3-30*12|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctgggggg...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M77339|IGHV3-30*13|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacaggctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77324|IGHV3-30*14|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77327|IGHV3-30*15|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgagcagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77328|IGHV3-30*16|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggccccaggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77329|IGHV3-30*17|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccgggcaaggggctagagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>X92214|IGHV3-30*18|Homo_sapiens|F|V-REGION|160..455|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaaaga
+>L06616|IGHV3-30*19|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>AB019439|IGHV3-30-2*01|Homo_sapiens|P|V-REGION|88935..89232|298 nt|1| | || |298+24=322| | |
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccctgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaaggaac
+tcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat...
+...ggaagtcagatatgttatgcataatctttgaag...agcaaattcaccatctccaaa
+gaaaatgccaagaactcactgtatttgctaatgaacagtctgagagcagcgggcacagct
+gtgtgttactgtatgtgaggca
+>KC162924|IGHV3-30-22*01|Homo_sapiens|P|V-REGION|41477..41774|298 nt|1| | | | |298+24=322| |rev-compl|
+gaggtggagctgatagagtccatagag...gacctgagacaacctgggaagttcctgaga
+ctctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagc
+cgagttcaccagtctccaggcaaggggctggagtgagtaatagatataaaagatgat...
+...ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaa
+gacaatgctaagaactctctgtatctgcaaatgaacagtcagagagctgaggacatggac
+gtgtatggctgtacataaggtc
+>X92283|IGHV3-30-3*01|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagcaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaga
+>M77302|IGHV3-30-3*02|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagcaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaaaga
+>KC713945|IGHV3-30-3*03|Homo_sapiens|F|V-REGION|409..704|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>AC244456|IGHV3-30-33*01|Homo_sapiens|P|V-REGION|11005..11300|296 nt|1| | | | |296+24=320| |rev-compl|
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccctgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaaggagc
+tcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat...
+...ggaagtcagatatgttatgcataatctttgaag...agcaaattcaccatctccaaa
+gaaaatgccaagaactcactgtatttgctaatgaacagtctgagagcagagggcacagct
+gtgtgttactgtatgtgagg
+>AC244456|IGHV3-30-42*01|Homo_sapiens|P|V-REGION|22749..23046|298 nt|1| | | | |298+24=322| |rev-compl|
+gaggtggagctgatagagcccacagag...gacctgagacaacctgggaagttcctgaga
+ctctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagc
+ccagttcaccagtctgcaggcaaggggctggagtgagtaatagatataaaagatgat...
+...ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaa
+gacaatgctaagaactctctgtatctgcaaatgaacagtcagagaactgaggacatggct
+gtgtatggctgtacataaggtt
+>AC244456|IGHV3-30-5*01|Homo_sapiens|F|V-REGION|26706..27001|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaaaga
+>AC245243|IGHV3-30-5*02|Homo_sapiens|F|V-REGION|3298..3593|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctggggggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcatttatacggtatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaaaga
+>AC244456|IGHV3-30-52*01|Homo_sapiens|P|V-REGION|36011..36306|296 nt|1| | | | |296+24=320| |rev-compl|
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccctgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaaggaac
+tcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat...
+...ggaagtcagatatgttatgcataatctttgaag...agcaaattcaccatctccaaa
+gaaaatgccaagaactcactgtatttgctaatgaacagtctgagagcagcgggcacagct
+gtgtgttactgtatgtgagg
+>AB019439|IGHV3-32*01|Homo_sapiens|P|V-REGION|77173..77470|298 nt|1| | | | |298+24=322| | |
+gaggtggagctgatagagtccatagag...gacctgagacaacctgggaagttcctgaga
+ctctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagc
+cgagttcaccagtctccaggcaaggggctggagtgagtaatagatataaaagatgat...
+...ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaa
+gacaatgctaagaactctctgtatctgcaaatgaacactcagagagctgaggacgtggcc
+gtgtatggctatacataaggtc
+>AB019439|IGHV3-33*01|Homo_sapiens|F|V-REGION|73526..73821|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M99665|IGHV3-33*02|Homo_sapiens|F|V-REGION|179..474|296 nt|1| | | | |296+24=320| | |
+caggtacagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat...
+...ggaagtaataaatactatgcagactccgcgaag...ggccgattcaccatctccaga
+gacaattccacgaacacgctgtttctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M77305|IGHV3-33*03|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaactccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgaaaga
+>M77335|IGHV3-33*04|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatggtatgac...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M77334|IGHV3-33*05|Homo_sapiens|F|V-REGION|41..336|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>HM855436|IGHV3-33*06|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat...
+...ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgaaaga
+>AB019439|IGHV3-33-2*01|Homo_sapiens|P|V-REGION|64215..64512|298 nt|1| | || |298+24=322| | |
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccttgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaatgagc
+tcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat...
+...ggaagtcagatatgttatgcccaatctgtgaag...agcaaattcaccatctccaaa
+gaaaatgccaagaactcactgtatttgcaaatgaacagtctgagagcagagggcacagct
+gtgtgttactgtatgtgaggca
+>M99666|IGHV3-35*01|Homo_sapiens|ORF|V-REGION|298..593|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctgggggatccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaac
+tgggtccatcaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat...
+...ggcagtaggacgcactatgcagactctgtgaag...ggccgattcatcatctccaga
+gacaattccaggaacaccctgtatctgcaaacgaatagcctgagggccgaggacacggct
+gtgtattactgtgtgagaaa
+>M99669|IGHV3-38*01|Homo_sapiens|ORF|V-REGION|169..460|292 nt|1| | | | |292+30=322| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctagggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagc
+tggatccgccaggctccagggaaggggctggagtgggtctcatccattagtggt......
+......ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacaacctgagagctgagggcacggcc
+gcgtattactgtgccagatata
+>AB019439|IGHV3-38*02|Homo_sapiens|ORF|V-REGION|22845..23136|292 nt|1| | | | |292+30=322| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctagggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagc
+tggatccgccaggctccagggaaggggctggagtgggtctcatccattagtggt......
+......ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacaacctgagagctgagggcacggcc
+gtgtattactgtgccagatata
+>KC713943|IGHV3-38*03|Homo_sapiens|ORF|V-REGION|411..702|292 nt|1| | | | |292+30=322| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctagggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagc
+tggatccgccaggctccagggaagggtctggagtgggtctcatccattagtggt......
+......ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacaacctgagagctgagggcacggcc
+gtgtattactgtgccagatata
+>KF698732|IGHV3-38-3*01|Homo_sapiens|ORF|V-REGION|411..700|290 nt|1| | | | |290+30=320| | |
+gaggtgcagctggtggagtctcgggga...gtcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagc
+tgggtccgccaggctccagggaagggtctggagtgggtctcatccattagtggt......
+......ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgcatcttcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtaagaaaga
+>M99672|IGHV3-43*01|Homo_sapiens|F|V-REGION|330..627|298 nt|1| | | | |298+24=322| | |
+gaagtgcagctggtggagtctggggga...gtcgtggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............gatgattataccatgcac
+tgggtccgtcaagctccggggaagggtctggagtgggtctctcttattagttgggat...
+...ggtggtagcacatactatgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacagcaaaaactccctgtatctgcaaatgaacagtctgagaactgaggacaccgcc
+ttgtattactgtgcaaaagata
+>HM855392|IGHV3-43*02|Homo_sapiens|F|V-REGION|22..319|298 nt|1| | | | |298+24=322| | |
+gaagtgcagctggtggagtctggggga...ggcgtggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............gatgattatgccatgcac
+tgggtccgtcaagctccagggaagggtctggagtgggtctctcttattagtggggat...
+...ggtggtagcacatactatgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacagcaaaaactccctgtatctgcaaatgaacagtctgagaactgaggacaccgcc
+ttgtattactgtgcaaaagata
+>KC713950|IGHV3-43D*01|Homo_sapiens|F|V-REGION|411..708|298 nt|1| | | | |298+24=322| | |
+gaagtgcagctggtggagtctggggga...gtcgtggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............gatgattatgccatgcac
+tgggtccgtcaagctccggggaagggtctggagtgggtctctcttattagttgggat...
+...ggtggtagcacctactatgcagactctgtgaag...ggtcgattcaccatctccaga
+gacaacagcaaaaactccctgtatctgcaaatgaacagtctgagagctgaggacaccgcc
+ttgtattactgtgcaaaagata
+>Z18900|IGHV3-47*01|Homo_sapiens|P|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+gaggatcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgcga
+ccctcctgtgcagcctctggattcgccttc............agtagctatgctctgcac
+tgggttcgccgggctccagggaagggtctggagtgggtatcagctattggtactggt...
+......ggtgatacatactatgcagactccgtgatg...ggccgattcaccatctccaga
+gacaacgccaagaagtccttgtatcttcatatgaacagcctgatagctgaggacatggct
+gtgtattattgtgcaaga
+>AB019438|IGHV3-47*02|Homo_sapiens|P|V-REGION|114743..115035|293 nt|1| | | | |293+27=320| | |
+gaggatcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ccctcctgtgcagcctctggattcgccttc............agtagctatgttctgcac
+tgggttcgccgggctccagggaagggtccggagtgggtatcagctattggtactggt...
+......ggtgatacatactatgcagactccgtgatg...ggccgattcaccatctccaga
+gacaacgccaagaagtccttgtatcttcaaatgaacagcctgatagctgaggacatggct
+gtgtattattgtgcaagaga
+>M99675|IGHV3-48*01|Homo_sapiens|F|V-REGION|334..629|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...agtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaatgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>AB019438|IGHV3-48*02|Homo_sapiens|F|V-REGION|95434..95729|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...agtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaatgccaagaactcactgtatctgcaaatgaacagcctgagagacgaggacacggct
+gtgtattactgtgcgagaga
+>U03893|IGHV3-48*03|Homo_sapiens|F|V-REGION|200..495|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagttatgaaatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...ggtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtttattactgtgcgagaga
+>HM855336|IGHV3-48*04|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| |rev-compl|
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatagcatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt...
+...agtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>M99676|IGHV3-49*01|Homo_sapiens|F|V-REGION|384..685|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggcggtccctgaga
+ctctcctgtacagcttctggattcaccttt............ggtgattatgctatgagc
+tggttccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagct
+tatggtgggacaacagaatacaccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatggttccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtactagaga
+>M99401|IGHV3-49*02|Homo_sapiens|F|V-REGION|128..429|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggccgtccctgaga
+ctctcctgtacagcttctggattcaccttt............gggtattatcctatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagct
+tatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtactagaga
+>AB019438|IGHV3-49*03|Homo_sapiens|F|V-REGION|76304..76605|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggcggtccctgaga
+ctctcctgtacagcttctggattcaccttt............ggtgattatgctatgagc
+tggttccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagct
+tatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtactagaga
+>AM940220|IGHV3-49*04|Homo_sapiens|F|V-REGION|1..302|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggcggtccctgaga
+ctctcctgtacagcttctggattcaccttt............ggtgattatgctatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagct
+tatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtactagaga
+>AM940221|IGHV3-49*05|Homo_sapiens|F|V-REGION|1..302|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagccagggcggtccctgaga
+ctctcctgtacagcttctggattcaccttt............ggtgattatgctatgagc
+tggttccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagct
+tatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagcc
+gtgtattactgtactagaga
+>M99678|IGHV3-52*01|Homo_sapiens|P|V-REGION|367..662|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctgggtga...ggcttggtacagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctcctggatgcac
+tgggtctgccaggctccggagaaggggctggagtgggtggccgacataaagtgtgac...
+...ggaagtgagaaatactatgtagactctgtgaag...ggccgattgaccatctccaga
+gacaatgccaagaactccctctatctgcaagtgaacagcctgagagctgaggacatgacc
+gtgtattactgtgtgagagg
+>Z17388|IGHV3-52*02|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318|partial in 3'| |
+gaggtgcagctggtggagtctgggtga...ggcttggtacagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctcctggatgcac
+tgggtctgccaggctccggagaaggggcaggagtgggtggccgacataaagtgtgac...
+...ggaagtgagaaatactatgtagactctgtgaag...ggccgattgaccatctccaga
+gacaatgccaagaactccctctatctgcaagtgaacagcctgagagctgaggacatgacc
+gtgtattactgtgtgaga
+>J00237|IGHV3-52*03|Homo_sapiens|P|V-REGION|177..470|294 nt|1| | | | |294+24=318|partial in 3'| |
+gaggtgcagctggtcgagtctgggtga...ggcttggtacagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctcctggatgcac
+tgggtctgccaggctccggagaaggggctggagtgggtggccgacataaagtgtgac...
+...ggaagtgagaaatactatgtagactctgtgaag...ggccgattgaccatctccaga
+gacaatgccaagaactccctctatctgcaagtgaacagcctgagagctgaggacatgacc
+gtgtattactgtgtgaga
+>M99679|IGHV3-53*01|Homo_sapiens|F|V-REGION|196..488|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggagga...ggcttgatccagcctggggggtccctgaga
+ctctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>KF698735|IGHV3-53*02|Homo_sapiens|F|V-REGION|409..701|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagactggagga...ggcttgatccagcctggggggtccctgaga
+ctctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>J03617|IGHV3-53*03|Homo_sapiens|F|V-REGION|679..971|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggagga...ggcttgatccagcctggggggtccctgaga
+ctctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagc
+tgggtccgccagcctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgctaggga
+>HM855453|IGHV3-53*04|Homo_sapiens|F|V-REGION|22..314|293 nt|1| | | | |293+27=320| |rev-compl|
+gaggtgcagctggtggagtctggagga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccaga
+cacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggcc
+gtgtattactgtgcgagaga
+>M99680|IGHV3-54*01|Homo_sapiens|P|V-REGION|297..592|296 nt|1| | || |296+24=320| | |
+gaggtacagctggtggagtctgaagaa...aaccaaagacaacttgggggatccctgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaatgagc
+tcagattcccaagctccagggaaggggctggagtgagtagtagatatatagtaggat...
+...agaagtcagctatgttatgcacaatctgtgaag...agcagattcaccatctccaaa
+gaaaatgccaagaactcactctgtttgcaaatgaacagtctgagagcagagggcacggcc
+gtgtattactgtatgtgagt
+>X92215|IGHV3-54*02|Homo_sapiens|P|V-REGION|346..641|296 nt|1| | | | |296+24=320| | |
+gaggtacagctggtggagtctgaagaa...aaccaaagacaacttgggggatccctgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaatgagc
+tcagattcccaggctccagggaaggggctggagtgagtagtagatatatagtacgat...
+...agaagtcagatatgttatgcacaatctgtgaag...agcagattcaccatctccaaa
+gaaaatgccaagaactcactccgtttgcaaatgaacagtctgagagcagagggcacggcc
+gtgtattactgtatgtgagg
+>AB019438|IGHV3-54*04|Homo_sapiens|P|V-REGION|31896..32191|296 nt|1| | | | |296+24=320| | |
+gaggtacagctggtggagtctgaagaa...aaccaaagacaacttgggggatccctgaga
+ctctcctgtgcagactctggattaaccttc............agtagctactgaatgagc
+tcagattcccaggctccagggaaggggctggagtgagtagtagatatatagtaggat...
+...agaagtcagctatgttatgcacaatctgtgaag...agcagattcaccatctccaaa
+gaaaatgccaagaactcactctgtttgcaaatgaacagtctgagagcagagggcacggcc
+gtgtattactgtatgtgagt
+>AB019437|IGHV3-62*01|Homo_sapiens|P|V-REGION|190113..190408|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggaa...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctctgctatgcac
+tgggtccgccaggctccaagaaagggtttgtagtgggtctcagttattagtacaagt...
+...ggtgataccgtactctacacagactctgtgaag...ggccgattcaccatctccaga
+gacaatgcccagaattcactgtctctgcaaatgaacagcctgagagccgagggcacagtt
+gtgtactactgtgtgaaaga
+>M99681|IGHV3-63*01|Homo_sapiens|P|V-REGION|170..467|298 nt|1| | | | |298+24=322| | |
+gaggtggagctgatagagtccatagag...ggcctgagacaacttgggaagttcctgaga
+ctctcctgtgtagcctctggattcaccttc............agtagctactgaatgagc
+tgggtcaatgagactctagggaaggggctggagggagtaatagatgtaaaatatgat...
+...ggaagtcagatataccatgcagactctgtgaag...ggcagattcaccatctccaaa
+gacaatgctaagaactcaccgtatctccaaacgaacagtctgagagctgaggacatgacc
+atgcatggctgtacataaggtt
+>Z15099|IGHV3-63*02|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtggagctgatagagtccatagag...ggcctgagacaacttgggaagttcctgaga
+ctctcctgtgtagcctctggattcaccttc............agtagctactgaatgagc
+tgggtcaatgagactctagggaaggggctggagggagtaatagatgtaaaatatgat...
+...ggaagtcagatataccatgcagactctgtgaag...ggcagattcaccatctccaaa
+gacaatgctaagaactcaccgtatctgcaaacgaacagtctgagagctgaggacatgacc
+atgcatggctgtacataa
+>M99682|IGHV3-64*01|Homo_sapiens|F|V-REGION|241..536|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat...
+...gggggtagcacatattatgcaaactctgtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgggcagcctgagagctgaggacatggct
+gtgtattactgtgcgagaga
+>AB019437|IGHV3-64*02|Homo_sapiens|F|V-REGION|175507..175802|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggaa...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat...
+...gggggtagcacatattatgcagactctgtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgggcagcctgagagctgaggacatggct
+gtgtattactgtgcgagaga
+>M77298|IGHV3-64*03|Homo_sapiens|F|V-REGION|114..409|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgttcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat...
+...gggggtagcacatactacgcagactcagtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatgtccaaatgagcagtctgagagctgaggacacggct
+gtgtattactgtgtgaaaga
+>M77299|IGHV3-64*04|Homo_sapiens|F|V-REGION|112..407|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgttcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat...
+...gggggtagcacatactacgcagactcagtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>M77301|IGHV3-64*05|Homo_sapiens|F|V-REGION|114..409|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgttcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat...
+...gggggtagcacatactacgcagactcagtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatgttcaaatgagcagtctgagagctgaggacacggct
+gtgtattactgtgtgaaaga
+>KC713941|IGHV3-64D*06|Homo_sapiens|F|V-REGION|407..702|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgttcagcctctggattcaccttc............agtagctatgctatgcac
+tgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat...
+...gggggtagcacatactacgcagactccgtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgagcagtctgagagctgaggacacggct
+gtgtattactgtgtgaaaga
+>X92218|IGHV3-66*01|Homo_sapiens|F|V-REGION|160..452|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactccgtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>Z27504|IGHV3-66*02|Homo_sapiens|F|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaga
+>AB019437|IGHV3-66*03|Homo_sapiens|F|V-REGION|158218..158510|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggagga...ggcttgatccagcctggggggtccctgaga
+ctctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagctgt...
+......ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgagaga
+>X70208|IGHV3-66*04|Homo_sapiens|F|V-REGION|450..742|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccgtc............agtagcaactacatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt...
+......ggtagcacatactacgcagactccgtgaag...ggcagattcaccatctccaga
+gacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaca
+>AJ879484|IGHV3-69-1*01|Homo_sapiens|P|V-REGION|169..461|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt...
+......agtaccatatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>AJ879485|IGHV3-69-1*02|Homo_sapiens|P|V-REGION|169..461|293 nt|1| | | | |293+27=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgaac
+tgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt...
+......agtaccatatactacgcagactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtttattactgtgcgagaga
+>M99649|IGHV3-7*01|Homo_sapiens|F|V-REGION|344..639|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agtagctattggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtggccaacataaagcaagat...
+...ggaagtgagaaatactatgtggactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>X92288|IGHV3-7*02|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agtagctattggatgagc
+tgggtccgccaggctccagggaaagggctggagtgggtggccaacataaagcaagat...
+...ggaagtgagaaatactatgtggactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgaga
+>HM855666|IGHV3-7*03|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| |rev-compl|
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............agtagctattggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggtggccaacataaagcaagat...
+...ggaagtgagaaatactatgtggactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>AB019437|IGHV3-71*01|Homo_sapiens|P|V-REGION|105844..106145|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtccggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tgggtccgccaggctcccgggaaggggctggagtgggtaggtttcattagaaacaaagct
+aatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaaga
+gatgattccaaaagcatcacctatctgcaaatgaacagcctgagagccgaggacacggcc
+gtgtattactgtgcgagaga
+>HM855875|IGHV3-71*02|Homo_sapiens|P|V-REGION|22..323|302 nt|1| | | | |302+18=320| |rev-compl|
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgactactacatgagc
+tgggtccgccaggctcccgggaaggggctggagtgggtaggtttcattagaaacaaagct
+aatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaaga
+gatgattccaaaagcatcacctatctgcaaatgaacagcctgagagccgaggacatggct
+gtgtattactgtgcgagaga
+>HM855455|IGHV3-71*03|Homo_sapiens|P|V-REGION|22..323|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctggtttcaccttc............agtgactactacatgagc
+tgggtccgccaggctcccgggaaggggctggagtgggtaggtttcattagaaacaaagct
+aatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaaga
+gatgattccaaaagcatcacctatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgcgagaga
+>X92206|IGHV3-72*01|Homo_sapiens|F|V-REGION|247..548|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtgaccactacatggac
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtactagaaacaaagct
+aacagttacaccacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaagaactcactgtatctgcaaatgaacagcctgaaaaccgaggacacggcc
+gtgtattactgtgctagaga
+>Z29979|IGHV3-72*02|Homo_sapiens|F|V-REGION|1..165|165 nt|1| | | | |165+99=264|partial in 5' and in 3' | |
+............................................................
