Mercurial > repos > brenninc > directory_reader_limited_by_data_table
changeset 1:1487421505f1 draft
Uploaded correct tool this time
| author | brenninc |
|---|---|
| date | Wed, 23 Mar 2016 12:08:33 -0400 |
| parents | 25b07ce180d4 |
| children | 3911ee1a0078 |
| files | README data_reader.xml directory_copier.py test-data/other.csv test-data/other.fa test-data/other.fasta test-data/other.fasta.gz test-data/other.fastq test-data/other.fastq.gz test-data/sample1.bmp test-data/sample1.csv test-data/sample1.fa test-data/sample1.fasta test-data/sample1.fasta.gz test-data/sample1.fq test-data/sample1.jpeg test-data/sample1.jpg test-data/sample1.png test-data/sample1.ps test-data/sample1.sam test-data/sample1.tabular test-data/sample1.text test-data/sample1.tiff test-data/sample1.tsv test-data/sample1.txt test-data/sample1.xls test-data/sample1.xlsx test-data/sample2.txt tool-data/black-list.ini tool-data/directory_data.loc.sample tool-data/white-list.ini tool_data_table_conf.xml.sample |
| diffstat | 32 files changed, 79 insertions(+), 834 deletions(-) [+] |
line wrap: on
line diff
--- a/README Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,32 +0,0 @@ -This tool will lookup files on the Galaxy server machine, including mounted directories. - -The user aspects of the tool are explained in the help section of data_reader.xml - -Only directories that are included in the white list and not in the black list are allowed. - -The white and black lists can be changed without the requirement to restart the server as these are read from the tools install directory each time the tool is run. - -==== - -The white list is tool-data/white-list.ini - -Any directory that starts with any entry from this file will be considered to have passed. - -The default file includes a single / so all absolute paths will pass. - -==== - -The black list is tool-data/black-list.ini - -Any directory that contains any of the blacklisted strings anywhere in the path are excluded. - -The default file excludes most of the standard linux systems directories where data is unlikely to be found. - -It also excludes the /galaxy/ pattern to avoid users getting access to galaxy files. - -Also .. and ~ are excluded for security reasons. - - - - -
--- a/data_reader.xml Wed Mar 23 11:56:50 2016 -0400 +++ b/data_reader.xml Wed Mar 23 12:08:33 2016 -0400 @@ -1,84 +1,29 @@ -<tool id="directory_data_reader" name="Directory Data Finder" version="0.2"> - <description>Reads a particular data type from a directory on the server</description> +<tool id="directory_table_reader" name="Directory Data Reader" version="0.2"> + <description>Reads data from preconfigured directories table.</description> <command interpreter="python"> -<![CDATA[ + <![CDATA[ directory_copier.py - #if $results.required=="data" - --ending .${results.extension.file_type} - --link - #if $results.start - --start $results.start - #end if - #if $results.last - --last $results.last + --ending .${directory.fields.original_extension} + --new_ending .${directory.fields.galaxy_extension} + #if $results.required=="data" + --new_ending .${directory.fields.galaxy_extension} + --decompress ${directory.fields.decompress} + #if $results.start + --start $results.start + #end if + #if $results.last + --last $results.last + #end if #end if - #if $results.extension.file_type=="fa" - --new_ending .fasta - #end if - #if $results.extension.file_type=="fq" - --new_ending .fastq - #end if - #if $results.extension.file_type=="text" - --new_ending .txt - #end if - #if $results.extension.file_type=="tsv" - --new_ending .tabular - #end if - #if $results.extension.file_type in ["fasta.gz"] - --decompress - --new_ending .fasta - #end if - #if $results.extension.file_type=="fastq" - --new_ending .$results.extension.new_galaxy.new_ending - #end if - #if $results.extension.file_type=="fastq.gz" - --decompress - --new_ending .