+........................accttc............agtgaccactacatggac
+tgggtccgccaggctccagggaaggggctggagtgggttggccgtactagaaacaaagct
+aacagctacaccacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaagaactcactgtat
+>X70197|IGHV3-73*01|Homo_sapiens|F|V-REGION|684..985|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaaa
+ctctcctgtgcagcctctgggttcaccttc............agtggctctgctatgcac
+tgggtccgccaggcttccgggaaagggctggagtgggttggccgtattagaagcaaagct
+aacagttacgcgacagcatatgctgcgtcggtgaaa...ggcaggttcaccatctccaga
+gatgattcaaagaacacggcgtatctgcaaatgaacagcctgaaaaccgaggacacggcc
+gtgtattactgtactagaca
+>AB019437|IGHV3-73*02|Homo_sapiens|F|V-REGION|78310..78611|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtccggggga...ggcttggtccagcctggggggtccctgaaa
+ctctcctgtgcagcctctgggttcaccttc............agtggctctgctatgcac
+tgggtccgccaggcttccgggaaagggctggagtgggttggccgtattagaagcaaagct
+aacagttacgcgacagcatatgctgcgtcggtgaaa...ggcaggttcaccatctccaga
+gatgattcaaagaacacggcgtatctgcaaatgaacagcctgaaaaccgaggacacggcc
+gtgtattactgtactagaca
+>L33851|IGHV3-74*01|Homo_sapiens|F|V-REGION|183..478|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtccggggga...ggcttagttcagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctactggatgcac
+tgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat...
+...gggagtagcacaagctacgcggactccgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaacacgctgtatctgcaaatgaacagtctgagagccgaggacacggct
+gtgtattactgtgcaagaga
+>Z17392|IGHV3-74*02|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtggagtctggggga...ggcttagttcagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctactggatgcac
+tgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat...
+...gggagtagcacaagctacgcggactccgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaacacgctgtatctgcaaatgaacagtctgagagccgaggacacggct
+gtgtattactgtgcaaga
+>J00239|IGHV3-74*03|Homo_sapiens|F|V-REGION|179..474|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtggagtccggggga...ggcttagttcagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctactggatgcac
+tgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat...
+...gggagtagcacaacgtacgcggactccgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaacacgctgtatctgcaaatgaacagtctgagagccgaggacacggct
+gtgtattactgtgcaagaga
+>M99651|IGHV3-9*01|Homo_sapiens|F|V-REGION|280..577|298 nt|1| | | | |298+24=322| | |
+gaagtgcagctggtggagtctggggga...ggcttggtacagcctggcaggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............gatgattatgccatgcac
+tgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaat...
+...agtggtagcataggctatgcggactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggcc
+ttgtattactgtgcaaaagata
+>HM855577|IGHV3-9*02|Homo_sapiens|F|V-REGION|22..319|298 nt|1| | | | |298+24=322| | |
+gaagtgcagctggtggagtctggggga...ggcttggtacagcctggcaggtccctgaga
+ctctcctgtgcagcctctggattcacctct............gatgattatgccatgcac
+tgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaat...
+...agtggtagcataggctatgcggactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggcc
+ttgtattactgtgcaaaagata
+>KC713947|IGHV3-9*03|Homo_sapiens|F|V-REGION|399..696|298 nt|1| | | | |298+24=322| | |
+gaagtgcagctggtggagtctggggga...ggcttggtacagcctggcaggtccctgaga
+ctctcctgtgcagcctctggattcaccttt............gatgattatgccatgcac
+tgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaat...
+...agtggtagcataggctatgcggactctgtgaag...ggccgattcaccatctccaga
+gacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacatggcc
+ttgtattactgtgcaaaagata
+>HM855939|IGHV3-NL1*01|Homo_sapiens|F|V-REGION|22..317|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctggggggtccctgaga
+ctctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcac
+tgggtccgccaggctccaggcaaggggctggagtgggtctcagttatttatagcggt...
+...ggtagtagcacatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgcgaaaga
+>Z29597|IGHV3/OR15-7*01|Homo_sapiens|ORF|V-REGION|1..300|300 nt|1| | | | |300+18=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctgggggttctctgaga
+ctctcatgtgcagcctctggattcaccttc............agtgaccactacatgagc
+tgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagct
+aacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaaga
+gaggattcaaagaacacgatgtatctgcaaatgagcaacctgaaaaccgaggacttggcc
+gtgtattactgtgctaga
+>M36530|IGHV3/OR15-7*02|Homo_sapiens|ORF|V-REGION|247..546|300 nt|1| | | | |300+18=318| | |
+gaggtgcagctgttggagtctggggga...ggcttggtccagcctgggggttctctgaga
+ctctcatgtgctgcctctggattcaccttc............agtgaccactacatgagc
+tgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagct
+aacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaaga
+gaggattcaaagaacacgctgtatctgcaaatgagcagcctgaaaaccgaggacttggcc
+gtgtattactgtgctaga
+>Z12332|IGHV3/OR15-7*03|Homo_sapiens|ORF|V-REGION|1..300|300 nt|1| | | | |300+18=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctgggggttctctgaga
+ctctcatgtgcagcctctggattcaccttc............agtgaccactacatgagc
+tgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagct
+aacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaaga
+gaggattcaaagaacacgctgtatctgcaaatgagcagcctgaaaaccgaggacttggcc
+gtgtattactgtgctaga
+>HM855865|IGHV3/OR15-7*05|Homo_sapiens|ORF|V-REGION|22..323|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctgggggttctctgaga
+ctctcatgtgcagcctctggattcaccttc............agtgaccactacatgagc
+tgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagct
+aacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaaga
+gaggattcaaagaacacgctgtatctgcaaatgagcaacctgaaaaccgaggacttggcc
+gtgtattactgtgctagaga
+>Z29607|IGHV3/OR16-10*01|Homo_sapiens|ORF|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+gaggttcagctggtgcagtctggggga...ggcttggtacatcctggggggtccctgaga
+ctctcctgtgcaggctctggattcaccttc............agtagctatgctatgcac
+tgggttcgccaggctccaggaaaaggtctggagtgggtatcagctattggtactggt...
+......ggtggcacatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaatgccaagaactccttgtatcttcaaatgaacagcctgagagccgaggacatggct
+gtgtattactgtgcaaga
+>Z12345|IGHV3/OR16-10*02|Homo_sapiens|ORF|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+gaggttcagctggtgcagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcaggctctggattcaccttc............agtagctatgctatgcac
+tgggttcgccaggctccaggaaaaggtctggagtgggtatcagctattggtactggt...
+......ggtggcacatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaatgccaagaactccttgtatcttcaaatgaacagcctgagagccgaggacatggct
+gtgtattactgtgcaaga
+>HM855718|IGHV3/OR16-10*03|Homo_sapiens|ORF|V-REGION|22..314|293 nt|1| | | | |293+27=320| |rev-compl|
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcaggctctggattcaccttc............agtagctatgctatgcac
+tgggttcgccaggctccaggaaaaggtctggagtgggtatcagctattggtactggt...
+......ggtggcacatactatgcagactccgtgaag...ggccgattcaccatctccaga
+gacaatgccaagaactccttgtatcttcaaatgaacagcctgagagccgaggacatggct
+gtgtattactgtgcaagaga
+>Z29609|IGHV3/OR16-12*01|Homo_sapiens|ORF|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtagagtctgggaga...ggcttggcccagcctggggggtacctaaaa
+ctctccggtgcagcctctggattcaccgtc............ggtagctggtacatgagc
+tggatccaccaggctccagggaagggtctggagtgggtctcatacattagtagtagt...
+...ggttgtagcacaaactacgcagactctgtgaag...ggcagattcaccatctccaca
+gacaactcaaagaacacgctctacctgcaaatgaacagcctgagagtggaggacacggcc
+gtgtattactgtgcaaga
+>Z29610|IGHV3/OR16-13*01|Homo_sapiens|ORF|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtggagtctggggga...ggcttagtacagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctactggatgcac
+tgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat...
+...gggagtagcacaagctacgcagactccatgaag...ggccaattcaccatctccaga
+gacaatgctaagaacacgctgtatctgcaaatgaacagtctgagagctgaggacatggct
+gtgtattactgtactaga
+>Z29611|IGHV3/OR16-14*01|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggaggagtctggggga...ggcttagtacagcctggagggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtagctactggatgcac
+tgggtccgccaatctccagggaaggggctggtgtgagtctcacgtattaatagtgat...
+...gggagtagcacaagctacgcagactccttgaag...ggccaattcaccatctccaga
+gacaatgctaagaacacgctgtatctgcaaatgaacagtctgagagctgaggacatggct
+gtgtattactgtactaga
+>L25546|IGHV3/OR16-15*01|Homo_sapiens|P|V-REGION|204..499|296 nt|1| | | | |296+24=320| | |
+gaagtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+ctctcctgtgcagcctctgtattcaccttc............agtaacagtgacataaac
+tgggtcctctaggctccaggaaaggggctggagtgggtctcgggtattagttggaat...
+...ggcggtaagacgcactatgtggactccgtgaag...ggccaattttccatctccaga
+gacaattccagcaagtccctgtatctgcaaaagaacagacagagagccaaggacatggcc
+gtgtattactgtgtgagaaa
+>Z29612|IGHV3/OR16-15*02|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+cactcctgtgcagcctctggattcaccttc............agtaacagtgacatgaac
+tgggtcctctaggctccaggaaaggggctggagtgggtctcgggtattagttggaat...
+...ggcggtaagacgcactatgtggactccgtgaag...ggccaatttaccatctccaga
+gacaattccagcaagtccctgtatctgcaaaagaacagacagagagccaaagacatggcc
+gtgtattactgtgtgaga
+>Z29613|IGHV3/OR16-16*01|Homo_sapiens|P|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaga
+cactcctgtgcagcctctggattcaccttc............agtaacagtgacatgaac
+tgggtcctctaggctccaggaaaggggctggagtgggtctcggatattagttggaat...
+...ggcggtaagacgcactatgtggactccgtgaag...ggccaatttaccatctccaga
+gacaattccagcaagtccctgtatctgcaaaagaacagacagagagccaaggacatggcc
+gtgtattactgtgtgaga
+>HM855668|IGHV3/OR16-6*02|Homo_sapiens|ORF|V-REGION|22..323|302 nt|1| | | | |302+18=320| | |
+gaggtgcagctggtggagtctgcggga...ggccttggtacagcctgggggtcccttaga
+ctctcctgtgcagcctctggattcacttgc............agtaacgcctggatgagc
+tgggtccgccaggctccagggaaggggctggagtgggttggctgtattaaaagcaaagct
+aatggtgggacaacagactacgctgcacctgtgaaa...ggcagattcaccatctcaaga
+gatgattcaaaaaacacgctgtatctgcaaatgatcagcctgaaaaccgaggacacggcc
+gtgtattactgtaccacagg
+>Z29605|IGHV3/OR16-8*01|Homo_sapiens|ORF|V-REGION|1..294|294 nt|1| | || |294+24=318| | |
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctgtcctgtccagcctctggattcaccttc............agtaaccactacatgagc
+tgggtccgccaggctccagggaagggactggagtgggtttcatacattagtggtgat...
+...agtggttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagg
+gacaacgccaataactcaccgtatctgcaaatgaacagcctgagagctgaggacacggct
+gtgtattactgtgtgaaa
+>HM855427|IGHV3/OR16-8*02|Homo_sapiens|ORF|V-REGION|22..317|296 nt|1| | | | |296+24=320| |rev-compl|
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgaga
+ctgtcctgtccagactctggattcaccttc............agtaaccactacatgagc
+tgggtccgccaggctccagggaagggactggagtggatttcatacattagtggtgat...
+...agtggttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagg
+gacaacgccaataactcaccgtatctgcaaatgaacagcttgagagctgaggacacggct
+gtgtattactgtgtgaaaca
+>Z29606|IGHV3/OR16-9*01|Homo_sapiens|ORF|V-REGION|1..294|294 nt|1| | || |294+24=318| | |
+gaggtgcagctggtggagtctggagga...ggcttggtacagcctggggggtccctgaga
+ctctcctgtgcagcctctggattcaccttc............agtaaccactacacgagc
+tgggtccgccaggctccagggaagggactggagtgggtttcatacagtagtggtaat...
+...agtggttacacaaactacgcagactctgtgaaa...ggccgattcaccatctccagg
+gacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggct
+gtgtattactgtgtgaaa
+>X05714|IGHV4-28*01|Homo_sapiens|F|V-REGION|290..585|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggcc
+gtgtattactgtgcgagaaa
+>M83133|IGHV4-28*02|Homo_sapiens|F|V-REGION|811..1106|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcatctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggcc
+gtgtattactgtgcgagaaa
+>X92233|IGHV4-28*03|Homo_sapiens|F|V-REGION|140..435|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggcc
+gtgtattactgtgcgagaga
+>X56358|IGHV4-28*04|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacaccggc
+gtgtattactgtgcgaga
+>HM855339|IGHV4-28*05|Homo_sapiens|F|V-REGION|26..321|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcatctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggcc
+gtgtattactgtgcgagaaa
+>HM855782|IGHV4-28*06|Homo_sapiens|F|V-REGION|26..321|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctacaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccttggacacggcc
+gtgtattactgtgcgagaaa
+>KC713936|IGHV4-28*07|Homo_sapiens|F|V-REGION|390..685|296 nt|1| | | | |296+24=320| | |
+caggtacagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggc
+tggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggcc
+gtgtattactgtgcgagaaa
+>L10089|IGHV4-30-2*01|Homo_sapiens|F|V-REGION|1..299|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaggtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgccagaga
+>M95122|IGHV4-30-2*02|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+21=315| | |
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaggtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcg
+>X92229|IGHV4-30-2*03|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagccaccagggaagggcctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcagacacggct
+gtgtattactgtgcgagaca
+>Z75351|IGHV4-30-2*04|Homo_sapiens|F|V-REGION|1..227|227 nt|1| | | | |227+93=320|partial in 5'| |
+............................................................
+...............tctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactgtgcgagaga
+>HM855593|IGHV4-30-2*05|Homo_sapiens|F|V-REGION|40..338|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggcc
+gtgtattactgtgccagaga
+>KC713944|IGHV4-30-2*06|Homo_sapiens|F|V-REGION|390..688|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagtcaccagggaagggcctggagtggattgggtacatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaggtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgccagaga
+>Z14238|IGHV4-30-4*01|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagt
+tggatccgccagcccccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggcc
+gtgtattactgtgccagaga
+>Z14239|IGHV4-30-4*02|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagt
+tggatccgccagcccccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgcagcagacacggcc
+gtgtattactgtgccagaga
+>X92274|IGHV4-30-4*03|Homo_sapiens|F|V-REGION|140..429|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagt
+tggatccgccagcccccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactg
+>X92275|IGHV4-30-4*04|Homo_sapiens|F|V-REGION|140..429|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtgcagctgcaggactcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagt
+tggatccgccagcccccagggaagggcctggagtggattgggtacttctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggcc
+gtgtattactg
+>Z75353|IGHV4-30-4*05|Homo_sapiens|F|V-REGION|1..228|228 nt|1| | | | |228+92=320|partial in 5'| |
+............................................................
+..............ctctggtggctccatcagc......agtggtgattactactggagt
+tggatccgccagcncccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggcc
+gtgtattactgtgccagaga
+>Z75360|IGHV4-30-4*06|Homo_sapiens|F|V-REGION|1..227|227 nt|1| | | | |227+93=320|partial in 5'| |
+............................................................
+...............tctggtggctccatcagc......agtggtgattactactggagt
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggcc
+gtgtattactgtgccagaga
+>KC713946|IGHV4-30-4*07|Homo_sapiens|F|V-REGION|390..688|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagc
+tggatccggcagccaccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgccagaga
+>L10098|IGHV4-31*01|Homo_sapiens|F|V-REGION|27..325|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtctagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactgtgcgagaga
+>M99683|IGHV4-31*02|Homo_sapiens|F|V-REGION|290..588|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgtactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactgtgcgagaga
+>Z14237|IGHV4-31*03|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactgtgcgagaga
+>M95120|IGHV4-31*04|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+21=315| | |
+caggtgcggctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactgtgcg
+>M95121|IGHV4-31*05|Homo_sapiens|F|V-REGION|1..291|291 nt|1| | | | |291+24=315| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgacc...gcggacgcggcc
+gtgtattactgtgcg
+>X92270|IGHV4-31*06|Homo_sapiens|F|V-REGION|140..429|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtagttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactg
+>X92271|IGHV4-31*07|Homo_sapiens|F|V-REGION|140..429|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggatccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactg
+>X92272|IGHV4-31*08|Homo_sapiens|F|V-REGION|140..429|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactg
+>X92273|IGHV4-31*09|Homo_sapiens|F|V-REGION|140..429|290 nt|1| | | | |290+21=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>Z14235|IGHV4-31*10|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactgttgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagc
+tggatccgccagcacccagggaagggcctggagtggattgggtgcatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacccgtccaagaaccagttctccctgaagccgagctctgtgactgccgcggacacggcc
+gtggattactgtgcgagaga
+>AB019439|IGHV4-34*01|Homo_sapiens|F|V-REGION|59657..59949|293 nt|1| | | | |293+27=320| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcgagagg
+>M99684|IGHV4-34*02|Homo_sapiens|F|V-REGION|311..603|293 nt|1| | | | |293+27=320| | |
+caggtgcagctacaacagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcgagagg
+>X92255|IGHV4-34*03|Homo_sapiens|F|V-REGION|141..424|284 nt|1| | | | |284+27=311|partial in 3'| |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92236|IGHV4-34*04|Homo_sapiens|F|V-REGION|141..433|293 nt|1| | | | |293+27=320| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaacaacaacccgtccctcaag...agtcgagccaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcgagagg
+>X92237|IGHV4-34*05|Homo_sapiens|F|V-REGION|141..433|293 nt|1| | | | |293+27=320| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggtgc
+tggatccgccagcccctagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaacaacaacccgtccctcaag...agtcgagccaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcgagagg
+>X92256|IGHV4-34*06|Homo_sapiens|F|V-REGION|141..424|284 nt|1| | | | |284+27=311|partial in 3'| |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgggctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92258|IGHV4-34*07|Homo_sapiens|F|V-REGION|141..424|284 nt|1| | | | |284+27=311|partial in 3'| |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaaccatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>M95113|IGHV4-34*08|Homo_sapiens|F|V-REGION|1..288|288 nt|1| | | | |288+27=315| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggaccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcg
+>Z14241|IGHV4-34*09|Homo_sapiens|F|V-REGION|140..432|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaagggactggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactgtgcgagaga
+>Z14242|IGHV4-34*10|Homo_sapiens|F|V-REGION|141..433|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaagggactggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgaatcaccatgtcagta
+gacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagata
+>X05716|IGHV4-34*11|Homo_sapiens|F|V-REGION|292..584|293 nt|1| | | | |293+27=320| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccgtc............agtggttactactggagc
+tggatccggcagcccccagggaaggggctggagtggattgggtatatctattatagt...
+......gggagcaccaacaacaacccctccctcaag...agtcgagccaccatatcagta
+gacacgtccaagaaccagttctccctgaacctgagctctgtgaccgccgcggacacggcc
+gtgtattgctgtgcgagaga
+>X56591|IGHV4-34*12|Homo_sapiens|F|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcattcatagt...
+......ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcgaga
+>Z75356|IGHV4-34*13|Homo_sapiens|F|V-REGION|1..221|221 nt|1| | | | |221+99=320|partial in 5'| |
+............................................................
+...............tatggtgggtccttc............agtggttactactggagc
+tggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt...
+......ggaagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggct
+gtgtattactgtgcgagagg
+>Z12367|IGHV4-38-2*01|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+24=318| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcgctgtctctggttactccatcagc.........agtggttactactggggc
+tggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactgtgcgaga
+>AC233755|IGHV4-38-2*02|Homo_sapiens|F|V-REGION|41583..41878|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggttactccatcagc.........agtggttactactggggc
+tggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactgtgcgagaga
+>AB019439|IGHV4-39*01|Homo_sapiens|F|V-REGION|11626..11924|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggct
+gtgtattactgtgcgagaca
+>X05715|IGHV4-39*02|Homo_sapiens|F|V-REGION|291..589|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccacttctccctgaagctgagctctgtgaccgccgcagacacggct
+gtgtattactgtgcgagaga
+>X92259|IGHV4-39*03|Homo_sapiens|F|V-REGION|141..430|290 nt|1| | | | |290+21=311|partial in 3'| |
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactg
+>X92297|IGHV4-39*04|Homo_sapiens|F|V-REGION|1..196|196 nt|1| | | | |196+100=296|partial in 5'| |
+............................................................
+......................gctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacac
+>M95116|IGHV4-39*05|Homo_sapiens|F|V-REGION|1..294|294 nt|1| | | | |294+21=315| | |
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccccgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggct
+gtgtattactgtgcg
+>Z14236|IGHV4-39*06|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+cggctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttccccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>AM940222|IGHV4-39*07|Homo_sapiens|F|V-REGION|1..299|299 nt|1| | | | |299+21=320| | |
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>X05713|IGHV4-4*01|Homo_sapiens|F|V-REGION|292..587|296 nt|1| | || |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagcctccggggaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagt
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattgctgtgcgagaga
+>X92232|IGHV4-4*02|Homo_sapiens|F|V-REGION|140..435|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggggaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagt
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>X92252|IGHV4-4*03|Homo_sapiens|F|V-REGION|140..426|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagcctccggggaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagt
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92253|IGHV4-4*04|Homo_sapiens|F|V-REGION|140..426|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagcctccggggaccctgtcc
+ctcacctgcgctatctctggtggctccatcagc.........agtagtaactggtggagt
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92254|IGHV4-4*05|Homo_sapiens|F|V-REGION|140..426|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagttgggccca...ggactggtgaagcctccggggaccctgtcc
+ctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagt
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>Z75355|IGHV4-4*06|Homo_sapiens|F|V-REGION|1..224|224 nt|1| | || |224+96=320|partial in 5'| |
+............................................................
+...............tctggtggctccatcagc.........agtagtaactggtggagt
+tgggtccgccagcccccagggannnggctggagtggattggggaaatctatcatagt...
+......gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>X62112|IGHV4-4*07|Homo_sapiens|F|V-REGION|229..521|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccgccgggaagggactggagtggattgggcgtatctataccagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>KC713942|IGHV4-4*08|Homo_sapiens|F|V-REGION|390..682|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctataccagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactgtgcgagaga
+>M99685|IGHV4-55*01|Homo_sapiens|P|V-REGION|370..665|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgta
+gacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagata
+>X92223|IGHV4-55*02|Homo_sapiens|P|V-REGION|349..644|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagta
+gacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagata
+>X92263|IGHV4-55*03|Homo_sapiens|P|V-REGION|141..427|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92265|IGHV4-55*04|Homo_sapiens|P|V-REGION|141..427|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagctttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagta
+gacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92266|IGHV4-55*05|Homo_sapiens|P|V-REGION|141..427|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagctttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgta
+gacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactg
+>X92267|IGHV4-55*06|Homo_sapiens|P|V-REGION|141..427|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgta
+gacacgtccaagaagcagttctacctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactg
+>X92268|IGHV4-55*07|Homo_sapiens|P|V-REGION|141..427|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgta
+gacacgtccaggaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactg
+>X92234|IGHV4-55*08|Homo_sapiens|P|V-REGION|141..436|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagta
+gacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>X92235|IGHV4-55*09|Homo_sapiens|P|V-REGION|140..435|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggcc
+gtgtattactgtgcgagaaa
+>AB019438|IGHV4-59*01|Homo_sapiens|F|V-REGION|5995..6287|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagaga
+>M29812|IGHV4-59*02|Homo_sapiens|F|V-REGION|290..582|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccgtc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagaga
+>M95114|IGHV4-59*03|Homo_sapiens|F|V-REGION|1..288|288 nt|1| | | | |288+27=315| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccaattctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcg
+>M95117|IGHV4-59*04|Homo_sapiens|F|V-REGION|1..288|288 nt|1| | | | |288+27=315| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggct
+gtgtattactgtgcg
+>M95118|IGHV4-59*05|Homo_sapiens|F|V-REGION|1..288|288 nt|1| | | | |288+27=315| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagccgccggggaagggactggagtggattgggcgtatctattatagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggct
+gtgtattactgtgcg
+>M95119|IGHV4-59*06|Homo_sapiens|F|V-REGION|1..288|288 nt|1| | | | |288+27=315| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtcactggtggctccatc............agtagttactactggagc
+tggatccggcagcccgctgggaagggcctggagtggattgggtacatctattacagt...
+......gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagta
+gacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggcc
+gtgtattactgtgcg
+>X56360|IGHV4-59*07|Homo_sapiens|F|V-REGION|1..291|291 nt|1| | | | |291+27=318| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgaga
+>HM855471|IGHV4-59*08|Homo_sapiens|F|V-REGION|40..332|293 nt|1| | | | |293+27=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactgtgcgagaca
+>Z75359|IGHV4-59*09|Homo_sapiens|F|V-REGION|1..221|221 nt|1| | || |221+99=320|partial in 5'| |
+............................................................
+...............tctggtggctccatc............agtagttactactggagc
+tggatccggcagcccccaggnannngactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagagg
+>Z14243|IGHV4-59*10|Homo_sapiens|F|V-REGION|141..433|293 nt|1| | | | |293+27=320| | |
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtcc
+ctcacctgcgctgtctatggtggctccatc............agtagttactactggagc
+tggatccggcagcccgccgggaaggggctggagtggattgggcgtatctataccagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatgtcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagata
+>M29811|IGHV4-61*01|Homo_sapiens|F|V-REGION|290..588|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccgtcagc......agtggtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagaga
+>L10097|IGHV4-61*02|Homo_sapiens|F|V-REGION|27..325|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtggtagttactactggagc
+tggatccggcagcccgccgggaagggactggagtggattgggcgtatctataccagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggcc
+gtgtattactgtgcgagaga
+>X92230|IGHV4-61*03|Homo_sapiens|F|V-REGION|140..438|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccgtcagc......agtggtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccacttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagaga
+>X92250|IGHV4-61*04|Homo_sapiens|F|V-REGION|140..426|287 nt|1| | | | |287+24=311|partial in 3'| |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccgtcagc......agtggtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattggatatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgct...gacacggcc
+gtgtattactg
+>X56356|IGHV4-61*05|Homo_sapiens|F|V-REGION|1..297|297 nt|1| | | | |297+21=318| | |
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgaga
+>Z75347|IGHV4-61*06|Homo_sapiens|ORF|V-REGION|1..227|227 nt|1| | | | |227+93=320|partial in 5'| |
+............................................................
+...............tctggtggctccgtcagc......agtggtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgccagaga
+>Z75348|IGHV4-61*07|Homo_sapiens|F|V-REGION|1..227|227 nt|1| | | | |227+93=320|partial in 5'| |
+............................................................
+...............tctggtggctccgtcagc......agtggtagttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagaca
+>AB019437|IGHV4-61*08|Homo_sapiens|F|V-REGION|194119..194417|299 nt|1| | | | |299+21=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcactgtctctggtggctccgtcagc......agtggtggttactactggagc
+tggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt...
+......gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagta
+gacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggcc
+gtgtattactgtgcgagaga
+>HM855539|IGHV4/OR15-8*01|Homo_sapiens|ORF|V-REGION|40..335|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcgttgtctctggtggctccatcagc.........agtagtaactggtggagc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagccccaactacaacccgtccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>X05712|IGHV4/OR15-8*02|Homo_sapiens|ORF|V-REGION|262..557|296 nt|1| | | | |296+24=320| | |
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcgttgtctctggtggctccatcagc.........agtagtaactggtggagc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggaaccccaactacaacccgtccctcaag...agtcgagtcaccatatcaata
+gacaagtccaagaaccaattctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>HM855418|IGHV4/OR15-8*03|Homo_sapiens|ORF|V-REGION|26..321|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtcc
+ctcacctgcgttgtctctggtggctccatcagc.........agtagtaactggtggagc
+tgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt...
+......gggagccccaactacaacccatccctcaag...agtcgagtcaccatatcagta
+gacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggcc
+gtgtattactgtgcgagaga
+>X92227|IGHV5-10-1*01|Homo_sapiens|F|V-REGION|13..306|294 nt|1| | | | |294+24=318| | |
+gaagtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgagg
+atctcctgtaagggttctggatacagcttt............accagctactggatcagc
+tgggtgcgccagatgcccgggaaaggcctggagtggatggggaggattgatcctagt...
+...gactcttataccaactacagcccgtccttccaa...ggccacgtcaccatctcagct
+gacaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgaga
+>X92279|IGHV5-10-1*02|Homo_sapiens|F|V-REGION|252..546|295 nt|1| | | | |295+25=320| | |
+gaagtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgagg
+atctcctgtaagggttctggatacagcttt............accagctactggatcagc
+tgggtgcgccagatgcccgggaaaggcttggagtggatggggaggattgatcctagt...
+...gactcttataccaactacagcccgtccttccaa...ggccacgtcaccatctcagct
+gacaagtccatcagcactgcctacctgcagtggagcagcctgaaggc.tcggacaccgcc
+atgtattactgtgcgagaca
+>X56375|IGHV5-10-1*03|Homo_sapiens|F|V-REGION|12..305|294 nt|1| | | | |294+24=318| | |
+gaagtgcagctggtgcagtccggagca...gaggtgaaaaagcccggggagtctctgagg
+atctcctgtaagggttctggatacagcttt............accagctactggatcagc
+tgggtgcgccagatgcccgggaaaggcctggagtggatggggaggattgatcctagt...
+...gactcttataccaactacagcccgtccttccaa...ggccacgtcaccatctcagct
+gacaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgaga
+>X56376|IGHV5-10-1*04|Homo_sapiens|F|V-REGION|12..305|294 nt|1| | | | |294+24=318| | |
+gaagtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgagg
+atctcctgtaagggttctggatacagcttt............accagctactggatcagc
+tgggtgcgccagatgcccgggaaaggcctggagtggatggggaggattgatcctagt...
+...gactcttataccaactacagcccgtccttccaa...ggccaggtcaccatctcagct
+gacaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgaga
+>M99686|IGHV5-51*01|Homo_sapiens|F|V-REGION|308..603|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaag
+atctcctgtaagggttctggatacagcttt............accagctactggatcggc
+tgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggt...
+...gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagcc
+gacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgagaca
+>M18806|IGHV5-51*02|Homo_sapiens|F|V-REGION|251..546|296 nt|1| | | | |296+24=320| | |
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaag
+atctcctgtaagggttctggatacagcttt............accagctactggaccggc
+tgggtgcgccagatgcccgggaaaggcttggagtggatggggatcatctatcctggt...
+...gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagcc
+gacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgagaca
+>X56368|IGHV5-51*03|Homo_sapiens|F|V-REGION|12..305|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagccgggggagtctctgaag
+atctcctgtaagggttctggatacagcttt............accagctactggatcggc
+tgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggt...
+...gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagcc
+gacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgaga
+>X56367|IGHV5-51*04|Homo_sapiens|F|V-REGION|12..305|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagccgggggagtctctgaag
+atctcctgtaagggttctggatacagcttt............accagctactggatcggc
+tgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggt...
+...gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagcc
+gacaagcccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atgtattactgtgcgaga
+>Z27449|IGHV5-51*05|Homo_sapiens|F|V-REGION|1..245|245 nt|1| | | | |245+58=303|partial in 5'| |
+.....................................aaaagcccggggagtctctgaag
+atctcctgtaagggttctggatacagcttt............accagctactggatcggc
+tgggtgcgccagatgcccaggaaaggcctggagtggatggggatcatctatcctggt...
+...gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagcc
+gacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgcc
+atg
+>X92213|IGHV5-78*01|Homo_sapiens|P|V-REGION|734..1027|294 nt|1| | | | |294+24=318| | |
+gaggtgcagctgttgcagtctgcagca...gaggtgaaaagacccggggagtctctgagg
+atctcctgtaagacttctggatacagcttt............accagctactggatccac
+tgggtgcgccagatgcccgggaaagaactggagtggatggggagcatctatcctggg...
+...aactctgataccagatacagcccatccttccaa...ggccacgtcaccatctcagcc
+gacagctccagcagcaccgcctacctgcagtggagcagcctgaaggcctcggacgccgcc
+atgtattattgtgtgaga
+>J04097|IGHV6-1*01|Homo_sapiens|F|V-REGION|480..784|305 nt|1| | | | |305+15=320| | |
+caggtacagctgcagcagtcaggtcca...ggactggtgaagccctcgcagaccctctca
+ctcacctgtgccatctccggggacagtgtctct......agcaacagtgctgcttggaac
+tggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtcc
+...aagtggtataatgattatgcagtatctgtgaaa...agtcgaataaccatcaaccca
+gacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggct
+gtgtattactgtgcaagaga
+>Z14223|IGHV6-1*02|Homo_sapiens|F|V-REGION|142..446|305 nt|1| | | | |305+15=320| | |
+caggtacagctgcagcagtcaggtccg...ggactggtgaagccctcgcagaccctctca
+ctcacctgtgccatctccggggacagtgtctct......agcaacagtgctgcttggaac
+tggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtcc
+...aagtggtataatgattatgcagtatctgtgaaa...agtcgaataaccatcaaccca
+gacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggct
+gtgtattactgtgcaagaga
+>AB019439|IGHV7-34-1*01|Homo_sapiens|P|V-REGION|56018..56310|293 nt|1| | | | |293+27=320| | |
+...ctgcagctggtgcagtctgggcct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctataagtcttctggttacaccttc............accatctatggtatgaat
+tgggtatgatagacccctggacagggctttgagtggatgtgatggatcatcacctac...
+...actgggaacccaacgtatacccacggcttcaca...ggatggtttgtcttctccatg
+gacacgtctgtcagcacggcgtgtcttcagatcagcagcctaaaggctgaggacacggcc
+gagtattactgtgcgaagta
+>HM855644|IGHV7-34-1*02|Homo_sapiens|P|V-REGION|24..316|293 nt|1| | | | |293+27=320| |rev-compl|
+...ctgcagctggtgcagtctgggcct...gaggtgaagaagcctggggcctcagtgaag
+gtctcctataagtcttctggttacaccttc............accatctatggtatgaat
+tgggtatgatagacccctggacagggctttgagtggatgtgatggatcatcacctac...
+...aatgggaacccaacgtatacccacggcttcaca...ggatggtttgtcttctccatg
+gacacgtctgtcagcacggcgtgtcttcagatcagcagcctaaaggctgaggacacggcc
+gagtattactgtgcgaagta
+>L10057|IGHV7-4-1*01|Homo_sapiens|F|V-REGION|95..388|294 nt|1| | | | |294+24=318| | |
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgaat
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac...
+...actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttg
+gacacctctgtcagcacggcatatctgcagatctgcagcctaaaggctgaggacactgcc
+gtgtattactgtgcgaga
+>X62110|IGHV7-4-1*02|Homo_sapiens|F|V-REGION|158..453|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgaat
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac...
+...actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttg
+gacacctctgtcagcacggcatatctgcagatcagcagcctaaaggctgaggacactgcc
+gtgtattactgtgcgagaga
+>X92290|IGHV7-4-1*03|Homo_sapiens|F|V-REGION|1..274|274 nt|1| | | | |274+24=298|partial in 3'| |
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgaat
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac...
+...actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttg
+gacacctctgtcagcacggcatatctgcagatcagcacgctaaaggctgaggacactg
+>HM855485|IGHV7-4-1*04|Homo_sapiens|F|V-REGION|24..319|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgaat
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac...
+...actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttg
+gacacctctgtcagcatggcatatctgcagatcagcagcctaaaggctgaggacactgcc
+gtgtattactgtgcgagaga
+>HM855361|IGHV7-4-1*05|Homo_sapiens|F|V-REGION|24..319|296 nt|1| | | | |296+24=320| |rev-compl|
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaag
+gtttcctgcaaggcttctggatacaccttc............actagctatgctatgaat
+tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac...
+...actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttg
+gacacctctgtcagcatggcatatctgcagatcagcagcctaaaggctgaggacactgcc
+gtgtgttactgtgcgagaga
+>AC241995|IGHV7-40*03|Homo_sapiens|P|V-REGION|10101..10396|296 nt|1| | | | |296+24=320| | |
+ttttcaatagaaaagtcaaataatcta...agtgtcaatcagtggatgattagataaaat
+atgatatatgtaaatcatggaatactatgc............agccagtatggtatgaat
+tcagtgtgaccagcccctggacaagggcttgagtggatgggatggatcatcacctac...
+...actgggaacccaacatataccaacggcttcaca...ggacggtttctattctccatg
+gacacctctgtcagcatggcgtatctgcagatcagcagcctaaaggctgaggacacggcc
+gtgtatgactgtatgagaga
+>AB019437|IGHV7-81*01|Homo_sapiens|ORF|V-REGION|6456..6751|296 nt|1| | | | |296+24=320| | |
+caggtgcagctggtgcagtctggccat...gaggtgaagcagcctggggcctcagtgaag
+gtctcctgcaaggcttctggttacagtttc............accacctatggtatgaat
+tgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctac...
+...actgggaacccaacatatgcccagggcttcaca...ggacggtttgtcttctccatg
+gacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggcc
+atgtattactgtgcgagata
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/LICENSE	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,437 @@
+Attribution-NonCommercial-ShareAlike 4.0 International
+
+=======================================================================
+
+Creative Commons Corporation ("Creative Commons") is not a law firm and
+does not provide legal services or legal advice. Distribution of
+Creative Commons public licenses does not create a lawyer-client or
+other relationship. Creative Commons makes its licenses and related
+information available on an "as-is" basis. Creative Commons gives no
+warranties regarding its licenses, any material licensed under their
+terms and conditions, or any related information. Creative Commons
+disclaims all liability for damages resulting from their use to the
+fullest extent possible.
+
+Using Creative Commons Public Licenses
+
+Creative Commons public licenses provide a standard set of terms and
+conditions that creators and other rights holders may use to share
+original works of authorship and other material subject to copyright
+and certain other rights specified in the public license below. The
+following considerations are for informational purposes only, are not
+exhaustive, and do not form part of our licenses.
+
+     Considerations for licensors: Our public licenses are
+     intended for use by those authorized to give the public
+     permission to use material in ways otherwise restricted by
+     copyright and certain other rights. Our licenses are
+     irrevocable. Licensors should read and understand the terms
+     and conditions of the license they choose before applying it.
+     Licensors should also secure all rights necessary before
+     applying our licenses so that the public can reuse the
+     material as expected. Licensors should clearly mark any
+     material not subject to the license. This includes other CC-
+     licensed material, or material used under an exception or
+     limitation to copyright. More considerations for licensors:
+	wiki.creativecommons.org/Considerations_for_licensors
+
+     Considerations for the public: By using one of our public
+     licenses, a licensor grants the public permission to use the
+     licensed material under specified terms and conditions. If
+     the licensor's permission is not necessary for any reason--for
+     example, because of any applicable exception or limitation to
+     copyright--then that use is not regulated by the license. Our
+     licenses grant only permissions under copyright and certain
+     other rights that a licensor has authority to grant. Use of
+     the licensed material may still be restricted for other
+     reasons, including because others have copyright or other
+     rights in the material. A licensor may make special requests,
+     such as asking that all changes be marked or described.
+     Although not required by our licenses, you are encouraged to
+     respect those requests where reasonable. More_considerations
+     for the public:
+	wiki.creativecommons.org/Considerations_for_licensees
+
+=======================================================================
+
+Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
+Public License
+
+By exercising the Licensed Rights (defined below), You accept and agree
+to be bound by the terms and conditions of this Creative Commons
+Attribution-NonCommercial-ShareAlike 4.0 International Public License
+("Public License"). To the extent this Public License may be
+interpreted as a contract, You are granted the Licensed Rights in
+consideration of Your acceptance of these terms and conditions, and the
+Licensor grants You such rights in consideration of benefits the
+Licensor receives from making the Licensed Material available under
+these terms and conditions.
+
+
+Section 1 -- Definitions.
+
+  a. Adapted Material means material subject to Copyright and Similar
+     Rights that is derived from or based upon the Licensed Material
+     and in which the Licensed Material is translated, altered,
+     arranged, transformed, or otherwise modified in a manner requiring
+     permission under the Copyright and Similar Rights held by the
+     Licensor. For purposes of this Public License, where the Licensed
+     Material is a musical work, performance, or sound recording,
+     Adapted Material is always produced where the Licensed Material is
+     synched in timed relation with a moving image.
+
+  b. Adapter's License means the license You apply to Your Copyright
+     and Similar Rights in Your contributions to Adapted Material in
+     accordance with the terms and conditions of this Public License.
+
+  c. BY-NC-SA Compatible License means a license listed at
+     creativecommons.org/compatiblelicenses, approved by Creative
+     Commons as essentially the equivalent of this Public License.
+
+  d. Copyright and Similar Rights means copyright and/or similar rights
+     closely related to copyright including, without limitation,
+     performance, broadcast, sound recording, and Sui Generis Database
+     Rights, without regard to how the rights are labeled or
+     categorized. For purposes of this Public License, the rights
+     specified in Section 2(b)(1)-(2) are not Copyright and Similar
+     Rights.