${results.extension.new_galaxy.new_ending} - #end if - #else - --ending bam - --ending csv - --ending fa - --ending fasta - --ending fasta.gz - --ending fastq - --ending fastq.gz - --ending fasta - --ending fq - --ending sam - --ending tabular - --ending text - --ending tsv - --ending txt - --ending xls - --ending xlsx - #end if - #if $directory.startswith('/'): - --path ${directory} - #else - --path $__tool_directory__/${directory} - #end if - --list ${listing} -]]> + --path ${directory.fields.path} + --list ${listing} + ]]> </command> - <macros> - <xml name="new_galaxy"> - <conditional name="new_galaxy"> - <param name="new_ending" type="select" label="Ending to be used for Galaxy" help="Will determine which down stream tools can be used."> - <option value="fastq" selected="true">Keep data as general fastq format</option> - <option value="fastqsanger">Tag data as fastq sanger in galaxy</option> - <option value="fastqsolexa">Tag data as fastq solexa in galaxy</option> - <option value="fastqillumina">Tag data as fastq illumina in galaxy</option> - </param> - <when value="fastq" /> - <when value="fastqsanger" /> - <when value="fastqsolexa" /> - <when value="fastqillumina" /> - </conditional> - </xml> - </macros> <inputs> - <param name="directory" type="text" label="Directory to read data from." /> + <param name="directory" type="select" label="Directory to import data from"> + <options from_data_table="directory_data"/> + <validator type="no_options" message="No Data Directory Setup"/> + </param> <param name="list_name" type="text" size="25" label="output name" value="input data"/> <conditional name="results"> <param name="required" type="select" label="Download data or just directory listing" help="Select type of action required."> @@ -88,51 +33,8 @@ <when value="data"> <param name="start" type="text" value="" label="String which must be at the start of each file name" /> <param name="last" type="text" value="" label="String which must be at the end of the file name (excluding the file type)" /> - <conditional name="extension"> - <param name="file_type" type="select" label="File Type" help="File Type."> - <option value="bam">*.bam files</option> - <option value="csv">*.csv files</option> - <option value="fa">*.fa files Files saved as *.fasta for galaxy</option> - <option value="fasta">*.fasta files</option> - <option value="fasta.gz">*.fasta.gz files</option> - <option value="fastq">*.fastq files</option> - <option value="fastq.gz">*.fastq.gz files</option> - <option value="fastq">*.fastq files</option> - <option value="fastq.gz">*.fastq.gz files</option> - <option value="fq">*.fq files Files saved as *.fastq for galaxy</option> - <option value="sam">*.sam files</option> - <option value="tabular">*.tabular Files</option> - <option value="text">*.text Files saved as *.txt for galaxy</option> - <option value="tsv">*.tsv files saved as *.tabular for galaxy</option> - <option value="txt">*.txt Files</option> - <option value="xls">*.xls files</option> - <option value="xlsx">*.xlsx files</option> - </param> - <when value="bam" /> - <when value="csv" /> - <when value="fa" /> - <when value="fasta" /> - <when value="fasta.gz" /> - <when value="fastq" > - <expand macro="new_galaxy"/> - </when> - <when value="fastq.gz" > - <expand macro="new_galaxy"/> - </when> - <when value="fq" > - <expand macro="new_galaxy"/> - </when> - <when value="sam" /> - <when value="tabular" /> - <when value="text" /> - <when value="tsv" /> - <when value="txt" /> - <when value="xls" /> - <when value="xlsx" /> - </conditional> </when> - <when value="listing"> - </when> + <when value="listing"/> </conditional> </inputs> <outputs> @@ -146,113 +48,18 @@ </outputs> <tests> <test> - <param name="directory" value="test-data" /> - <param name="list_name" value="csv_files" /> - <param name="results|extension|file_type" value="csv"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.csv" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="csv" file="sample1.csv" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fa"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.fasta" /> - <has_line line="other.fasta" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fasta" file="sample1.fasta" /> - <element