+
+  e. Effective Technological Measures means those measures that, in the
+     absence of proper authority, may not be circumvented under laws
+     fulfilling obligations under Article 11 of the WIPO Copyright
+     Treaty adopted on December 20, 1996, and/or similar international
+     agreements.
+
+  f. Exceptions and Limitations means fair use, fair dealing, and/or
+     any other exception or limitation to Copyright and Similar Rights
+     that applies to Your use of the Licensed Material.
+
+  g. License Elements means the license attributes listed in the name
+     of a Creative Commons Public License. The License Elements of this
+     Public License are Attribution, NonCommercial, and ShareAlike.
+
+  h. Licensed Material means the artistic or literary work, database,
+     or other material to which the Licensor applied this Public
+     License.
+
+  i. Licensed Rights means the rights granted to You subject to the
+     terms and conditions of this Public License, which are limited to
+     all Copyright and Similar Rights that apply to Your use of the
+     Licensed Material and that the Licensor has authority to license.
+
+  j. Licensor means the individual(s) or entity(ies) granting rights
+     under this Public License.
+
+  k. NonCommercial means not primarily intended for or directed towards
+     commercial advantage or monetary compensation. For purposes of
+     this Public License, the exchange of the Licensed Material for
+     other material subject to Copyright and Similar Rights by digital
+     file-sharing or similar means is NonCommercial provided there is
+     no payment of monetary compensation in connection with the
+     exchange.
+
+  l. Share means to provide material to the public by any means or
+     process that requires permission under the Licensed Rights, such
+     as reproduction, public display, public performance, distribution,
+     dissemination, communication, or importation, and to make material
+     available to the public including in ways that members of the
+     public may access the material from a place and at a time
+     individually chosen by them.
+
+  m. Sui Generis Database Rights means rights other than copyright
+     resulting from Directive 96/9/EC of the European Parliament and of
+     the Council of 11 March 1996 on the legal protection of databases,
+     as amended and/or succeeded, as well as other essentially
+     equivalent rights anywhere in the world.
+
+  n. You means the individual or entity exercising the Licensed Rights
+     under this Public License. Your has a corresponding meaning.
+
+
+Section 2 -- Scope.
+
+  a. License grant.
+
+       1. Subject to the terms and conditions of this Public License,
+          the Licensor hereby grants You a worldwide, royalty-free,
+          non-sublicensable, non-exclusive, irrevocable license to
+          exercise the Licensed Rights in the Licensed Material to:
+
+            a. reproduce and Share the Licensed Material, in whole or
+               in part, for NonCommercial purposes only; and
+
+            b. produce, reproduce, and Share Adapted Material for
+               NonCommercial purposes only.
+
+       2. Exceptions and Limitations. For the avoidance of doubt, where
+          Exceptions and Limitations apply to Your use, this Public
+          License does not apply, and You do not need to comply with
+          its terms and conditions.
+
+       3. Term. The term of this Public License is specified in Section
+          6(a).
+
+       4. Media and formats; technical modifications allowed. The
+          Licensor authorizes You to exercise the Licensed Rights in
+          all media and formats whether now known or hereafter created,
+          and to make technical modifications necessary to do so. The
+          Licensor waives and/or agrees not to assert any right or
+          authority to forbid You from making technical modifications
+          necessary to exercise the Licensed Rights, including
+          technical modifications necessary to circumvent Effective
+          Technological Measures. For purposes of this Public License,
+          simply making modifications authorized by this Section 2(a)
+          (4) never produces Adapted Material.
+
+       5. Downstream recipients.
+
+            a. Offer from the Licensor -- Licensed Material. Every
+               recipient of the Licensed Material automatically
+               receives an offer from the Licensor to exercise the
+               Licensed Rights under the terms and conditions of this
+               Public License.
+
+            b. Additional offer from the Licensor -- Adapted Material.
+               Every recipient of Adapted Material from You
+               automatically receives an offer from the Licensor to
+               exercise the Licensed Rights in the Adapted Material
+               under the conditions of the Adapter's License You apply.
+
+            c. No downstream restrictions. You may not offer or impose
+               any additional or different terms or conditions on, or
+               apply any Effective Technological Measures to, the
+               Licensed Material if doing so restricts exercise of the
+               Licensed Rights by any recipient of the Licensed
+               Material.
+
+       6. No endorsement. Nothing in this Public License constitutes or
+          may be construed as permission to assert or imply that You
+          are, or that Your use of the Licensed Material is, connected
+          with, or sponsored, endorsed, or granted official status by,
+          the Licensor or others designated to receive attribution as
+          provided in Section 3(a)(1)(A)(i).
+
+  b. Other rights.
+
+       1. Moral rights, such as the right of integrity, are not
+          licensed under this Public License, nor are publicity,
+          privacy, and/or other similar personality rights; however, to
+          the extent possible, the Licensor waives and/or agrees not to
+          assert any such rights held by the Licensor to the limited
+          extent necessary to allow You to exercise the Licensed
+          Rights, but not otherwise.
+
+       2. Patent and trademark rights are not licensed under this
+          Public License.
+
+       3. To the extent possible, the Licensor waives any right to
+          collect royalties from You for the exercise of the Licensed
+          Rights, whether directly or through a collecting society
+          under any voluntary or waivable statutory or compulsory
+          licensing scheme. In all other cases the Licensor expressly
+          reserves any right to collect such royalties, including when
+          the Licensed Material is used other than for NonCommercial
+          purposes.
+
+
+Section 3 -- License Conditions.
+
+Your exercise of the Licensed Rights is expressly made subject to the
+following conditions.
+
+  a. Attribution.
+
+       1. If You Share the Licensed Material (including in modified
+          form), You must:
+
+            a. retain the following if it is supplied by the Licensor
+               with the Licensed Material:
+
+                 i. identification of the creator(s) of the Licensed
+                    Material and any others designated to receive
+                    attribution, in any reasonable manner requested by
+                    the Licensor (including by pseudonym if
+                    designated);
+
+                ii. a copyright notice;
+
+               iii. a notice that refers to this Public License;
+
+                iv. a notice that refers to the disclaimer of
+                    warranties;
+
+                 v. a URI or hyperlink to the Licensed Material to the
+                    extent reasonably practicable;
+
+            b. indicate if You modified the Licensed Material and
+               retain an indication of any previous modifications; and
+
+            c. indicate the Licensed Material is licensed under this
+               Public License, and include the text of, or the URI or
+               hyperlink to, this Public License.
+
+       2. You may satisfy the conditions in Section 3(a)(1) in any
+          reasonable manner based on the medium, means, and context in
+          which You Share the Licensed Material. For example, it may be
+          reasonable to satisfy the conditions by providing a URI or
+          hyperlink to a resource that includes the required
+          information.
+       3. If requested by the Licensor, You must remove any of the
+          information required by Section 3(a)(1)(A) to the extent
+          reasonably practicable.
+
+  b. ShareAlike.
+
+     In addition to the conditions in Section 3(a), if You Share
+     Adapted Material You produce, the following conditions also apply.
+
+       1. The Adapter's License You apply must be a Creative Commons
+          license with the same License Elements, this version or
+          later, or a BY-NC-SA Compatible License.
+
+       2. You must include the text of, or the URI or hyperlink to, the
+          Adapter's License You apply. You may satisfy this condition
+          in any reasonable manner based on the medium, means, and
+          context in which You Share Adapted Material.
+
+       3. You may not offer or impose any additional or different terms
+          or conditions on, or apply any Effective Technological
+          Measures to, Adapted Material that restrict exercise of the
+          rights granted under the Adapter's License You apply.
+
+
+Section 4 -- Sui Generis Database Rights.
+
+Where the Licensed Rights include Sui Generis Database Rights that
+apply to Your use of the Licensed Material:
+
+  a. for the avoidance of doubt, Section 2(a)(1) grants You the right
+     to extract, reuse, reproduce, and Share all or a substantial
+     portion of the contents of the database for NonCommercial purposes
+     only;
+
+  b. if You include all or a substantial portion of the database
+     contents in a database in which You have Sui Generis Database
+     Rights, then the database in which You have Sui Generis Database
+     Rights (but not its individual contents) is Adapted Material,
+     including for purposes of Section 3(b); and
+
+  c. You must comply with the conditions in Section 3(a) if You Share
+     all or a substantial portion of the contents of the database.
+
+For the avoidance of doubt, this Section 4 supplements and does not
+replace Your obligations under this Public License where the Licensed
+Rights include other Copyright and Similar Rights.
+
+
+Section 5 -- Disclaimer of Warranties and Limitation of Liability.
+
+  a. UNLESS OTHERWISE SEPARATELY UNDERTAKEN BY THE LICENSOR, TO THE
+     EXTENT POSSIBLE, THE LICENSOR OFFERS THE LICENSED MATERIAL AS-IS
+     AND AS-AVAILABLE, AND MAKES NO REPRESENTATIONS OR WARRANTIES OF
+     ANY KIND CONCERNING THE LICENSED MATERIAL, WHETHER EXPRESS,
+     IMPLIED, STATUTORY, OR OTHER. THIS INCLUDES, WITHOUT LIMITATION,
+     WARRANTIES OF TITLE, MERCHANTABILITY, FITNESS FOR A PARTICULAR
+     PURPOSE, NON-INFRINGEMENT, ABSENCE OF LATENT OR OTHER DEFECTS,
+     ACCURACY, OR THE PRESENCE OR ABSENCE OF ERRORS, WHETHER OR NOT
+     KNOWN OR DISCOVERABLE. WHERE DISCLAIMERS OF WARRANTIES ARE NOT
+     ALLOWED IN FULL OR IN PART, THIS DISCLAIMER MAY NOT APPLY TO YOU.
+
+  b. TO THE EXTENT POSSIBLE, IN NO EVENT WILL THE LICENSOR BE LIABLE
+     TO YOU ON ANY LEGAL THEORY (INCLUDING, WITHOUT LIMITATION,
+     NEGLIGENCE) OR OTHERWISE FOR ANY DIRECT, SPECIAL, INDIRECT,
+     INCIDENTAL, CONSEQUENTIAL, PUNITIVE, EXEMPLARY, OR OTHER LOSSES,
+     COSTS, EXPENSES, OR DAMAGES ARISING OUT OF THIS PUBLIC LICENSE OR
+     USE OF THE LICENSED MATERIAL, EVEN IF THE LICENSOR HAS BEEN
+     ADVISED OF THE POSSIBILITY OF SUCH LOSSES, COSTS, EXPENSES, OR
+     DAMAGES. WHERE A LIMITATION OF LIABILITY IS NOT ALLOWED IN FULL OR
+     IN PART, THIS LIMITATION MAY NOT APPLY TO YOU.
+
+  c. The disclaimer of warranties and limitation of liability provided
+     above shall be interpreted in a manner that, to the extent
+     possible, most closely approximates an absolute disclaimer and
+     waiver of all liability.
+
+
+Section 6 -- Term and Termination.
+
+  a. This Public License applies for the term of the Copyright and
+     Similar Rights licensed here. However, if You fail to comply with
+     this Public License, then Your rights under this Public License
+     terminate automatically.
+
+  b. Where Your right to use the Licensed Material has terminated under
+     Section 6(a), it reinstates:
+
+       1. automatically as of the date the violation is cured, provided
+          it is cured within 30 days of Your discovery of the
+          violation; or
+
+       2. upon express reinstatement by the Licensor.
+
+     For the avoidance of doubt, this Section 6(b) does not affect any
+     right the Licensor may have to seek remedies for Your violations
+     of this Public License.
+
+  c. For the avoidance of doubt, the Licensor may also offer the
+     Licensed Material under separate terms or conditions or stop
+     distributing the Licensed Material at any time; however, doing so
+     will not terminate this Public License.
+
+  d. Sections 1, 5, 6, 7, and 8 survive termination of this Public
+     License.
+
+
+Section 7 -- Other Terms and Conditions.
+
+  a. The Licensor shall not be bound by any additional or different
+     terms or conditions communicated by You unless expressly agreed.
+
+  b. Any arrangements, understandings, or agreements regarding the
+     Licensed Material not stated herein are separate from and
+     independent of the terms and conditions of this Public License.
+
+
+Section 8 -- Interpretation.
+
+  a. For the avoidance of doubt, this Public License does not, and
+     shall not be interpreted to, reduce, limit, restrict, or impose
+     conditions on any use of the Licensed Material that could lawfully
+     be made without permission under this Public License.
+
+  b. To the extent possible, if any provision of this Public License is
+     deemed unenforceable, it shall be automatically reformed to the
+     minimum extent necessary to make it enforceable. If the provision
+     cannot be reformed, it shall be severed from this Public License
+     without affecting the enforceability of the remaining terms and
+     conditions.
+
+  c. No term or condition of this Public License will be waived and no
+     failure to comply consented to unless expressly agreed to by the
+     Licensor.
+
+  d. Nothing in this Public License constitutes or may be interpreted
+     as a limitation upon, or waiver of, any privileges and immunities
+     that apply to the Licensor or You, including from the legal
+     processes of any jurisdiction or authority.
+
+=======================================================================
+
+Creative Commons is not a party to its public
+licenses. Notwithstanding, Creative Commons may elect to apply one of
+its public licenses to material it publishes and in those instances
+will be considered the “Licensor.” The text of the Creative Commons
+public licenses is dedicated to the public domain under the CC0 Public
+Domain Dedication. Except for the limited purpose of indicating that
+material is shared under a Creative Commons public license or as
+otherwise permitted by the Creative Commons policies published at
+creativecommons.org/policies, Creative Commons does not authorize the
+use of the trademark "Creative Commons" or any other trademark or logo
+of Creative Commons without its prior written consent including,
+without limitation, in connection with any unauthorized modifications
+to any of its public licenses or any other arrangements,
+understandings, or agreements concerning use of licensed material. For
+the avoidance of doubt, this paragraph does not form part of the
+public licenses.
+
+Creative Commons may be contacted at creativecommons.org.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/MakeDb.py	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,1025 @@
+#!/usr/bin/env python3
+"""
+Create tab-delimited database file to store sequence alignment information
+"""
+# Info
+__author__ = 'Namita Gupta, Jason Anthony Vander Heiden'
+from changeo import __version__, __date__
+
+# Imports
+import csv
+import os
+import re
+import sys
+import pandas as pd
+import tarfile
+import zipfile
+from argparse import ArgumentParser
+from collections import OrderedDict
+from itertools import groupby
+from shutil import rmtree
+from tempfile import mkdtemp
+from textwrap import dedent
+from time import time
+from Bio import SeqIO
+from Bio.Seq import Seq
+from Bio.Alphabet import IUPAC
+
+# Presto and changeo imports
+from presto.Defaults import default_out_args
+from presto.Annotation import parseAnnotation
+from presto.IO import countSeqFile, printLog, printProgress
+from changeo.Commandline import CommonHelpFormatter, getCommonArgParser, parseCommonArgs
+from changeo.IO import getDbWriter, countDbFile, getRepo
+from changeo.Receptor import IgRecord, parseAllele, v_allele_regex, d_allele_regex, \
+                             j_allele_regex
+
+# Default parameters
+default_delimiter = ('\t', ',', '-')
+
+
+def gapV(ig_dict, repo_dict):
+    """
+    Insert gaps into V region and update alignment information
+
+    Arguments:
+      ig_dict : Dictionary of parsed IgBlast output
+      repo_dict : Dictionary of IMGT gapped germline sequences
+
+    Returns:
+      dict : Updated with SEQUENCE_IMGT, V_GERM_START_IMGT, and V_GERM_LENGTH_IMGT fields
+    """
+
+    seq_imgt = '.' * (int(ig_dict['V_GERM_START_VDJ'])-1) + ig_dict['SEQUENCE_VDJ']
+
+    # Find gapped germline V segment
+    vgene = parseAllele(ig_dict['V_CALL'], v_allele_regex, 'first')
+    vkey = (vgene, )
+    #TODO: Figure out else case
+    if vkey in repo_dict:
+        vgap = repo_dict[vkey]
+        # Iterate over gaps in the germline segment
+        gaps = re.finditer(r'\.', vgap)
+        gapcount = int(ig_dict['V_GERM_START_VDJ'])-1
+        for gap in gaps:
+            i = gap.start()
+            # Break if gap begins after V region
+            if i >= ig_dict['V_GERM_LENGTH_VDJ'] + gapcount:
+                break
+            # Insert gap into IMGT sequence
+            seq_imgt = seq_imgt[:i] + '.' + seq_imgt[i:]
+            # Update gap counter
+            gapcount += 1
+        ig_dict['SEQUENCE_IMGT'] = seq_imgt
+        # Update IMGT positioning information for V
+        ig_dict['V_GERM_START_IMGT'] = 1
+        ig_dict['V_GERM_LENGTH_IMGT'] = ig_dict['V_GERM_LENGTH_VDJ'] + gapcount
+
+    return ig_dict
+
+
+def getIMGTJunc(ig_dict, repo_dict):
+    """
+    Identify junction region by IMGT definition
+
+    Arguments:
+      ig_dict : Dictionary of parsed IgBlast output
+      repo_dict : Dictionary of IMGT gapped germline sequences
+
+    Returns:
+      dict : Updated with JUNCTION_LENGTH_IMGT and JUNCTION_IMGT fields
+    """
+    # Find germline J segment
+    jgene = parseAllele(ig_dict['J_CALL'], j_allele_regex, 'first')
+    jkey = (jgene, )
+    #TODO: Figure out else case
+    if jkey in repo_dict:
+        # Get germline J sequence
+        jgerm = repo_dict[jkey]
+        jgerm = jgerm[:ig_dict['J_GERM_START']+ig_dict['J_GERM_LENGTH']-1]
+        # Look for (F|W)GXG aa motif in nt sequence
+        motif = re.search(r'T(TT|TC|GG)GG[ACGT]{4}GG[AGCT]', jgerm)
+        aa_end = len(ig_dict['SEQUENCE_IMGT'])
+        #TODO: Figure out else case
+        if motif:
+            # print('\n', motif.group())
+            aa_end = motif.start() - len(jgerm) + 3
+        # Add fields to dict
+        ig_dict['JUNCTION'] = ig_dict['SEQUENCE_IMGT'][309:aa_end]
+        ig_dict['JUNCTION_LENGTH'] = len(ig_dict['JUNCTION'])
+
+    return ig_dict
+
+
+def getRegions(ig_dict):
+    """
+    Identify FWR and CDR regions by IMGT definition
+
+    Arguments:
+      ig_dict : Dictionary of parsed alignment output
+
+    Returns:
+      dict : Updated with FWR1_IMGT, FWR2_IMGT, FWR3_IMGT, FWR4_IMGT,
+             CDR1_IMGT, CDR2_IMGT, and CDR3_IMGT fields
+    """
+    try:
+        seq_len = len(ig_dict['SEQUENCE_IMGT'])
+        ig_dict['FWR1_IMGT'] = ig_dict['SEQUENCE_IMGT'][0:min(78,seq_len)]
+    except (KeyError, IndexError):
+        return ig_dict
+
+    try: ig_dict['CDR1_IMGT'] = ig_dict['SEQUENCE_IMGT'][78:min(114, seq_len)]
+    except (IndexError): return ig_dict
+
+    try: ig_dict['FWR2_IMGT'] = ig_dict['SEQUENCE_IMGT'][114:min(165, seq_len)]
+    except (IndexError): return ig_dict
+
+    try: ig_dict['CDR2_IMGT'] = ig_dict['SEQUENCE_IMGT'][165:min(195, seq_len)]
+    except (IndexError): return ig_dict
+
+    try: ig_dict['FWR3_IMGT'] = ig_dict['SEQUENCE_IMGT'][195:min(312, seq_len)]
+    except (IndexError): return ig_dict
+
+    try:
+        cdr3_end = 306 + ig_dict['JUNCTION_LENGTH']
+        ig_dict['CDR3_IMGT'] = ig_dict['SEQUENCE_IMGT'][312:cdr3_end]
+        ig_dict['FWR4_IMGT'] = ig_dict['SEQUENCE_IMGT'][cdr3_end:]
+    except (KeyError, IndexError):
+        return ig_dict
+
+    return ig_dict
+
+
+def getSeqforIgBlast(seq_file):
+    """
+    Fetch input sequences for IgBlast queries
+
+    Arguments:
+    seq_file = a fasta file of sequences input to IgBlast
+
+    Returns:
+    a dictionary of {ID:Seq}
+    """
+
+    seq_dict = SeqIO.index(seq_file, "fasta", IUPAC.ambiguous_dna)
+
+    # Create a seq_dict ID translation using IDs truncate up to space or 50 chars
+    seqs = {}
+    for seq in seq_dict.values():
+        seqs.update({seq.description:str(seq.seq)})
+
+    return seqs
+
+
+def findLine(handle, query):
+    """
+    Finds line with query string in file
+
+    Arguments:
+    handle = file handle in which to search for line
+    query = query string for which to search in file
+
+    Returns:
+    line from handle in which query string was found
+    """
+    for line in handle:
+        if(re.match(query, line)):
+            return line
+
+
+def extractIMGT(imgt_output):
+    """
+    Extract necessary files from IMGT results, zipped or unzipped
+    
+    Arguments:
+    imgt_output = zipped file or unzipped folder output by IMGT
+    
+    Returns:
+    sorted list of filenames from which information will be read
+    """
+    #file_ext = os.path.splitext(imgt_output)[1].lower()
+    imgt_flags = ('1_Summary', '2_IMGT-gapped', '3_Nt-sequences', '6_Junction')
+    temp_dir = mkdtemp()
+    if zipfile.is_zipfile(imgt_output):
+        # Open zip file
+        imgt_zip = zipfile.ZipFile(imgt_output, 'r')
+        # Extract required files
+        imgt_files = sorted([n for n in imgt_zip.namelist() \
+                             if os.path.basename(n).startswith(imgt_flags)])
+        imgt_zip.extractall(temp_dir, imgt_files)
+        # Define file list
+        imgt_files = [os.path.join(temp_dir, f) for f in imgt_files]
+    elif os.path.isdir(imgt_output):
+        # Find required files in folder
+        folder_files = []
+        for root, dirs, files in os.walk(imgt_output):
+            folder_files.extend([os.path.join(os.path.abspath(root), f) for f in files])
+        # Define file list
+        imgt_files = sorted([n for n in folder_files \
+                             if os.path.basename(n).startswith(imgt_flags)])
+    elif tarfile.is_tarfile(imgt_output):
+        # Open zip file
+        imgt_tar = tarfile.open(imgt_output, 'r')
+        # Extract required files
+        imgt_files = sorted([n for n in imgt_tar.getnames() \
+                             if os.path.basename(n).startswith(imgt_flags)])
+        imgt_tar.extractall(temp_dir, [imgt_tar.getmember(n) for n in imgt_files])
+        # Define file list
+        imgt_files = [os.path.join(temp_dir, f) for f in imgt_files]
+    else:
+        sys.exit('ERROR: Unsupported IGMT output file. Must be either a zipped file (.zip), LZMA compressed tarfile (.txz) or a folder.')