name="other" ftype="fasta" file="sample1.fasta" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fasta"/> - <param name="results|start" value="sam" /> - <output name="listing"> - <assert_contents> - <has_line line="sample1.fasta" /> - <not_has_text text="other.fasta" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fasta" file="sample1.fasta" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fasta.gz"/> - <param name="results|last" value="le1" /> - <output name="listing"> - <assert_contents> - <has_line line="sample1.fasta" /> - <not_has_text text="other.fasta" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fasta" file="sample1.fasta" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fq"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.fastq" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fastq" file="sample1.fastq" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fastq"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.fastq" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fastq" file="sample1.fastq" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fastq"/> - <param name="results|extension|new_galaxy|new_ending" value="fastqsanger"/> + <param name="directory" value="fastq.gz_files_id" /> + <param name="list_name" value="test_files" /> + <param name="results|required" value="listing"/> <output name="listing"> <assert_contents> <has_line line="sample1.fastqsanger" /> + <has_line line="other.fastqsanger" /> </assert_contents> </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fastqsanger" file="sample1.fastq" /> - </output_collection> - </test> + </test> <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fastq.gz"/> - <output name="data_collection"> - <assert_contents> - <has_line line="sample1.fastq" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="fastq" file="sample1.fastq" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="fastq.gz"/> - <param name="results|extension|new_galaxy|new_ending" value="fastqsanger"/> + <param name="directory" value="fastq.gz_files_id" /> <output name="listing_fastq_gz"> <assert_contents> <has_line line="sample1.fastqsanger" /> @@ -260,126 +67,29 @@ </output> <output_collection name="data_collection" type="list"> <element name="sample1" ftype="fastqsanger" file="sample1.fastq" /> + <element name="other" ftype="fastqsanger" file="other.fastq" /> </output_collection> - </test> + </test> <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="sam"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.sam" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="sam" file="sample1.sam" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="tabular"/> - <output name="listing"> + <param name="directory" value="fastq_files_id" /> + <param name="results|start" value="sam" /> + <output name="listing_fastq"> <assert_contents> - <has_line line="sample1.tabular" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="tabular" file="sample1.tabular" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="text"/> - <output name="listing_text"> - <assert_contents> - <has_line line="sample1.txt" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="txt" file="sample1.text" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="tsv"/> - <output name="data_collection"> - <assert_contents> - <has_line line="sample1.tabular" /> + <has_line line="sample1.fastq" /> + <not_has_text text="other.fasta" /> </assert_contents> </output> <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="tabular" file="sample1.tsv" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="txt" /> - <output name="listing"> - <assert_contents> - <has_line line="sample1.txt" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="txt" file="sample1.txt" /> - <element name="sample2" ftype="txt" file="sample2.txt" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="xls"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.xls" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="xls" file="sample1.xls" /> + <element name="sample1" ftype="fastq" file="sample1.fastq" /> </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|extension|file_type" value="xlsx"/> - <output name="listing"> - <assert_contents> - <has_line line="sample1.xlsx" /> - </assert_contents> - </output> - <output_collection name="data_collection" type="list"> - <element name="sample1" ftype="xlsx" file="sample1.xlsx" /> - </output_collection> - </test> - <test> - <param name="directory" value="test-data" /> - <param name="results|required" value="listing"/> - <output name="listing_all"> - <assert_contents> - <has_line line="sample1.csv" /> - <has_line line="sample1.fasta" /> - <has_line line="sample1.fasta.gz" /> - <has_line line="sample1.fastq" /> - <has_line line="sample1.fastq.gz" /> - <has_line line="sample1.sam" /> - <has_line line="sample1.tabular" /> - <has_line line="sample1.text" /> - <has_line line="sample1.tsv" /> - <has_line line="sample1.txt" /> - <has_line line="sample1.xls" /> - <has_line line="sample1.xlsx" /> - </assert_contents> - </output> - </test> - + </test> </tests> <help> <![CDATA[ This tool will lookup files on the Galaxy server machine, including mounted directories. -Only directories that are included in the white list and not in the black list are allowed. -If the directory you require does not pass the white list or blacklist test please contact the local galaxy admin. -(Admins see README) - -This tool only supports a limited set of types and file extenstions. -No other files are ever returned either by data or listing. +Only directories and ending combinations set up by a Galaxy admin can be listed or loaded in this way. These endings are case senitive. ==== @@ -388,11 +98,11 @@ The tool will return two things. -1. A Dataset collection of all the detected files. +1. A Dataset collection of all the detected files. (If data requested) 2. A file with the names of all the detected files. These will be sorted in the same order as galaxy builds the dataset collection. -The files can be filtered by setting a specific start strinf for the file name. +The files can be filtered by setting a specific start string for the file name. Only files that start with this string (case senstive) will be included. Files can also be filter for the last part before the file extsentions. @@ -404,18 +114,10 @@ Setting last R1_001 will return the read1 files: C01_R1_001.fasta C02_R1_001.fasta -As Galaxy detects the file type based on the extension this tool will change the exstension for supported alternative file ends. - This includes (manually) setting the exstension to fastqsanger, fastqsolexa, fastqillumina for tools that specify one of these. - -This tool will unzip gz files. +As Galaxy detects the file type based on the extension this tool will change the exstension as setup by the admin. -==== - -The listing option will return a txt file with all the files found with any of the supported endings. Other files in that directory are not included. +This tool will unzip gz files if requested to by the admin, -The file exstensions are left as in the directory. - -File start and last filters are not supported in this mode. ]]> </help> <citations>
--- a/directory_copier.py Wed Mar 23 11:56:50 2016 -0400 +++ b/directory_copier.py Wed Mar 23 12:08:33 2016 -0400 @@ -10,34 +10,6 @@ sys.exit(1) -def get_tool_data(name): - root_dir = os.path.dirname((os.path.realpath(__file__))) - path = os.path.join(root_dir,"tool-data",name) - if not(os.path.isfile(path)): - report_error(name,"file not found in tool's tool-data folder. Please ask you galaxy admin to add it back") - return path - - -def check_white_list(path_to_check): - white_list = get_tool_data("white-list.ini") - with open(white_list, 'r') as white_list_file: - for line in white_list_file: - line = line.strip() - if len(line) >= 1 and path_to_check.startswith(line): - return True - report_error(path_to_check,"has not been included in the white list. Please contact the local galaxy admin to add it.") - - -def check_black_list(path_to_check): - black_list = get_tool_data("black-list.ini") - with open(black_list, 'r') as black_list_file: - for line in black_list_file: - line = line.strip() - if len(line) >= 1 and line in path_to_check: - report_error(line,"has been black list so",path_to_check,"is not allowed. Please contact the local galaxy admin to change that, or add a symlink.") - return True - - def check_pattern_get_new_name(a_file, ending, options): if options.start: if not(a_file.startswith(options.start)): @@ -130,9 +102,5 @@ path = options.path.strip() if path[-1] != '/': path = path + "/" - check_white_list(path) - print path, "white listed" - check_black_list(path) - print path, "not black listed" copy_and_link(path, options)