+    
+    if len(imgt_files) > len(imgt_flags): # e.g. multiple 1_Summary files
+        sys.exit('ERROR: Wrong files in IMGT output %s.' % imgt_output)
+    elif len(imgt_files) < len(imgt_flags):
+        sys.exit('ERROR: Missing necessary file IMGT output %s.' % imgt_output)
+        
+    return temp_dir, imgt_files
+
+
+# TODO: return a dictionary with keys determined by the comment strings in the blocks, thus avoiding problems with missing blocks
+def readOneIgBlastResult(block):
+    """
+    Parse a single IgBLAST query result
+
+    Arguments:
+    block =  itertools groupby object of single result
+
+    Returns:
+    None if no results, otherwise list of DataFrames for each result block
+    """
+    results = list()
+    i = 0
+    for match, subblock in groupby(block, lambda l: l=='\n'):
+        if not match:
+            # Strip whitespace and comments
+            sub = [s.strip() for s in subblock if not s.startswith('#')]
+
+            # Continue on empty block
+            if not sub:  continue
+            else:  i += 1
+
+            # Split by tabs
+            sub = [s.split('\t') for s in sub]
+
+            # Append list for "V-(D)-J rearrangement summary" (i == 1)
+            # And "V-(D)-J junction details" (i == 2)
+            # Otherwise append DataFrame of subblock
+            if i == 1 or i == 2:
+                results.append(sub[0])
+            else:
+                df = pd.DataFrame(sub)
+                if not df.empty: results.append(df)
+
+    return results if results else None
+
+
+# TODO:  needs more speeds. pandas is probably to blame.
+def readIgBlast(igblast_output, seq_dict, repo_dict,
+                score_fields=False, region_fields=False):
+    """
+    Reads IgBlast output
+
+    Arguments:
+    igblast_output = IgBlast output file (format 7)
+    seq_dict = a dictionary of {ID:Seq} from input fasta file
+    repo_dict = dictionary of IMGT gapped germline sequences
+    score_fields = if True parse alignment scores
+    region_fields = if True add FWR and CDR region fields
+
+    Returns:
+    a generator of dictionaries containing alignment data
+    """
+
+    # Open IgBlast output file
+    with open(igblast_output) as f:
+        # Iterate over individual results (separated by # IGBLASTN)
+        for k1, block in groupby(f, lambda x: re.match('# IGBLASTN', x)):
+            block = list(block)
+            if not k1:
+                # TODO: move query name extraction into block parser readOneIgBlastResult().
+                # Extract sequence ID
+                query_name = ' '.join(block[0].strip().split(' ')[2:])
+                # Initialize db_gen to have ID and input sequence
+                db_gen = {'SEQUENCE_ID':     query_name,
+                          'SEQUENCE_INPUT':  seq_dict[query_name]}
+
+                # Parse further sub-blocks
+                block_list = readOneIgBlastResult(block)
+
+                # TODO: this is indented pretty far.  should be a separate function. or several functions.
+                # If results exist, parse further to obtain full db_gen
+                if block_list is not None:
+                    # Parse quality information
+                    db_gen['STOP'] = 'T' if block_list[0][-4] == 'Yes' else 'F'
+                    db_gen['IN_FRAME'] = 'T' if block_list[0][-3] == 'In-frame' else 'F'
+                    db_gen['FUNCTIONAL'] = 'T' if block_list[0][-2] == 'Yes' else 'F'
+                    if block_list[0][-1] == '-':
+                        db_gen['SEQUENCE_INPUT'] = str(Seq(db_gen['SEQUENCE_INPUT'],
+                                                           IUPAC.ambiguous_dna).reverse_complement())
+
+                    # Parse V, D, and J calls
+                    call_str = ' '.join(block_list[0])
+                    v_call = parseAllele(call_str, v_allele_regex, action='list')
+                    d_call = parseAllele(call_str, d_allele_regex, action='list')
+                    j_call = parseAllele(call_str, j_allele_regex, action='list')
+                    db_gen['V_CALL'] = ','.join(v_call) if v_call is not None else 'None'
+                    db_gen['D_CALL'] = ','.join(d_call) if d_call is not None else 'None'
+                    db_gen['J_CALL'] = ','.join(j_call) if j_call is not None else 'None'
+
+                    # Parse junction sequence
+                    # db_gen['JUNCTION_VDJ'] = re.sub('(N/A)|\[|\(|\)|\]', '', ''.join(block_list[1]))
+                    # db_gen['JUNCTION_LENGTH_VDJ'] = len(db_gen['JUNCTION_VDJ'])
+
+                    # TODO:  IgBLAST does a stupid and doesn't output block #3 sometimes. why?
+                    # TODO:  maybe we should fail these. they look craptastic.
+                    #pd.set_option('display.width', 500)
+                    #print query_name, len(block_list), hit_idx
+                    #for i, x in enumerate(block_list):
+                    #    print '[%i]' % i
+                    #    print x
+
+                    # Parse segment start and stop positions
+                    hit_df = block_list[-1]
+
+                    # Alignment info block
+                    #  0:  segment
+                    #  1:  query id
+                    #  2:  subject id
+                    #  3:  % identity
+                    #  4:  alignment length
+                    #  5:  mismatches
+                    #  6:  gap opens
+                    #  7:  gaps
+                    #  8:  q. start
+                    #  9:  q. end
+                    # 10:  s. start
+                    # 11:  s. end
+                    # 12:  evalue
+                    # 13:  bit score
+                    # 14:  query seq
+                    # 15:  subject seq
+                    # 16:  btop
+
+                    # If V call exists, parse V alignment information
+                    seq_vdj = ''
+                    if v_call is not None:
+                        v_align = hit_df[hit_df[0] == 'V'].iloc[0]
+                        # Germline positions
+                        db_gen['V_GERM_START_VDJ'] = int(v_align[10])
+                        db_gen['V_GERM_LENGTH_VDJ'] = int(v_align[11]) - db_gen['V_GERM_START_VDJ'] + 1
+                        # Query sequence positions
+                        db_gen['V_SEQ_START'] = int(v_align[8])
+                        db_gen['V_SEQ_LENGTH'] = int(v_align[9]) - db_gen['V_SEQ_START'] + 1
+
+                        if int(v_align[6]) == 0:
+                            db_gen['INDELS'] = 'F'
+                        else:
+                            db_gen['INDELS'] = 'T'
+                            # Set functional to none so record gets tossed (junction will be wrong)
+                            # db_gen['FUNCTIONAL'] = None
+
+                        # V alignment scores
+                        if score_fields:
+                            try: db_gen['V_SCORE'] = float(v_align[13])
+                            except (TypeError, ValueError): db_gen['V_SCORE'] = 'None'
+
+                            try: db_gen['V_IDENTITY'] = float(v_align[3]) / 100.0
+                            except (TypeError, ValueError): db_gen['V_IDENTITY'] = 'None'
+
+                            try: db_gen['V_EVALUE'] = float(v_align[12])
+                            except (TypeError, ValueError): db_gen['V_EVALUE'] = 'None'
+
+                            try: db_gen['V_BTOP'] = v_align[16]
+                            except (TypeError, ValueError): db_gen['V_BTOP'] = 'None'
+
+                        # Update VDJ sequence, removing insertions
+                        start = 0
+                        for m in re.finditer(r'-', v_align[15]):
+                            ins = m.start()
+                            seq_vdj += v_align[14][start:ins]
+                            start = ins + 1
+                        seq_vdj += v_align[14][start:]
+
+                    # TODO:  needs to check that the V results are present before trying to determine N1_LENGTH from them.
+                    # If D call exists, parse D alignment information
+                    if d_call is not None:
+                        d_align = hit_df[hit_df[0] == 'D'].iloc[0]
+
+                        # TODO:  this is kinda gross.  not sure how else to fix the alignment overlap problem though.
+                        # Determine N-region length and amount of J overlap with V or D alignment
+                        overlap = 0
+                        if v_call is not None:
+                            n1_len = int(d_align[8]) - (db_gen['V_SEQ_START'] + db_gen['V_SEQ_LENGTH'])
+                            if n1_len < 0:
+                                db_gen['N1_LENGTH'] = 0
+                                overlap = abs(n1_len)
+                            else:
+                                db_gen['N1_LENGTH'] = n1_len
+                                n1_start = (db_gen['V_SEQ_START'] + db_gen['V_SEQ_LENGTH']-1)
+                                n1_end = int(d_align[8])-1
+                                seq_vdj += db_gen['SEQUENCE_INPUT'][n1_start:n1_end]
+
+                        # Query sequence positions
+                        db_gen['D_SEQ_START'] = int(d_align[8]) + overlap
+                        db_gen['D_SEQ_LENGTH'] = max(int(d_align[9]) - db_gen['D_SEQ_START'] + 1, 0)
+
+                        # Germline positions
+                        db_gen['D_GERM_START'] = int(d_align[10]) + overlap
+                        db_gen['D_GERM_LENGTH'] = max(int(d_align[11]) - db_gen['D_GERM_START'] + 1, 0)
+
+                        # Update VDJ sequence, removing insertions
+                        start = overlap
+                        for m in re.finditer(r'-', d_align[15]):
+                            ins = m.start()
+                            seq_vdj += d_align[14][start:ins]
+                            start = ins + 1
+                        seq_vdj += d_align[14][start:]
+
+                    # TODO:  needs to check that the V results are present before trying to determine N1_LENGTH from them.
+                    # If J call exists, parse J alignment information
+                    if j_call is not None:
+                        j_align = hit_df[hit_df[0] == 'J'].iloc[0]
+
+                        # TODO:  this is kinda gross.  not sure how else to fix the alignment overlap problem though.
+                        # Determine N-region length and amount of J overlap with V or D alignment
+                        overlap = 0
+                        if d_call is not None:
+                            n2_len = int(j_align[8]) - (db_gen['D_SEQ_START'] + db_gen['D_SEQ_LENGTH'])
+                            if n2_len < 0:
+                                db_gen['N2_LENGTH'] = 0
+                                overlap = abs(n2_len)
+                            else:
+                                db_gen['N2_LENGTH'] = n2_len
+                                n2_start = (db_gen['D_SEQ_START']+db_gen['D_SEQ_LENGTH']-1)
+                                n2_end = int(j_align[8])-1
+                                seq_vdj += db_gen['SEQUENCE_INPUT'][n2_start:n2_end]
+                        elif v_call is not None:
+                            n1_len = int(j_align[8]) - (db_gen['V_SEQ_START'] + db_gen['V_SEQ_LENGTH'])
+                            if n1_len < 0:
+                                db_gen['N1_LENGTH'] = 0
+                                overlap = abs(n1_len)
+                            else:
+                                db_gen['N1_LENGTH'] = n1_len
+                                n1_start = (db_gen['V_SEQ_START']+db_gen['V_SEQ_LENGTH']-1)
+                                n1_end = int(j_align[8])-1
+                                seq_vdj += db_gen['SEQUENCE_INPUT'][n1_start:n1_end]
+                        else:
+                            db_gen['N1_LENGTH'] = 0
+
+                        # Query positions
+                        db_gen['J_SEQ_START'] = int(j_align[8]) + overlap
+                        db_gen['J_SEQ_LENGTH'] = max(int(j_align[9]) - db_gen['J_SEQ_START'] + 1, 0)
+
+                        # Germline positions
+                        db_gen['J_GERM_START'] = int(j_align[10]) + overlap
+                        db_gen['J_GERM_LENGTH'] = max(int(j_align[11]) - db_gen['J_GERM_START'] + 1, 0)
+
+                        # J alignment scores
+                        if score_fields:
+                            try: db_gen['J_SCORE'] = float(j_align[13])
+                            except (TypeError, ValueError): db_gen['J_SCORE'] = 'None'
+
+                            try: db_gen['J_IDENTITY'] = float(j_align[3]) / 100.0
+                            except (TypeError, ValueError): db_gen['J_IDENTITY'] = 'None'
+
+                            try: db_gen['J_EVALUE'] = float(j_align[12])
+                            except (TypeError, ValueError): db_gen['J_EVALUE'] = 'None'
+
+                            try: db_gen['J_BTOP'] = j_align[16]
+                            except (TypeError, ValueError): db_gen['J_BTOP'] = 'None'
+
+                        # Update VDJ sequence, removing insertions
+                        start = overlap
+                        for m in re.finditer(r'-', j_align[15]):
+                            ins = m.start()
+                            seq_vdj += j_align[14][start:ins]
+                            start = ins + 1
+                        seq_vdj += j_align[14][start:]
+
+                    db_gen['SEQUENCE_VDJ'] = seq_vdj
+
+                    # Create IMGT-gapped sequence and infer IMGT junction
+                    if v_call is not None:
+                        db_gen = gapV(db_gen, repo_dict)
+                        if j_call is not None:
+                            db_gen = getIMGTJunc(db_gen, repo_dict)
+
+                    # FWR and CDR regions
+                    if region_fields: getRegions(db_gen)
+
+                yield IgRecord(db_gen)
+
+
+# TODO:  should be more readable
+def readIMGT(imgt_files, score_fields=False, region_fields=False):
+    """
+    Reads IMGT/HighV-Quest output
+
+    Arguments: 
+    imgt_files = IMGT/HighV-Quest output files 1, 2, 3, and 6
+    score_fields = if True parse alignment scores
+    region_fields = if True add FWR and CDR region fields
+    
+    Returns: 
+    a generator of dictionaries containing alignment data
+    """
+    imgt_iters = [csv.DictReader(open(f, 'rU'), delimiter='\t') for f in imgt_files]
+    # Create a dictionary for each sequence alignment and yield its generator
+    for sm, gp, nt, jn in zip(*imgt_iters):
+        if len(set([sm['Sequence ID'],
+                    gp['Sequence ID'],
+                    nt['Sequence ID'],
+                    jn['Sequence ID']])) != 1:
+            sys.exit('Error: IMGT files are corrupt starting with Summary file record %s' \
+                     % sm['Sequence ID'])
+
+        db_gen = {'SEQUENCE_ID': sm['Sequence ID'],
+                  'SEQUENCE_INPUT': sm['Sequence']}
+
+        if 'No results' not in sm['Functionality']:
+            db_gen['FUNCTIONAL'] = ['?','T','F'][('productive' in sm['Functionality']) +
+                                                 ('unprod' in sm['Functionality'])]
+            db_gen['IN_FRAME'] = ['?','T','F'][('in-frame' in sm['JUNCTION frame']) +
+                                               ('out-of-frame' in sm['JUNCTION frame'])],
+            db_gen['STOP'] = ['F','?','T'][('stop codon' in sm['Functionality comment']) +
+                                           ('unprod' in sm['Functionality'])]
+            db_gen['MUTATED_INVARIANT'] = ['F','?','T'][(any(('missing' in sm['Functionality comment'],
+                                                         'missing' in sm['V-REGION potential ins/del']))) +
+                                                         ('unprod' in sm['Functionality'])]
+            db_gen['INDELS'] = ['F','T'][any((sm['V-REGION potential ins/del'],
+                                              sm['V-REGION insertions'],
+                                              sm['V-REGION deletions']))]
+
+            db_gen['SEQUENCE_VDJ'] = nt['V-D-J-REGION'] if nt['V-D-J-REGION'] else nt['V-J-REGION']
+            db_gen['SEQUENCE_IMGT'] = gp['V-D-J-REGION'] if gp['V-D-J-REGION'] else gp['V-J-REGION']
+
+            db_gen['V_CALL'] = re.sub('\sor\s', ',', re.sub(',', '', gp['V-GENE and allele']))
+            db_gen['D_CALL'] = re.sub('\sor\s', ',', re.sub(',', '', gp['D-GENE and allele']))
+            db_gen['J_CALL'] = re.sub('\sor\s', ',', re.sub(',', '', gp['J-GENE and allele']))
+
+            v_seq_length = len(nt['V-REGION']) if nt['V-REGION'] else 0
+            db_gen['V_SEQ_START'] = nt['V-REGION start']
+            db_gen['V_SEQ_LENGTH'] = v_seq_length
+            db_gen['V_GERM_START_IMGT'] = 1
+            db_gen['V_GERM_LENGTH_IMGT'] = len(gp['V-REGION']) if gp['V-REGION'] else 0
+
+            db_gen['N1_LENGTH'] = sum(int(i) for i in [jn["P3'V-nt nb"],
+                                                       jn['N-REGION-nt nb'],
+                                                       jn['N1-REGION-nt nb'],
+                                                       jn["P5'D-nt nb"]] if i)
+            db_gen['D_SEQ_START'] = sum(int(i) for i in [1, v_seq_length,
+                                                         jn["P3'V-nt nb"],
+                                                         jn['N-REGION-nt nb'],
+                                                         jn['N1-REGION-nt nb'],
+                                                         jn["P5'D-nt nb"]] if i)
+            db_gen['D_SEQ_LENGTH'] = int(jn["D-REGION-nt nb"] or 0)
+            db_gen['D_GERM_START'] = int(jn["5'D-REGION trimmed-nt nb"] or 0) + 1
+            db_gen['D_GERM_LENGTH'] = int(jn["D-REGION-nt nb"] or 0)
+            db_gen['N2_LENGTH'] = sum(int(i) for i in [jn["P3'D-nt nb"],
+                                                       jn['N2-REGION-nt nb'],
+                                                       jn["P5'J-nt nb"]] if i)
+
+            db_gen['J_SEQ_START_IMGT'] = sum(int(i) for i in [1, v_seq_length,
+                                                         jn["P3'V-nt nb"],
+                                                         jn['N-REGION-nt nb'],
+                                                         jn['N1-REGION-nt nb'],
+                                                         jn["P5'D-nt nb"],
+                                                         jn["D-REGION-nt nb"],
+                                                         jn["P3'D-nt nb"],
+                                                         jn['N2-REGION-nt nb'],
+                                                         jn["P5'J-nt nb"]] if i)
+            db_gen['J_SEQ_LENGTH'] = len(nt['J-REGION']) if nt['J-REGION'] else 0
+            db_gen['J_GERM_START'] = int(jn["5'J-REGION trimmed-nt nb"] or 0) + 1
+            db_gen['J_GERM_LENGTH'] = len(gp['J-REGION']) if gp['J-REGION'] else 0
+
+            db_gen['JUNCTION_LENGTH'] = len(jn['JUNCTION']) if jn['JUNCTION'] else 0
+            db_gen['JUNCTION'] = jn['JUNCTION']
+
+            # Alignment scores
+            if score_fields:
+                try:  db_gen['V_SCORE'] = float(sm['V-REGION score'])
+                except (TypeError, ValueError):  db_gen['V_SCORE'] = 'None'
+
+                try:  db_gen['V_IDENTITY'] = float(sm['V-REGION identity %']) / 100.0
+                except (TypeError, ValueError):  db_gen['V_IDENTITY'] = 'None'
+
+                try:  db_gen['J_SCORE'] = float(sm['J-REGION score'])
+                except (TypeError, ValueError):  db_gen['J_SCORE'] = 'None'
+
+                try:  db_gen['J_IDENTITY'] = float(sm['J-REGION identity %']) / 100.0
+                except (TypeError, ValueError):  db_gen['J_IDENTITY'] = 'None'
+
+            # FWR and CDR regions
+            if region_fields: getRegions(db_gen)
+        else:
+            db_gen['V_CALL'] = 'None'
+            db_gen['D_CALL'] = 'None'
+            db_gen['J_CALL'] = 'None'
+
+        yield IgRecord(db_gen)
+
+    
+def getIDforIMGT(seq_file):
+    """
+    Create a sequence ID translation using IMGT truncation
+    
+    Arguments: 
+    seq_file = a fasta file of sequences input to IMGT
+                    
+    Returns: 
+    a dictionary of {truncated ID: full seq description} 
+    """
+    
+    # Create a seq_dict ID translation using IDs truncate up to space or 50 chars
+    ids = {}
+    for i, rec in enumerate(SeqIO.parse(seq_file, 'fasta', IUPAC.ambiguous_dna)):
+        if len(rec.description) <= 50:
+            id_key = rec.description
+        else:
+            id_key = re.sub('\||\s|!|&|\*|<|>|\?','_',rec.description[:50])
+        ids.update({id_key:rec.description})
+
+    return ids
+
+
+def writeDb(db_gen, file_prefix, total_count, id_dict={}, no_parse=True,
+            score_fields=False, region_fields=False, out_args=default_out_args):
+    """
+    Writes tab-delimited database file in output directory
+    
+    Arguments:
+    db_gen = a generator of IgRecord objects containing alignment data
+    file_prefix = directory and prefix for CLIP tab-delim file
+    total_count = number of records (for progress bar)
+    id_dict = a dictionary of {IMGT ID: full seq description}
+    no_parse = if ID is to be parsed for pRESTO output with default delimiters
+    score_fields = if True add alignment score fields to output file
+    region_fields = if True add FWR and CDR region fields to output file
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    None
+    """
+    pass_file = "%s_db-pass.tab" % file_prefix
+    fail_file = "%s_db-fail.tab" % file_prefix
+    ordered_fields = ['SEQUENCE_ID',
+                      'SEQUENCE_INPUT',
+                      'FUNCTIONAL',
+                      'IN_FRAME',
+                      'STOP',
+                      'MUTATED_INVARIANT',
+                      'INDELS',
+                      'V_CALL',
+                      'D_CALL',
+                      'J_CALL',
+                      'SEQUENCE_VDJ',
+                      'SEQUENCE_IMGT',
+                      'V_SEQ_START',
+                      'V_SEQ_LENGTH',
+                      'V_GERM_START_VDJ',
+                      'V_GERM_LENGTH_VDJ',
+                      'V_GERM_START_IMGT',
+                      'V_GERM_LENGTH_IMGT',
+                      'N1_LENGTH',
+                      'D_SEQ_START',
+                      'D_SEQ_LENGTH',
+                      'D_GERM_START',
+                      'D_GERM_LENGTH',
+                      'N2_LENGTH',
+                      'J_SEQ_START',
+                      'J_SEQ_LENGTH',
+                      'J_GERM_START',
+                      'J_GERM_LENGTH',
+                      'JUNCTION_LENGTH',
+                      'JUNCTION']
+
+    if score_fields:
+        ordered_fields.extend(['V_SCORE',
+                               'V_IDENTITY',
+                               'V_EVALUE',
+                               'V_BTOP',
+                               'J_SCORE',
+                               'J_IDENTITY',
+                               'J_EVALUE',
+                               'J_BTOP'])
+
+    if region_fields:
+        ordered_fields.extend(['FWR1_IMGT', 'FWR2_IMGT', 'FWR3_IMGT', 'FWR4_IMGT',
+                               'CDR1_IMGT', 'CDR2_IMGT', 'CDR3_IMGT'])
+
+
+    # TODO:  This is not the best approach. should pass in output fields.