--- a/test-data/other.csv Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,18 +0,0 @@ -A,top,line,with,fluff,across,many,columns -more,,,,,,, -stuff,,,,,,, -in,,,,,,, -several,,,,,,, -lines,,,,,,, -then blanks,,,,,,, -,,,,,,, -,,,,,,, -An,the,the,more,the,more,, -unimportant,x,y,unimportant,value,more,, -column,axis,axis,stuff,column,fluff,, -asas,alpha,foo,23,2,999,, -dad,alpha,bar,21,3,23,, -sd,beta,foo,21,999,34,, -wwd,gamma,foo,34,3,999,, -sd,gamma,bar,32,5,23,, -sdee,beta,bar,323,5,23,,
--- a/test-data/other.fa Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 -TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT -@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 -GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC -@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 -TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT -
--- a/test-data/other.fasta Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 -TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT -@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 -GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC -@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 -TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/other.fastq Wed Mar 23 12:08:33 2016 -0400 @@ -0,0 +1,12 @@ +@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC ++SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 +hhhhgfhhcghghggfcffdhfehhhhcehdchhdhahehffffde`bVd +@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT ++SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 +hhhhhhhhhhghhghhhhhfhhhhhfffffe`ee[`X]b[d[ed`[Y[^Y +@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT ++SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 +dhhhgchhhghhhfhhhhhdhhhhehhghfhhhchfddffcffafhfghe
--- a/test-data/sample1.csv Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,18 +0,0 @@ -A,top,line,with,fluff,across,many,columns -more,,,,,,, -stuff,,,,,,, -in,,,,,,, -several,,,,,,, -lines,,,,,,, -then blanks,,,,,,, -,,,,,,, -,,,,,,, -An,the,the,more,the,more,, -unimportant,x,y,unimportant,value,more,, -column,axis,axis,stuff,column,fluff,, -asas,alpha,foo,23,2,999,, -dad,alpha,bar,21,3,23,, -sd,beta,foo,21,999,34,, -wwd,gamma,foo,34,3,999,, -sd,gamma,bar,32,5,23,, -sdee,beta,bar,323,5,23,,
--- a/test-data/sample1.fa Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 -TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT -@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 -GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC -@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 -TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT -
--- a/test-data/sample1.fasta Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 -TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT -@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 -GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC -@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 -TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT -
--- a/test-data/sample1.fq Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,12 +0,0 @@ -@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 -TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT -+SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50 -hhhhhhhhhhghhghhhhhfhhhhhfffffe`ee[`X]b[d[ed`[Y[^Y -@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 -GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC -+SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50 -hhhhgfhhcghghggfcffdhfehhhhcehdchhdhahehffffde`bVd -@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 -TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT -+SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50 -dhhhgchhhghhhfhhhhhdhhhhehhghfhhhchfddffcffafhfghe