+    # Initiate passed handle
+    pass_handle = None
+
+    # Open failed file
+    if out_args['failed']:
+        fail_handle = open(fail_file, 'wt')
+        fail_writer = getDbWriter(fail_handle, add_fields=['SEQUENCE_ID', 'SEQUENCE_INPUT'])
+    else:
+        fail_handle = None
+        fail_writer = None
+
+    # Initialize counters and file
+    pass_writer = None
+    start_time = time()
+    rec_count = pass_count = fail_count = 0
+    for record in db_gen:
+        #printProgress(i + (total_count/2 if id_dict else 0), total_count, 0.05, start_time)
+        printProgress(rec_count, total_count, 0.05, start_time)
+        rec_count += 1
+
+        # Count pass or fail
+        if (record.v_call == 'None' and record.j_call == 'None') or \
+                record.functional is None or \
+                not record.seq_vdj or \
+                not record.junction:
+            # print(record.v_call, record.j_call, record.functional, record.junction)
+            fail_count += 1
+            if fail_writer is not None: fail_writer.writerow(record.toDict())
+            continue
+        else: 
+            pass_count += 1
+            
+        # Build sample sequence description
+        if record.id in id_dict:
+            record.id = id_dict[record.id]
+
+        # Parse sequence description into new columns
+        if not no_parse:
+            record.annotations = parseAnnotation(record.id, delimiter=out_args['delimiter'])
+            record.id = record.annotations['ID']
+            del record.annotations['ID']
+
+        # TODO:  This is not the best approach. should pass in output fields.
+        # If first sequence, use parsed description to create new columns and initialize writer
+        if pass_writer is None:
+            if not no_parse:  ordered_fields.extend(list(record.annotations.keys()))
+            pass_handle = open(pass_file, 'wt')
+            pass_writer = getDbWriter(pass_handle, add_fields=ordered_fields)
+
+        # Write row to tab-delim CLIP file
+        pass_writer.writerow(record.toDict())
+    
+    # Print log
+    #printProgress(i+1 + (total_count/2 if id_dict else 0), total_count, 0.05, start_time)
+    printProgress(rec_count, total_count, 0.05, start_time)
+
+    log = OrderedDict()
+    log['OUTPUT'] = pass_file
+    log['PASS'] = pass_count
+    log['FAIL'] = fail_count
+    log['END'] = 'MakeDb'
+    printLog(log)
+    
+    if pass_handle is not None: pass_handle.close()
+    if fail_handle is not None: fail_handle.close()
+
+
+# TODO:  may be able to merge with parseIMGT
+def parseIgBlast(igblast_output, seq_file, repo, no_parse=True, score_fields=False,
+                 region_fields=False, out_args=default_out_args):
+    """
+    Main for IgBlast aligned sample sequences
+
+    Arguments:
+    igblast_output = IgBlast output file to process
+    seq_file = fasta file input to IgBlast (from which to get sequence)
+    repo = folder with germline repertoire files
+    no_parse = if ID is to be parsed for pRESTO output with default delimiters
+    score_fields = if True add alignment score fields to output file
+    region_fields = if True add FWR and CDR region fields to output file
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    None
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'MakeDB'
+    log['ALIGNER'] = 'IgBlast'
+    log['ALIGN_RESULTS'] = os.path.basename(igblast_output)
+    log['SEQ_FILE'] = os.path.basename(seq_file)
+    log['NO_PARSE'] = no_parse
+    log['SCORE_FIELDS'] = score_fields
+    log['REGION_FIELDS'] = region_fields
+    printLog(log)
+
+    # Get input sequence dictionary
+    seq_dict = getSeqforIgBlast(seq_file)
+
+    # Formalize out_dir and file-prefix
+    if not out_args['out_dir']:
+        out_dir = os.path.split(igblast_output)[0]
+    else:
+        out_dir = os.path.abspath(out_args['out_dir'])
+        if not os.path.exists(out_dir):  os.mkdir(out_dir)
+    if out_args['out_name']:
+        file_prefix = out_args['out_name']
+    else:
+        file_prefix = os.path.basename(os.path.splitext(igblast_output)[0])
+    file_prefix = os.path.join(out_dir, file_prefix)
+
+    total_count = countSeqFile(seq_file)
+
+    # Create
+    repo_dict = getRepo(repo)
+    igblast_dict = readIgBlast(igblast_output, seq_dict, repo_dict,
+                               score_fields=score_fields, region_fields=region_fields)
+    writeDb(igblast_dict, file_prefix, total_count, no_parse=no_parse,
+            score_fields=score_fields, region_fields=region_fields, out_args=out_args)
+
+
+# TODO:  may be able to merge with parseIgBlast
+def parseIMGT(imgt_output, seq_file=None, no_parse=True, score_fields=False,
+              region_fields=False, out_args=default_out_args):
+    """
+    Main for IMGT aligned sample sequences
+
+    Arguments:
+    imgt_output = zipped file or unzipped folder output by IMGT
+    seq_file = FASTA file input to IMGT (from which to get seqID)
+    no_parse = if ID is to be parsed for pRESTO output with default delimiters
+    score_fields = if True add alignment score fields to output file
+    region_fields = if True add FWR and CDR region fields to output file
+    out_args = common output argument dictionary from parseCommonArgs
+        
+    Returns: 
+    None
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'MakeDb'
+    log['ALIGNER'] = 'IMGT'
+    log['ALIGN_RESULTS'] = imgt_output
+    log['SEQ_FILE'] = os.path.basename(seq_file) if seq_file else ''
+    log['NO_PARSE'] = no_parse
+    log['SCORE_FIELDS'] = score_fields
+    log['REGION_FIELDS'] = region_fields
+    printLog(log)
+    
+    # Get individual IMGT result files
+    temp_dir, imgt_files = extractIMGT(imgt_output)
+        
+    # Formalize out_dir and file-prefix
+    if not out_args['out_dir']:
+        out_dir = os.path.dirname(os.path.abspath(imgt_output))
+    else:
+        out_dir = os.path.abspath(out_args['out_dir'])
+        if not os.path.exists(out_dir):  os.mkdir(out_dir)
+    if out_args['out_name']:
+        file_prefix = out_args['out_name']
+    else:
+        file_prefix = os.path.splitext(os.path.split(os.path.abspath(imgt_output))[1])[0]
+    file_prefix = os.path.join(out_dir, file_prefix)
+
+    total_count = countDbFile(imgt_files[0])
+    
+    # Get (parsed) IDs from fasta file submitted to IMGT
+    id_dict = getIDforIMGT(seq_file) if seq_file else {}
+    
+    # Create
+    imgt_dict = readIMGT(imgt_files, score_fields=score_fields,
+                         region_fields=region_fields)
+    writeDb(imgt_dict, file_prefix, total_count, id_dict=id_dict, no_parse=no_parse,
+            score_fields=score_fields, region_fields=region_fields, out_args=out_args)
+
+    # Delete temp directory
+    rmtree(temp_dir)
+
+
+def getArgParser():
+    """
+    Defines the ArgumentParser
+
+    Arguments: 
+    None
+                      
+    Returns: 
+    an ArgumentParser object
+    """
+    fields = dedent(
+             '''
+              output files:
+                  db-pass
+                      database of parsed alignment records.
+                  db-fail
+                      database with records failing alignment.
+
+              output fields:
+                  SEQUENCE_ID, SEQUENCE_INPUT, FUNCTIONAL, IN_FRAME, STOP, MUTATED_INVARIANT,
+                  INDELS, V_CALL, D_CALL, J_CALL, SEQUENCE_VDJ and/or SEQUENCE_IMGT,
+                  V_SEQ_START, V_SEQ_LENGTH, V_GERM_START_VDJ and/or V_GERM_START_IMGT,
+                  V_GERM_LENGTH_VDJ and/or V_GERM_LENGTH_IMGT, N1_LENGTH,
+                  D_SEQ_START, D_SEQ_LENGTH, D_GERM_START, D_GERM_LENGTH, N2_LENGTH,
+                  J_SEQ_START, J_SEQ_LENGTH, J_GERM_START, J_GERM_LENGTH,
+                  JUNCTION_LENGTH, JUNCTION, V_SCORE, V_IDENTITY, V_EVALUE, V_BTOP,
+                  J_SCORE, J_IDENTITY, J_EVALUE, J_BTOP, FWR1_IMGT, FWR2_IMGT, FWR3_IMGT,
+                  FWR4_IMGT, CDR1_IMGT, CDR2_IMGT, CDR3_IMGT
+              ''')
+                
+    # Define ArgumentParser
+    parser = ArgumentParser(description=__doc__, epilog=fields,
+                            formatter_class=CommonHelpFormatter)
+    parser.add_argument('--version', action='version',
+                        version='%(prog)s:' + ' %s-%s' %(__version__, __date__))
+    subparsers = parser.add_subparsers(title='subcommands', dest='command',
+                                       help='Aligner used', metavar='')
+    # TODO:  This is a temporary fix for Python issue 9253
+    subparsers.required = True
+
+    # Parent parser    
+    parser_parent = getCommonArgParser(seq_in=False, seq_out=False, log=False)
+
+    # IgBlast Aligner
+    parser_igblast = subparsers.add_parser('igblast', help='Process IgBlast output',
+                                           parents=[parser_parent],
+                                           formatter_class=CommonHelpFormatter)
+    parser_igblast.set_defaults(func=parseIgBlast)
+    parser_igblast.add_argument('-i', nargs='+', action='store', dest='aligner_files',
+                                required=True,
+                                help='''IgBLAST output files in format 7 with query sequence
+                                     (IgBLAST argument \'-outfmt "7 std qseq sseq btop"\').''')
+    parser_igblast.add_argument('-r', nargs='+', action='store', dest='repo', required=True,
+                                help='''List of folders and/or fasta files containing
+                                     IMGT-gapped germline sequences corresponding to the
+                                     set of germlines used in the IgBLAST alignment.''')
+    parser_igblast.add_argument('-s', action='store', nargs='+', dest='seq_files',
+                                required=True,
+                                help='List of input FASTA files containing sequences')
+    parser_igblast.add_argument('--noparse', action='store_true', dest='no_parse',
+                                help='''Specify if input IDs should not be parsed to add
+                                     new columns to database.''')
+    parser_igblast.add_argument('--scores', action='store_true', dest='score_fields',
+                                help='''Specify if alignment score metrics should be
+                                     included in the output. Adds the V_SCORE, V_IDENTITY,
+                                     V_EVALUE, V_BTOP, J_SCORE, J_IDENTITY,
+                                     J_BTOP, and J_EVALUE columns.''')
+    parser_igblast.add_argument('--regions', action='store_true', dest='region_fields',
+                                help='''Specify if IMGT framework and CDR regions should be
+                                     included in the output. Adds the FWR1_IMGT, FWR2_IMGT,
+                                     FWR3_IMGT, FWR4_IMGT, CDR1_IMGT, CDR2_IMGT, and
+                                     CDR3_IMGT columns.''')
+    
+    # IMGT aligner
+    parser_imgt = subparsers.add_parser('imgt', help='Process IMGT/HighV-Quest output', 
+                                        parents=[parser_parent], 
+                                        formatter_class=CommonHelpFormatter)
+    imgt_arg_group =  parser_imgt.add_mutually_exclusive_group(required=True)
+    imgt_arg_group.add_argument('-i', nargs='+', action='store', dest='aligner_files',
+                                help='''Either zipped IMGT output files (.zip) or a folder
+                                     containing unzipped IMGT output files (which must
+                                     include 1_Summary, 2_IMGT-gapped, 3_Nt-sequences,
+                                     and 6_Junction).''')
+    parser_imgt.add_argument('-s', nargs='*', action='store', dest='seq_files',
+                             required=False,
+                             help='List of input FASTA files containing sequences')
+    parser_imgt.add_argument('--noparse', action='store_true', dest='no_parse', 
+                             help='''Specify if input IDs should not be parsed to add new
+                                  columns to database.''')
+    parser_imgt.add_argument('--scores', action='store_true', dest='score_fields',
+                             help='''Specify if alignment score metrics should be
+                                  included in the output. Adds the V_SCORE, V_IDENTITY,
+                                  J_SCORE and J_IDENTITY. Note, this will also add
+                                  the columns V_EVALUE, V_BTOP, J_EVALUE and J_BTOP,
+                                  but they will be empty for IMGT output.''')
+    parser_imgt.add_argument('--regions', action='store_true', dest='region_fields',
+                             help='''Specify if IMGT framework and CDR regions should be
+                                  included in the output. Adds the FWR1_IMGT, FWR2_IMGT,
+                                  FWR3_IMGT, FWR4_IMGT, CDR1_IMGT, CDR2_IMGT, and
+                                  CDR3_IMGT columns.''')
+    parser_imgt.set_defaults(func=parseIMGT)
+
+    return parser
+    
+    
+if __name__ == "__main__":
+    """
+    Parses command line arguments and calls main
+    """
+    parser = getArgParser()    
+    args = parser.parse_args()
+    args_dict = parseCommonArgs(args, in_arg='aligner_files')
+
+    # Set no ID parsing if sequence files are not provided
+    if 'seq_files' in args_dict and not args_dict['seq_files']:
+        args_dict['no_parse'] = True
+
+    # Delete
+    if 'seq_files' in args_dict: del args_dict['seq_files']
+    if 'aligner_files' in args_dict: del args_dict['aligner_files']
+    if 'command' in args_dict: del args_dict['command']
+    if 'func' in args_dict: del args_dict['func']           
+    
+    if args.command == 'imgt':
+        for i in range(len(args.__dict__['aligner_files'])):
+            args_dict['imgt_output'] = args.__dict__['aligner_files'][i]
+            args_dict['seq_file'] = args.__dict__['seq_files'][i] \
+                                    if args.__dict__['seq_files'] else None
+            args.func(**args_dict)
+    elif args.command == 'igblast':
+        for i in range(len(args.__dict__['aligner_files'])):
+            args_dict['igblast_output'] =  args.__dict__['aligner_files'][i]
+            args_dict['seq_file'] = args.__dict__['seq_files'][i]
+            args.func(**args_dict)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/ParseDb.py	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,1101 @@
+#!/usr/bin/env python3
+"""
+Parses tab delimited database files
+"""
+# Info
+__author__ = 'Jason Anthony Vander Heiden'
+from changeo import __version__, __date__
+
+# Imports
+import csv
+import os
+import re
+from argparse import ArgumentParser
+from collections import OrderedDict
+
+from textwrap import dedent
+from time import time
+from Bio import SeqIO
+from Bio.Seq import Seq
+from Bio.SeqRecord import SeqRecord
+from Bio.Alphabet import IUPAC
+
+# Presto and changeo imports
+from presto.Defaults import default_delimiter, default_out_args
+from presto.Annotation import flattenAnnotation
+from presto.IO import getOutputHandle, printLog, printProgress, printMessage
+from changeo.Commandline import CommonHelpFormatter, getCommonArgParser, parseCommonArgs
+from changeo.IO import getDbWriter, readDbFile, countDbFile
+
+# Defaults
+default_id_field = 'SEQUENCE_ID'
+default_seq_field = 'SEQUENCE_IMGT'
+default_germ_field = 'GERMLINE_IMGT_D_MASK'
+default_index_field = 'INDEX'
+
+# TODO:  convert SQL-ish operations to modify_func() as per ParseHeaders
+
+def getDbSeqRecord(db_record, id_field, seq_field, meta_fields=None, 
+                   delimiter=default_delimiter):
+    """
+    Parses a database record into a SeqRecord
+
+    Arguments: 
+    db_record = a dictionary containing a database record
+    id_field = the field containing identifiers
+    seq_field = the field containing sequences
+    meta_fields = a list of fields to add to sequence annotations
+    delimiter = a tuple of delimiters for (fields, values, value lists) 
+
+    Returns: 
+    a SeqRecord
+    """
+    # Return None if ID or sequence fields are empty
+    if not db_record[id_field] or not db_record[seq_field]:
+        return None
+    
+    # Create description string
+    desc_dict = OrderedDict([('ID', db_record[id_field])])
+    if meta_fields is not None:
+        desc_dict.update([(f, db_record[f]) for f in meta_fields if f in db_record]) 
+    desc_str = flattenAnnotation(desc_dict, delimiter=delimiter)
+    
+    # Create SeqRecord
+    seq_record = SeqRecord(Seq(db_record[seq_field], IUPAC.ambiguous_dna),
+                           id=desc_str, name=desc_str, description='')
+        
+    return seq_record
+
+
+def splitDbFile(db_file, field, num_split=None, out_args=default_out_args):
+    """
+    Divides a tab-delimited database file into segments by description tags
+
+    Arguments:
+    db_file = filename of the tab-delimited database file to split
+    field = the field name by which to split db_file
+    num_split = the numerical threshold by which to group sequences;
+                if None treat field as textual
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    a list of output file names
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'split'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELD'] = field
+    log['NUM_SPLIT'] = num_split
+    printLog(log)
+
+    # Open IgRecord reader iter object
+    reader = readDbFile(db_file, ig=False)
+
+    # Determine total numbers of records
+    rec_count = countDbFile(db_file)
+
+    start_time = time()
+    count = 0
+    # Sort records into files based on textual field
+    if num_split is None:
+        # Create set of unique field tags
+        tmp_iter = readDbFile(db_file, ig=False)
+        tag_list = list(set([row[field] for row in tmp_iter]))
+
+        # Forbidden characters in filename and replacements
+        noGood = {'\/':'f','\\':'b','?':'q','\%':'p','*':'s',':':'c',
+                  '\|':'pi','\"':'dq','\'':'sq','<':'gt','>':'lt',' ':'_'}
+        # Replace forbidden characters in tag_list
+        tag_dict = {}
+        for tag in tag_list:
+            for c,r in noGood.items():
+                tag_dict[tag] = (tag_dict.get(tag, tag).replace(c,r) \
+                                     if c in tag else tag_dict.get(tag, tag))
+
+        # Create output handles
+        handles_dict = {tag:getOutputHandle(db_file,
+                                            '%s-%s' % (field, label),
+                                            out_type = out_args['out_type'],
+                                            out_name = out_args['out_name'],
+                                            out_dir = out_args['out_dir'])
+                        for tag, label in tag_dict.items()}
+
+        # Create Db writer instances
+        writers_dict = {tag:getDbWriter(handles_dict[tag], db_file)
+                        for tag in tag_dict}
+
+        # Iterate over IgRecords
+        for row in reader:
+            printProgress(count, rec_count, 0.05, start_time)
+            count += 1
+            # Write row to appropriate file
+            tag = row[field]
+            writers_dict[tag].writerow(row)
+
+    # Sort records into files based on numeric num_split
+    else:
+        num_split = float(num_split)
+
+        # Create output handles
+        handles_dict = {'under':getOutputHandle(db_file,
+                                                'under-%.1f' % num_split,
+                                                out_type = out_args['out_type'],
+                                                out_name = out_args['out_name'],
+                                                out_dir = out_args['out_dir']),
+                        'atleast':getOutputHandle(db_file,
+                                                  'atleast-%.1f' % num_split,
+                                                out_type = out_args['out_type'],
+                                                out_name = out_args['out_name'],
+                                                out_dir = out_args['out_dir'])}
+
+        # Create Db writer instances
+        writers_dict = {'under':getDbWriter(handles_dict['under'], db_file),
+                        'atleast':getDbWriter(handles_dict['atleast'], db_file)}
+
+        # Iterate over IgRecords
+        for row in reader:
+            printProgress(count, rec_count, 0.05, start_time)
+            count += 1
+            tag = row[field]
+            tag = 'under' if float(tag) < num_split else 'atleast'
+            writers_dict[tag].writerow(row)
+
+    # Write log
+    printProgress(count, rec_count, 0.05, start_time)
+    log = OrderedDict()
+    for i, k in enumerate(handles_dict):
+        log['OUTPUT%i' % (i + 1)] = os.path.basename(handles_dict[k].name)
+    log['RECORDS'] = rec_count
+    log['PARTS'] = len(handles_dict)
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close output file handles
+    for t in handles_dict: handles_dict[t].close()
+
+    return [handles_dict[t].name for t in handles_dict]
+
+
+# TODO:  SHOULD ALLOW FOR UNSORTED CLUSTER COLUMN
+# TODO:  SHOULD ALLOW FOR GROUPING FIELDS
+def convertDbClip(db_file, id_field=default_id_field, seq_field=default_seq_field, 
+                  germ_field=default_germ_field, cluster_field=None, 
+                  meta_fields=None, out_args=default_out_args):
+    """
+    Builds fasta files from database records
+
+    Arguments: 
+    db_file = the database file name
+    id_field = the field containing identifiers
+    seq_field = the field containing sample sequences
+    germ_field = the field containing germline sequences
+    cluster_field = the field containing clonal groupings
+                    if None write the germline for each record
+    meta_fields = a list of fields to add to sequence annotations
+    out_args = common output argument dictionary from parseCommonArgs
+                    
+    Returns: 
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'fasta'
+    log['FILE'] = os.path.basename(db_file)
+    log['ID_FIELD'] = id_field
+    log['SEQ_FIELD'] = seq_field
+    log['GERM_FIELD'] = germ_field
+    log['CLUSTER_FIELD'] = cluster_field
+    if meta_fields is not None:  log['META_FIELDS'] = ','.join(meta_fields)
+    printLog(log)
+    
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='sequences', out_dir=out_args['out_dir'], 
+                                  out_name=out_args['out_name'], out_type='clip')
+    # Count records
+    result_count = countDbFile(db_file)
+    
+    # Iterate over records
+    start_time = time()
+    rec_count = germ_count = pass_count = fail_count = 0
+    cluster_last = None
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+        
+        # Update cluster ID
+        cluster = rec.get(cluster_field, None)
+        
+        # Get germline SeqRecord when needed
+        if cluster_field is None:
+            germ = getDbSeqRecord(rec, id_field, germ_field, meta_fields, 
+                                  delimiter=out_args['delimiter'])
+            germ.id = '>' + germ.id
+        elif cluster != cluster_last:
+            germ = getDbSeqRecord(rec, cluster_field, germ_field, 
+                                  delimiter=out_args['delimiter'])
+            germ.id = '>' + germ.id            
+        else:
+            germ = None
+
+        # Get read SeqRecord
+        seq = getDbSeqRecord(rec, id_field, seq_field, meta_fields, 
+                             delimiter=out_args['delimiter'])
+        
+        # Write germline
+        if germ is not None:
+            germ_count += 1
+            SeqIO.write(germ, pass_handle, 'fasta')
+        
+        # Write sequences
+        if seq is not None:
+            pass_count += 1
+            SeqIO.write(seq, pass_handle, 'fasta')
+        else:
+            fail_count += 1
+        
+        # Set last cluster ID
+        cluster_last = cluster
+        
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['GERMLINES'] = germ_count
+    log['PASS'] = pass_count
+    log['FAIL'] = fail_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+ 
+    return pass_handle.name
+
+
+def convertDbFasta(db_file, id_field=default_id_field, seq_field=default_seq_field,
+                 meta_fields=None, out_args=default_out_args):
+    """
+    Builds fasta files from database records
+
+    Arguments: 
+    db_file = the database file name
+    id_field = the field containing identifiers
+    seq_field = the field containing sequences
+    meta_fields = a list of fields to add to sequence annotations
+    out_args = common output argument dictionary from parseCommonArgs
+                    
+    Returns: 
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'fasta'
+    log['FILE'] = os.path.basename(db_file)
+    log['ID_FIELD'] = id_field
+    log['SEQ_FIELD'] = seq_field
+    if meta_fields is not None:  log['META_FIELDS'] = ','.join(meta_fields)
+    printLog(log)
+    
+    # Open file handles
+    out_type = 'fasta'
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='sequences', out_dir=out_args['out_dir'], 
+                                  out_name=out_args['out_name'], out_type=out_type)
+    # Count records
+    result_count = countDbFile(db_file)
+    
+    # Iterate over records
+    start_time = time()
+    rec_count = pass_count = fail_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+
+        # Get SeqRecord
+        seq = getDbSeqRecord(rec, id_field, seq_field, meta_fields, out_args['delimiter'])
+
+        # Write sequences
+        if seq is not None:
+            pass_count += 1
+            SeqIO.write(seq, pass_handle, out_type)
+        else:
+            fail_count += 1
+        
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['PASS'] = pass_count
+    log['FAIL'] = fail_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+ 
+    return pass_handle.name
+
+
+def addDbFile(db_file, fields, values, out_args=default_out_args):
+    """
+    Adds field and value pairs to a database file
+
+    Arguments:
+    db_file = the database file name
+    fields = a list of fields to add
+    values = a list of values to assign to all rows of each field
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'add'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELDS'] = ','.join(fields)
+    log['VALUES'] = ','.join(values)
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-add', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file, add_fields=fields)
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Define fields and values to append
+    add_dict = {k:v for k,v in zip(fields, values) if k not in db_iter.fieldnames}
+
+    # Iterate over records
+    start_time = time()
+    rec_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+        # Write updated row
+        rec.update(add_dict)
+        pass_writer.writerow(rec)
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def indexDbFile(db_file, field=default_index_field, out_args=default_out_args):
+    """
+    Adds an index column to a database file
+
+    Arguments:
+    db_file = the database file name
+    field = the name of the index field to add
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'index'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELD'] = field
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-index', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file, add_fields=field)
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+
+        # Add count and write updated row
+        rec.update({field:rec_count})
+        pass_writer.writerow(rec)
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def dropDbFile(db_file, fields, out_args=default_out_args):
+    """
+    Deletes entire fields from a database file
+
+    Arguments:
+    db_file = the database file name
+    fields = a list of fields to drop
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'add'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELDS'] = ','.join(fields)
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-drop', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file, exclude_fields=fields)
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+        # Write row
+        pass_writer.writerow(rec)
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def deleteDbFile(db_file, fields, values, logic='any', regex=False,
+                 out_args=default_out_args):
+    """
+    Deletes records from a database file
+
+    Arguments: 
+    db_file = the database file name
+    fields = a list of fields to check for deletion criteria
+    values = a list of values defining deletion targets
+    logic = one of 'any' or 'all' defining whether one or all fields must have a match.
+    regex = if False do exact full string matches; if True allow partial regex matches.
+    out_args = common output argument dictionary from parseCommonArgs
+                    
+    Returns: 
+    the output file name
+    """
+    # Define string match function
+    if regex:
+        def _match_func(x, patterns):  return any([re.search(p, x) for p in patterns])
+    else:
+        def _match_func(x, patterns):  return x in patterns
+
+    # Define logic function
+    if logic == 'any':
+        _logic_func = any
+    elif logic == 'all':
+        _logic_func = all
+
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'delete'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELDS'] = ','.join(fields)
+    log['VALUES'] = ','.join(values)
+    printLog(log)
+    
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-delete', out_dir=out_args['out_dir'], 
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file)
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = pass_count = fail_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+
+        # Check for deletion values in all fields
+        delete = _logic_func([_match_func(rec.get(f, False), values) for f in fields])
+        
+        # Write sequences
+        if not delete:
+            pass_count += 1
+            pass_writer.writerow(rec)
+        else:
+            fail_count += 1
+        
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['KEPT'] = pass_count
+    log['DELETED'] = fail_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+ 
+    return pass_handle.name
+
+
+def renameDbFile(db_file, fields, names, out_args=default_out_args):
+    """
+    Renames fields in a database file
+
+    Arguments:
+    db_file = the database file name
+    fields = a list of fields to rename
+    values = a list of new names for fields
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'rename'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELDS'] = ','.join(fields)
+    log['NAMES'] = ','.join(names)
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-rename', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+
+    # Get header and rename fields
+    header = (readDbFile(db_file, ig=False)).fieldnames
+    for f, n in zip(fields, names):
+        i = header.index(f)
+        header[i] = n
+
+    # Open writer and write new header
+    # TODO:  should modify getDbWriter to take a list of fields
+    pass_writer = csv.DictWriter(pass_handle, fieldnames=header, dialect='excel-tab')
+    pass_writer.writeheader()
+
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+        # TODO:  repeating renaming is unnecessary.  should had a non-dict reader/writer to DbCore
+        # Rename fields
+        for f, n in zip(fields, names):
+            rec[n] = rec.pop(f)
+        # Write
+        pass_writer.writerow(rec)
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def selectDbFile(db_file, fields, values, logic='any', regex=False,
+                 out_args=default_out_args):
+    """
+    Selects records from a database file
+
+    Arguments:
+    db_file = the database file name
+    fields = a list of fields to check for selection criteria
+    values = a list of values defining selection targets
+    logic = one of 'any' or 'all' defining whether one or all fields must have a match.
+    regex = if False do exact full string matches; if True allow partial regex matches.
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    # Define string match function
+    if regex:
+        def _match_func(x, patterns):  return any([re.search(p, x) for p in patterns])
+    else:
+        def _match_func(x, patterns):  return x in patterns
+
+    # Define logic function
+    if logic == 'any':
+        _logic_func = any
+    elif logic == 'all':
+        _logic_func = all
+
+    # Print console log
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'select'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELDS'] = ','.join(fields)
+    log['VALUES'] = ','.join(values)
+    log['REGEX'] =regex
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-select', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file)
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = pass_count = fail_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+
+        # Check for selection values in all fields
+        select = _logic_func([_match_func(rec.get(f, False), values) for f in fields])
+
+        # Write sequences
+        if select:
+            pass_count += 1
+            pass_writer.writerow(rec)
+        else:
+            fail_count += 1
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['SELECTED'] = pass_count
+    log['DISCARDED'] = fail_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def sortDbFile(db_file, field, numeric=False, descend=False,
+               out_args=default_out_args):
+    """
+    Sorts records by values in an annotation field
+
+    Arguments:
+    db_file = the database filename
+    field = the field name to sort by
+    numeric = if True sort field numerically;
+              if False sort field alphabetically
+    descend = if True sort in descending order;
+              if False sort in ascending order
+
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'sort'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELD'] = field
+    log['NUMERIC'] = numeric
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-sort', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file)
+
+
+    # Store all records in a dictionary
+    start_time = time()
+    printMessage("Indexing: Running", start_time=start_time)
+    db_dict = {i:r for i, r in enumerate(db_iter)}
+    result_count = len(db_dict)
+
+    # Sort db_dict by field values
+    tag_dict = {k:v[field] for k, v in db_dict.items()}
+    if numeric:  tag_dict = {k:float(v or 0) for k, v in tag_dict.items()}
+    sorted_keys = sorted(tag_dict, key=tag_dict.get, reverse=descend)
+    printMessage("Indexing: Done", start_time=start_time, end=True)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = 0
+    for key in sorted_keys:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+
+        # Write records
+        pass_writer.writerow(db_dict[key])
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def updateDbFile(db_file, field, values, updates, out_args=default_out_args):
+    """
+    Updates field and value pairs to a database file
+
+    Arguments:
+    db_file = the database file name
+    field = the field to update
+    values = a list of values to specifying which rows to update
+    updates = a list of values to update each value with
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    the output file name
+    """
+    log = OrderedDict()
+    log['START'] = 'ParseDb'
+    log['COMMAND'] = 'update'
+    log['FILE'] = os.path.basename(db_file)
+    log['FIELD'] = field
+    log['VALUES'] = ','.join(values)
+    log['UPDATES'] = ','.join(updates)
+    printLog(log)
+
+    # Open file handles
+    db_iter = readDbFile(db_file, ig=False)
+    pass_handle = getOutputHandle(db_file, out_label='parse-update', out_dir=out_args['out_dir'],
+                                  out_name=out_args['out_name'], out_type='tab')
+    pass_writer = getDbWriter(pass_handle, db_file)
+    # Count records
+    result_count = countDbFile(db_file)
+
+    # Iterate over records
+    start_time = time()
+    rec_count = pass_count = 0
+    for rec in db_iter:
+        # Print progress for previous iteration
+        printProgress(rec_count, result_count, 0.05, start_time)
+        rec_count += 1
+
+        # Updated values if found
+        for x, y in zip(values, updates):
+            if rec[field] == x:
+                rec[field] = y
+                pass_count += 1
+
+        # Write records
+        pass_writer.writerow(rec)
+
+    # Print counts
+    printProgress(rec_count, result_count, 0.05, start_time)
+    log = OrderedDict()
+    log['OUTPUT'] = os.path.basename(pass_handle.name)
+    log['RECORDS'] = rec_count
+    log['UPDATED'] = pass_count
+    log['END'] = 'ParseDb'
+    printLog(log)
+
+    # Close file handles
+    pass_handle.close()
+
+    return pass_handle.name
+
+
+def getArgParser():
+    """
+    Defines the ArgumentParser
+
+    Arguments: 
+    None
+                      
+    Returns: 
+    an ArgumentParser object
+    """
+    # Define input and output field help message
+    fields = dedent(
+             '''
+             output files:
+                 sequences
+                     FASTA formatted sequences output from the subcommands fasta and clip.
+                 <field>-<value>
+                     database files partitioned by annotation <field> and <value>.
+                 parse-<command>
+                     output of the database modification functions where <command> is one of
+                     the subcommands add, index, drop, delete, rename, select, sort or update.
+
+             required fields:
+                 SEQUENCE_ID
+                 
+             optional fields:
+                 JUNCTION, SEQUENCE_IMGT, SEQUENCE_VDJ, GERMLINE_IMGT, GERMLINE_VDJ,
+                 GERMLINE_IMGT_D_MASK, GERMLINE_VDJ_D_MASK,
+                 GERMLINE_IMGT_V_REGION, GERMLINE_VDJ_V_REGION
+                
+             output fields:
+                 None
+             ''')
+    
+    # Define ArgumentParser
+    parser = ArgumentParser(description=__doc__, epilog=fields,
+                            formatter_class=CommonHelpFormatter)
+    parser.add_argument('--version', action='version',
+                        version='%(prog)s:' + ' %s-%s' %(__version__, __date__))
+    subparsers = parser.add_subparsers(title='subcommands', dest='command', metavar='',
+                                       help='Database operation')
+    # TODO:  This is a temporary fix for Python issue 9253
+    subparsers.required = True
+
+    # Define parent parser
+    parser_parent = getCommonArgParser(seq_in=False, seq_out=False, db_in=True,
+                                       failed=False, log=False)
+
+    # Subparser to convert database entries to sequence file
+    parser_seq = subparsers.add_parser('fasta', parents=[parser_parent],
+                                       formatter_class=CommonHelpFormatter,
+                                       help='Creates a fasta file from database records')
+    parser_seq.add_argument('--if', action='store', dest='id_field', 
+                            default=default_id_field,
+                            help='The name of the field containing identifiers')
+    parser_seq.add_argument('--sf', action='store', dest='seq_field', 
+                            default=default_seq_field,
+                            help='The name of the field containing sequences')
+    parser_seq.add_argument('--mf', nargs='+', action='store', dest='meta_fields',
+                            help='List of annotation fields to add to the sequence description')
+    parser_seq.set_defaults(func=convertDbFasta)
+    
+    # Subparser to convert database entries to clip-fasta file
+    parser_clip = subparsers.add_parser('clip', parents=[parser_parent], 
+                                        formatter_class=CommonHelpFormatter,
+                                        help='''Creates a clip-fasta file from database
+                                             records, wherein germline sequences precede
+                                             each clone and are denoted by ">>" headers.''')
+    parser_clip.add_argument('--if', action='store', dest='id_field', 
+                             default=default_id_field,
+                             help='The name of the field containing identifiers')
+    parser_clip.add_argument('--sf', action='store', dest='seq_field',
+                             default=default_seq_field,
+                             help='The name of the field containing reads')
+    parser_clip.add_argument('--gf', action='store', dest='germ_field',
+                             default=default_germ_field,
+                             help='The name of the field containing germline sequences')
+    parser_clip.add_argument('--cf', action='store', dest='cluster_field', default=None,
+                             help='The name of the field containing containing sorted clone IDs')
+    parser_clip.add_argument('--mf', nargs='+', action='store', dest='meta_fields',
+                             help='List of annotation fields to add to the sequence description')
+    parser_clip.set_defaults(func=convertDbClip)
+
+    # Subparser to partition files by annotation values
+    parser_split = subparsers.add_parser('split', parents=[parser_parent],
+                                         formatter_class=CommonHelpFormatter,
+                                         help='Splits database files by field values')
+    parser_split.add_argument('-f', action='store', dest='field', type=str, required=True,
+                              help='Annotation field by which to split database files.')
+    parser_split.add_argument('--num', action='store', dest='num_split', type=float, default=None,
+                              help='''Specify to define the field as numeric and group
+                                   records by whether they are less than or at least
+                                   (greater than or equal to) the specified value.''')
+    parser_split.set_defaults(func=splitDbFile)
+
+    # Subparser to add records
+    parser_add = subparsers.add_parser('add', parents=[parser_parent],
+                                       formatter_class=CommonHelpFormatter,
+                                       help='Adds field and value pairs')
+    parser_add.add_argument('-f', nargs='+', action='store', dest='fields', required=True,
+                               help='The name of the fields to add.')
+    parser_add.add_argument('-u', nargs='+', action='store', dest='values', required=True,
+                               help='The value to assign to all rows for each field.')
+    parser_add.set_defaults(func=addDbFile)
+
+    # Subparser to delete records
+    parser_delete = subparsers.add_parser('delete', parents=[parser_parent], 
+                                          formatter_class=CommonHelpFormatter,
+                                          help='Deletes specific records')
+    parser_delete.add_argument('-f', nargs='+', action='store', dest='fields', required=True,
+                               help='The name of the fields to check for deletion criteria.')
+    parser_delete.add_argument('-u', nargs='+', action='store', dest='values', default=['', 'NA'],
+                               help='''The values defining which records to delete. A value
+                                    may appear in any of the fields specified with -f.''')
+    parser_delete.add_argument('--logic', action='store', dest='logic',
+                               choices=('any', 'all'), default='any',
+                               help='''Defines whether a value may appear in any field (any)
+                                    or whether it must appear in all fields (all).''')
+    parser_delete.add_argument('--regex', action='store_true', dest='regex',
+                               help='''If specified, treat values as regular expressions
+                                    and allow partial string matches.''')
+    parser_delete.set_defaults(func=deleteDbFile)
+
+    # Subparser to drop fields
+    parser_drop = subparsers.add_parser('drop', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='Deletes entire fields')
+    parser_drop.add_argument('-f', nargs='+', action='store', dest='fields', required=True,
+                               help='The name of the fields to delete from the database.')