--- a/test-data/sample1.ps Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,284 +0,0 @@ -%!PS-Adobe-3.0 EPSF-3.0 -%%DocumentNeededResources: font Helvetica -%%+ font Helvetica-Bold -%%+ font Helvetica-Oblique -%%+ font Helvetica-BoldOblique -%%+ font Symbol -%%Title: R Graphics Output -%%Creator: R Software -%%Pages: (atend) -%%BoundingBox: 0 0 720 720 -%%EndComments -%%BeginProlog -/bp { gs sRGB gs } def -% begin .ps.prolog -/gs { gsave } bind def -/gr { grestore } bind def -/ep { showpage gr gr } bind def -/m { moveto } bind def -/l { rlineto } bind def -/np { newpath } bind def -/cp { closepath } bind def -/f { fill } bind def -/o { stroke } bind def -/c { newpath 0 360 arc } bind def -/r { 4 2 roll moveto 1 copy 3 -1 roll exch 0 exch rlineto 0 rlineto -1 mul 0 exch rlineto closepath } bind def -/p1 { stroke } bind def -/p2 { gsave bg fill grestore newpath } bind def -/p3 { gsave bg fill grestore stroke } bind def -/p6 { gsave bg eofill grestore newpath } bind def -/p7 { gsave bg eofill grestore stroke } bind def -/t { 5 -2 roll moveto gsave rotate - 1 index stringwidth pop - mul neg 0 rmoveto show grestore } bind def -/ta { 4 -2 roll moveto gsave rotate show } bind def -/tb { 2 -1 roll 0 rmoveto show } bind def -/cl { grestore gsave newpath 3 index 3 index moveto 1 index - 4 -1 roll lineto exch 1 index lineto lineto - closepath clip newpath } bind def -/rgb { setrgbcolor } bind def -/s { scalefont setfont } bind def -% end .ps.prolog -/sRGB { [ /CIEBasedABC - << /DecodeLMN - [ { dup 0.03928 le - {12.92321 div} - {0.055 add 1.055 div 2.4 exp } - ifelse - } bind dup dup - ] - /MatrixLMN [0.412457 0.212673 0.019334 - 0.357576 0.715152 0.119192 - 0.180437 0.072175 0.950301] - /WhitePoint [0.9505 1.0 1.0890] - >> - ] setcolorspace } bind def -/srgb { setcolor } bind def -%%IncludeResource: font Helvetica -/Helvetica findfont -dup length dict begin - {1 index /FID ne {def} {pop pop} ifelse} forall - /Encoding ISOLatin1Encoding def - currentdict - end -/Font1 exch definefont pop -%%IncludeResource: font Helvetica-Bold -/Helvetica-Bold findfont -dup length dict begin - {1 index /FID ne {def} {pop pop} ifelse} forall - /Encoding ISOLatin1Encoding def - currentdict - end -/Font2 exch definefont pop -%%IncludeResource: font Helvetica-Oblique -/Helvetica-Oblique findfont -dup length dict begin - {1 index /FID ne {def} {pop pop} ifelse} forall - /Encoding ISOLatin1Encoding def - currentdict - end -/Font3 exch definefont pop -%%IncludeResource: font Helvetica-BoldOblique -/Helvetica-BoldOblique findfont -dup length dict begin - {1 index /FID ne {def} {pop pop} ifelse} forall - /Encoding ISOLatin1Encoding def - currentdict - end -/Font4 exch definefont pop -%%IncludeResource: font Symbol -/Symbol findfont -dup length dict begin - {1 index /FID ne {def} {pop pop} ifelse} forall - currentdict - end -/Font5 exch definefont pop -%%EndProlog -%%Page: 1 1 -bp -59.04 433.44 689.76 660.96 cl -0 0 0 srgb -2.25 setlinewidth -[] 0 setdash -0 setlinecap -1 setlinejoin -10.00 setmiterlimit -np -101.87 476.98 m -155.73 0 l -o -0.75 setlinewidth -[ 2.25 3.75] 0 setdash -1 setlinecap -np -179.73 441.87 m -0 0 l -o -np -179.73 512.09 m -0 0 l -o -0.75 setlinewidth -[] 0 setdash -np -140.80 441.87 m -77.87 0 l -o -np -140.80 512.09 m -77.87 0 l -o -np -101.87 441.87 m -155.73 0 l -0 70.22 l --155.73 0 l -0 -70.22 l -o -2.25 setlinewidth -[] 0 setdash -0 setlinecap -np -296.53 652.53 m -155.74 0 l -o -0.75 setlinewidth -[ 2.25 3.75] 0 setdash -1 setlinecap -np -374.40 652.53 m -0 0 l -o -np -374.40 652.53 m -0 0 l -o -0.75 setlinewidth -[] 0 setdash -np -335.47 652.53 m -77.86 0 l -o -np -335.47 652.53 m -77.86 0 l -o -np -296.53 652.53 m -155.74 0 l -0 0 l --155.74 0 l -0 0 l -o -2.25 setlinewidth -[] 0 setdash -0 setlinecap -np -491.20 582.31 m -155.73 0 l -o -0.75 setlinewidth -[ 2.25 3.75] 0 setdash -1 