+    parser_drop.set_defaults(func=dropDbFile)
+
+    # Subparser to index fields
+    parser_index = subparsers.add_parser('index', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='Adds a numeric index field')
+    parser_index.add_argument('-f', action='store', dest='field',
+                              default=default_index_field,
+                              help='The name of the index field to add to the database.')
+    parser_index.set_defaults(func=indexDbFile)
+
+    # Subparser to rename fields
+    parser_rename = subparsers.add_parser('rename', parents=[parser_parent],
+                                          formatter_class=CommonHelpFormatter,
+                                          help='Renames fields')
+    parser_rename.add_argument('-f', nargs='+', action='store', dest='fields', required=True,
+                               help='List of fields to rename.')
+    parser_rename.add_argument('-k', nargs='+', action='store', dest='names', required=True,
+                               help='List of new names for each field.')
+    parser_rename.set_defaults(func=renameDbFile)
+
+    # Subparser to select records
+    parser_select = subparsers.add_parser('select', parents=[parser_parent],
+                                          formatter_class=CommonHelpFormatter,
+                                          help='Selects specific records')
+    parser_select.add_argument('-f', nargs='+', action='store', dest='fields', required=True,
+                               help='The name of the fields to check for selection criteria.')
+    parser_select.add_argument('-u', nargs='+', action='store', dest='values', required=True,
+                               help='''The values defining with records to select. A value
+                                    may appear in any of the fields specified with -f.''')
+    parser_select.add_argument('--logic', action='store', dest='logic',
+                               choices=('any', 'all'), default='any',
+                               help='''Defines whether a value may appear in any field (any)
+                                    or whether it must appear in all fields (all).''')
+    parser_select.add_argument('--regex', action='store_true', dest='regex',
+                               help='''If specified, treat values as regular expressions
+                                    and allow partial string matches.''')
+    parser_select.set_defaults(func=selectDbFile)
+
+    # Subparser to sort file by records
+    parser_sort = subparsers.add_parser('sort', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='Sorts records by field values')
+    parser_sort.add_argument('-f', action='store', dest='field', type=str, required=True,
+                             help='The annotation field by which to sort records.')
+    parser_sort.add_argument('--num', action='store_true', dest='numeric', default=False,
+                             help='''Specify to define the sort column as numeric rather
+                                  than textual.''')
+    parser_sort.add_argument('--descend', action='store_true', dest='descend',
+                             help='''If specified, sort records in descending, rather
+                             than ascending, order by values in the target field.''')
+    parser_sort.set_defaults(func=sortDbFile)
+
+    # Subparser to update records
+    parser_update = subparsers.add_parser('update', parents=[parser_parent],
+                                       formatter_class=CommonHelpFormatter,
+                                       help='Updates field and value pairs')
+    parser_update.add_argument('-f', action='store', dest='field', required=True,
+                               help='The name of the field to update.')
+    parser_update.add_argument('-u', nargs='+', action='store', dest='values', required=True,
+                               help='The values that will be replaced.')
+    parser_update.add_argument('-t', nargs='+', action='store', dest='updates', required=True,
+                               help='''The new value to assign to each selected row.''')
+    parser_update.set_defaults(func=updateDbFile)
+
+    return parser
+
+
+if __name__ == '__main__':
+    """
+    Parses command line arguments and calls main function
+    """
+    # Parse arguments
+    parser = getArgParser()
+    args = parser.parse_args()
+    args_dict = parseCommonArgs(args)
+    # Convert case of fields
+    if 'id_field' in args_dict:
+        args_dict['id_field'] = args_dict['id_field'].upper()
+    if 'seq_field' in args_dict:
+        args_dict['seq_field'] = args_dict['seq_field'].upper()
+    if 'germ_field' in args_dict:
+        args_dict['germ_field'] = args_dict['germ_field'].upper()
+    if 'field' in args_dict:
+        args_dict['field'] = args_dict['field'].upper()
+    if 'cluster_field' in args_dict and args_dict['cluster_field'] is not None:
+        args_dict['cluster_field'] = args_dict['cluster_field'].upper()
+    if 'meta_fields' in args_dict and args_dict['meta_fields'] is not None:
+        args_dict['meta_fields'] = [f.upper() for f in args_dict['meta_fields']]
+    if 'fields' in args_dict:
+        args_dict['fields'] = [f.upper() for f in args_dict['fields']]
+
+    # Check modify_args arguments
+    if args.command == 'add' and len(args_dict['fields']) != len(args_dict['values']):
+        parser.error('You must specify exactly one value (-u) per field (-f)')
+    elif args.command == 'rename' and len(args_dict['fields']) != len(args_dict['names']):
+        parser.error('You must specify exactly one new name (-k) per field (-f)')
+    elif args.command == 'update' and len(args_dict['values']) != len(args_dict['updates']):
+        parser.error('You must specify exactly one value (-u) per replacement (-t)')
+
+    # Call parser function for each database file
+    del args_dict['command']
+    del args_dict['func']
+    del args_dict['db_files']
+    for f in args.__dict__['db_files']:
+        args_dict['db_file'] = f
+        args.func(**args_dict)
+ 
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/create_germlines.sh	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,22 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+input=$1
+type=$2
+cloned=$3
+output=$4
+
+cp $input $PWD/input.tab #file has to have a ".tab" extension
+
+if [ "true" == "$cloned" ] ; then
+	cloned="--cloned"
+else
+	cloned=""
+fi
+
+mkdir $PWD/outdir
+
+#/home/galaxy/anaconda3/bin/python $dir/CreateGermlines.py -d $PWD/input.tab -r $germline --outdir $PWD/outdir --outname output -g $type $cloned
+/data/users/david/anaconda3/bin/python $dir/CreateGermlines.py -d $PWD/input.tab -r $dir/IMGT_Human_IGH[VDJ].fasta --outdir $PWD/outdir --outname output -g $type $cloned
+
+mv $PWD/outdir/output_germ-pass.tab $output
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/create_germlines.xml	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,28 @@
+<tool id="change_o_create_germlines_galaxy" name="Create Germlines" version="1.0">
+	<description>Change-O</description>
+	<command interpreter="bash">
+		create_germlines.sh $input $type $cloned $out_file
+	</command>
+	<inputs>
+		<param name="input" type="data" label="Input IMGT zip file" />
+		<param name="type" type="select" label="Type" help="Specify type(s) of germlines to include full germline, germline with D-region masked, or germline for V-region only." >
+			<option value="dmask" selected="true">Full germline</option>
+			<option value="full">Masked D-region</option>
+			<option value="vonly" >V-region only</option>
+		</param>
+		<param name="cloned" type="select" label="Cloned" help="Create one germline per clone" >
+			<option value="true">True</option>
+			<option value="false" selected="true">False</option>
+		</param>
+	</inputs>
+	<outputs>
+		<data format="tabular" name="out_file" label = "Change-O Germline on ${on_string}"/>
+	</outputs>
+	<citations>
+		<citation type="doi">10.1093/bioinformatics/btv359</citation>
+	</citations>
+	<help>
+			
+	
+	</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/define_clones.sh	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,31 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+#define_clones.sh $input $noparse $scores $regions $out_file
+
+type=$1
+input=$2
+
+mkdir $PWD/outdir
+
+cp $input $PWD/input.tab #file has to have a ".tab" extension
+
+if [ "bygroup" == "$type" ] ; then	
+	mode=$3
+	act=$4
+	model=$5
+	norm=$6
+	sym=$7
+	link=$8
+	dist=$9
+	output=${10}
+	
+	/data/users/david/anaconda3/bin/python $dir/DefineClones.py bygroup -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --mode $mode --act $act --model $model --dist $dist --norm $norm --sym $sym --link $link
+else
+	method=$3
+	output=$4
+	
+	/data/users/david/anaconda3/bin/python $dir/DefineClones.py hclust -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --method $method
+fi
+
+cp $PWD/outdir/output_clone-pass.tab $output
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/define_clones.xml	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,67 @@
+<tool id="change_o_define_clones_galaxy" name="Define Clones" version="1.0">
+	<description>Change-O</description>
+	<command interpreter="bash">
+		#if $input_type.input_type_select=="bygroup"
+			define_clones.sh bygroup $input $input_type.mode $input_type.act $input_type.model $input_type.norm $input_type.sym $input_type.link $input_type.dist $out_file
+		#else
+			define_clones.sh hclust $input $input_type.method $out_file
+		#end if
+	</command>
+	<inputs>
+		<param name="input" type="data" format="tabular" label="A Change-O DB file" />
+		<conditional name="input_type">
+			<param name="input_type_select" type="select" label="Input type">
+				<option value="bygroup">Define clones by V assignment, J assignment and junction length</option>
+				<option value="hclust">Define clones by specified distance metric on CDR3s and cutting of hierarchical clustering tree</option>
+			</param>
+			<when value="bygroup">
+				<param name="mode" type="select" label="Specifies whether to use the V(D)J allele or gene for initial grouping.">
+					<option value="allele">Allele</option>
+					<option value="gene" selected="true">Gene</option>
+				</param>
+				<param name="act" type="select" label="Specifies how to handle multiple V(D)J assignments for initial grouping.">
+					<option value="first">First</option>
+					<option value="set" selected="true">Set</option>
+				</param>
+				<param name="model" type="select" label="Specifies which substitution model to use for calculating distance between sequences.">
+					<option value="aa">AA hamming distance</option>
+					<option value="ham">Nucleotide hamming distance</option>
+					<option value="m1n">Mouse single nucleotide (Smith et al, 1996)</option>
+					<option value="hs1f" selected="true">Human single nucleotide (Yaari et al, 2013)</option>
+					<option value="hs5f">Human S5F (Yaari et al, 2013)</option>
+				</param>
+				<param name="norm" type="select" label="Specifies how to normalize distances.">
+					<option value="none">Do not normalize</option>
+					<option value="mut">Normalize by number of mutations</option>
+					<option value="len" selected="true">Normalize by length</option>
+				</param>
+				<param name="sym" type="select" label="Specifies how to combine asymmetric distances.">
+					<option value="avg" selected="true">Average</option>
+					<option value="min">Minimum</option>
+				</param>
+				<param name="link" type="select" label="Type of linkage to use for hierarchical clustering.">
+					<option value="single" selected="true">Single</option>
+					<option value="average">Average</option>
+					<option value="complete">Complete</option>
+				</param>
+				<param name="dist" size="4" type="float" value="0.0" label="The distance threshold for clonal grouping" />
+			</when>
+			<when value="hclust">
+				<param name="method" type="select" label="Specifies which cloning method to use for calculating distance between CDR3s">
+					<option value="chen2010" selected="true">Chen et al 2010</option>
+					<option value="ademokun2011">Ademokun et al 2011</option>
+				</param>
+			</when>
+		</conditional>
+	</inputs>
+	<outputs>
+		<data format="tabular" name="out_file" label = "Change-o DB clones ${input.name}"/>
+	</outputs>
+	<citations>
+		<citation type="doi">10.1093/bioinformatics/btv359</citation>
+	</citations>
+	<help>
+			
+	
+	</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/makedb.sh	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,32 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+input=$1
+noparse=$2
+scores=$3
+regions=$4
+output=$5
+
+if [ "true" == "$noparse" ] ; then
+	noparse="--noparse"
+else
+	noparse=""
+fi
+
+if [ "true" == "$scores" ] ; then
+	scores="--scores"
+else
+	scores=""
+fi
+
+if [ "true" == "$regions" ] ; then
+	regions="--regions"
+else
+	regions=""
+fi
+
+mkdir $PWD/outdir
+
+/data/users/david/anaconda3/bin/python $dir/MakeDb.py imgt -i $input --outdir $PWD/outdir --outname output $noparse $scores $regions
+
+mv $PWD/outdir/output_db-pass.tab $output
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/makedb.xml	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,31 @@
+<tool id="change_o_makdedb_galaxy" name="MakeDB" version="1.0">
+	<description>Change-O</description>
+	<command interpreter="bash">
+		makedb.sh $input $noparse $scores $regions $out_file
+	</command>
+	<inputs>
+		<param name="input" type="data" label="Input IMGT zip file" />
+		<param name="noparse" type="select" label="No parse" help="Specify if input IDs should not be parsed to add new columns to database." >
+			<option value="true">True</option>
+			<option value="false" selected="true">False</option>
+		</param>
+		<param name="scores" type="select" label="Scores" help="Specify if alignment score metrics should be included in the output." >
+			<option value="true">True</option>
+			<option value="false" selected="true">False</option>
+		</param>
+		<param name="regions" type="select" label="Regions" help="Specify if IMGT framework and CDR regions should be included in the output." >
+			<option value="true">True</option>
+			<option value="false" selected="true">False</option>
+		</param>
+	</inputs>
+	<outputs>
+		<data format="tabular" name="out_file" label = "Change-o DB ${input.name}"/>
+	</outputs>
+	<citations>
+		<citation type="doi">10.1093/bioinformatics/btv359</citation>
+	</citations>
+	<help>
+			
+	
+	</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/parsedb.sh	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,92 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+action=$1
+input=$2
+output=$3
+
+cp $input $PWD/input.tab
+
+input="$PWD/input.tab"
+
+mkdir $PWD/outdir
+
+if [ "fasta" == "$action" ] ; then
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py fasta -d $input --outdir $PWD/outdir --outname output
+	mv $PWD/outdir/output_sequences.fasta $output
+elif [ "clip" == "$action" ] ; then
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py clip -d $input --outdir $PWD/outdir --outname output
+	mv $PWD/outdir/output_sequences.fasta $output
+elif [ "split" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	label=$5
+	mkdir $PWD/split
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py split -d $input --outdir $PWD/split --outname output -f $field 
+	#rename "s/output_${field}/$label/" $PWD/split/*
+elif [ "add" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	value=$5
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py add -d $input --outdir $PWD/outdir --outname output -f $field -u $value
+	mv $PWD/outdir/output_parse-add.tab $output
+elif [ "delete" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	value=$5
+	regex=$6
+	if [ "true" == "$regex" ] ; then
+		regex="--regex"
+	else
+		regex=""
+	fi
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py delete -d $input --outdir $PWD/outdir --outname output -f $field -u $value --logic any $regex
+	mv $PWD/outdir/output_parse-delete.tab $output
+elif [ "drop" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py drop -d $input --outdir $PWD/outdir --outname output -f $field
+	mv $PWD/outdir/output_parse-drop.tab $output
+elif [ "index" == "$action" ] ; then
+	field=$4
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py index -d $input --outdir $PWD/outdir --outname output -f $field
+	mv $PWD/outdir/output_parse-index.tab $output
+elif [ "rename" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	newname=$5
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py rename -d $input --outdir $PWD/outdir --outname output -f $field -k $newname
+	mv $PWD/outdir/output_parse-rename.tab $output
+elif [ "select" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	value=$5
+	regex=$6
+	if [ "true" == "$regex" ] ; then
+		regex="--regex"
+	else
+		regex=""
+	fi
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py select -d $input --outdir $PWD/outdir --outname output -f $field -u $value --logic any $regex
+	mv $PWD/outdir/output_parse-select.tab $output
+elif [ "sort" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	num=$5
+	tmp=""
+	if [ "true" == "$num" ] ; then
+		tmp="--num"
+	fi	
+	desc=$6
+	if [ "true" == "$desc" ] ; then
+		tmp="--descend $tmp"
+	fi	
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py sort -d $input --outdir $PWD/outdir --outname output -f $field $tmp
+	mv $PWD/outdir/output_parse-sort.tab $output
+elif [ "update" == "$action" ] ; then
+	field="`cat $input 2> /dev/null | head -n 1 | cut -f$4 | tr '\n\r' ' '`"
+	value=$5
+	replace=$6
+	regex=$7
+	if [ "true" == "$regex" ] ; then
+		regex="--regex"
+	else
+		regex=""
+	fi
+	/data/users/david/anaconda3/bin/python $dir/ParseDb.py update -d $input --outdir $PWD/outdir --outname output -f $field -u $value -t $replace $regex
+	mv $PWD/outdir/output_parse-update.tab $output
+fi
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/parsedb.xml	Tue May 03 09:52:21 2016 -0400
@@ -0,0 +1,120 @@
+<tool id="change_o_parsedb_galaxy" name="ParseDB" version="1.0">
+	<description>Change-O</description>
+	<command interpreter="bash">
+		#if $action.action_select=="fasta"
+			parsedb.sh fasta $input $out_file
+		#elif $action.action_select=="clip"
+			parsedb.sh clip $input $out_file
+		#elif $action.action_select=="split"
+			parsedb.sh split $input $out_file $action.column '$input.name'
+		#elif $action.action_select=="add"
+			parsedb.sh add $input $out_file $action.column $action.value
+		#elif $action.action_select=="delete"
+			parsedb.sh delete $input $out_file $action.column $action.value $action.regex
+		#elif $action.action_select=="drop"
+			parsedb.sh drop $input $out_file $action.column
+		#elif $action.action_select=="index"
+			parsedb.sh index $input $out_file $action.column
+		#elif $action.action_select=="rename"
+			parsedb.sh rename $input $out_file $action.column $action.newname
+		#elif $action.action_select=="select"
+			parsedb.sh select $input $out_file $action.column $action.value $action.regex
+		#elif $action.action_select=="sort"
+			parsedb.sh sort $input $out_file $action.column $action.num $action.desc
+		#elif $action.action_select=="update"
+			parsedb.sh update $input $out_file $action.column $action.value $action.update $action.regex
+		#end if
+	</command>
+	<inputs>
+		<param name="input" type="data" format="tabular" label="Change-o DB file" />
+		<conditional name="action">
+			<param name="action_select" type="select" label="Action">
+				<option value="fasta">Create a fasta file from database records</option>
+				<option value="clip">Create a clip-fasta file from database records</option>
+				<option value="split">Split database files by field values</option>
+				<option value="add">Add field and value pairs</option>
+				<option value="delete">Delete specific records</option>
+				<option value="drop">Delete entire fields</option>
+				<option value="index">Add a numeric index field</option>
+				<option value="rename">Renames fields</option>
+				<option value="select">Select specific records</option>
+				<option value="sort">Sort records by field values</option>
+				<option value="update">Update field and value pairs</option>
+			</param>
+			<when value="fasta">
+				
+			</when>
+			<when value="clip">
+				
+			</when>
+			<when value="split">
+				<param name="column" label="Select the column to split on" type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+			</when>l
+			<when value="add">
+				<param name="column" type="text" size="20" label="The new column name." />
+				<param name="value" type="text" size="20" label="The value that will be put in the new column" />
+			</when>
+			<when value="delete">
+				<param name="column" label="Select the column to search on." type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+				<param name="value" type="text"  size="20" label="The value that will be used" />
+				<param name="regex" type="select" label="Regex" help="Treat values as regular expressions and allow partial string matches.">
+					<option value="text" selected="true">False</option>
+					<option value="regex">True</option>
+				</param>
+			</when>
+			<when value="drop">
+				<param name="column" label="Select the column to remove" type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+			</when>
+			<when value="index">
+				<param name="column" type="text" size="20" value="INDEX" label="The index column name" />
+			</when>
+			<when value="rename">
+				<param name="column" label="Select the column to delete on" type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+				<param name="newname" type="text" size="20" value="newname" label="The new column name" />
+			</when>
+			<when value="select">
+				<param name="column" label="Select the column to search on" type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+				<param name="value" type="text" size="20" label="The value that will be used" />
+				<param name="regex" type="select" label="Regex" help="Treat values as regular expressions and allow partial string matches">
+					<option value="text" selected="true">False</option>
+					<option value="regex">True</option>
+				</param>
+			</when>
+			<when value="sort">
+				<param name="column" label="Select the column to sort on" type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+				<param name="num" type="select" label="Numerical" help="Define the sort column as numeric rather than textual.">
+					<option value="false" selected="true">False</option>
+					<option value="true">True</option>
+				</param>
+				<param name="desc" type="select" label="Descending" help="Sort records in descending">
+					<option value="false" selected="true">False</option>
+					<option value="true">True</option>
+				</param>
+			</when>
+			<when value="update">
+				<param name="column" label="Select the column to search on" type="data_column" data_ref="input" numerical="False" use_header_names="True" force_select="True" />
+				<param name="value" type="text" size="20" label="The value that will be replaced" />
+				<param name="update" type="text" size="20" label="The value that will replace the original" />
+				<param name="regex" type="select" label="Regex" help="Treat values as regular expressions and allow partial string matches">
+					<option value="text" selected="true">False</option>
+					<option value="regex">True</option>
+				</param>
+			</when>			
+		</conditional>
+	</inputs>
+	<outputs>
+		<data format="tabular" name="out_file" label = "Change-o DB ${input.name}">
+		    <filter>action['action_select'] != "split"</filter>
+		</data>
+        <data format="txt" name="split">
+			<discover_datasets pattern="(?P&lt;designation&gt;.+)\.tab" ext="tabular" directory="split" visible="true" />
+			<filter>action['action_select'] == "split"</filter>
+        </data>
+	</outputs>
+	<citations>
+		<citation type="doi">10.1093/bioinformatics/btv359</citation>
+	</citations>
+	<help>
+		
+	</help>
+</tool>