setlinecap -np -569.07 512.09 m -0 0 l -o -np -569.07 652.53 m -0 0 l -o -0.75 setlinewidth -[] 0 setdash -np -530.13 512.09 m -77.87 0 l -o -np -530.13 652.53 m -77.87 0 l -o -np -491.20 512.09 m -155.73 0 l -0 140.44 l --155.73 0 l -0 -140.44 l -o -0.00 0.00 720.00 720.00 cl -0 0 0 srgb -0.75 setlinewidth -[] 0 setdash -1 setlinecap -1 setlinejoin -10.00 setmiterlimit -np -179.73 433.44 m -389.34 0 l -o -np -179.73 433.44 m -0 -7.20 l -o -np -374.40 433.44 m -0 -7.20 l -o -np -569.07 433.44 m -0 -7.20 l -o -/Font1 findfont 7 s -182.25 419.04 (alpha) 1 90 t -376.91 419.04 (beta) 1 90 t -571.58 419.04 (gamma) 1 90 t -np -59.04 441.87 m -0 210.66 l -o -np -59.04 441.87 m --7.20 0 l -o -np -59.04 476.98 m --7.20 0 l -o -np -59.04 512.09 m --7.20 0 l -o -np -59.04 547.20 m --7.20 0 l -o -np -59.04 582.31 m --7.20 0 l -o -np -59.04 617.42 m --7.20 0 l -o -np -59.04 652.53 m --7.20 0 l -o -44.64 439.35 (2.0) 1 0 t -44.64 474.46 (2.5) 1 0 t -44.64 509.58 (3.0) 1 0 t -44.64 544.69 (3.5) 1 0 t -44.64 579.80 (4.0) 1 0 t -44.64 614.91 (4.5) 1 0 t -44.64 650.02 (5.0) 1 0 t -np -59.04 433.44 m -630.72 0 l -0 227.52 l --630.72 0 l -0 -227.52 l -o -ep -%%Trailer -%%Pages: 1 -%%EOF
--- a/test-data/sample1.sam Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,14 +0,0 @@ -@SQ SN:ref LN:45 -@SQ SN:ref2 LN:40 -r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 -r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * -r003 0 ref 9 30 5H6M * 0 0 AGCTAA * -r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * -r003 16 ref 29 30 6H5M * 0 0 TAGGC * -r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT * -x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ???????????????????? -x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ????????????????????? -x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ?????????????????????????? -x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ????????????????????????? -x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ???????????????????????? -x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
--- a/test-data/sample1.tabular Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -An_unimportant_column the_x_axis the_y_axis stuff the_value_column more_more_fluff -13 asas alpha foo 23 2 999 -14 dad alpha bar 21 3 23 -15 sd beta foo 21 999 34 -16 wwd gamma foo 34 3 999 -17 sd gamma bar 32 5 23 -18 sdee beta bar 323 5 23
--- a/test-data/sample1.text Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -text1
--- a/test-data/sample1.tsv Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -An_unimportant_column the_x_axis the_y_axis stuff the_value_column more_more_fluff -13 asas alpha foo 23 2 999 -14 dad alpha bar 21 3 23 -15 sd beta foo 21 999 34 -16 wwd gamma foo 34 3 999 -17 sd gamma bar 32 5 23 -18 sdee beta bar 323 5 23
--- a/test-data/sample1.txt Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -1
--- a/test-data/sample2.txt Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,1 +0,0 @@ -2
--- a/tool-data/black-list.ini Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,24 +0,0 @@ -# This file only works if saved as {tool}/tool-data/black_list.ini -# It may be empty but it must exists - -# Parts of paths that will be blocked even if whitelisted. -# so for example /usr/home/galaxy/ will be blocked if /galaxy/ if nlisted here - -/bin/ -/boot/ -/dev/ -/galaxy/ -/lib/ -/lib32/ -/lib64/ -/media/ -/opt/ -/root/ -/run/ -/sbin/ -/srv/ -/sys/ -/var/ -/usr/ -.. -~
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/directory_data.loc.sample Wed Mar 23 12:08:33 2016 -0400 @@ -0,0 +1,19 @@ +#This file lists the directories that can be read in + +#This file has the format (white space characters are TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <original_extension> <galaxy_extension> <decompress> <path> +# +#original_extension should not include the starting . +# +#galaxy_extension should be one listed in galaxy/config/datatypes_conf.xml (or xml.sample) +# +#decompress should be No or Yes +# +#So, data_manager.loc could look something like this: (whitespace is tabs) +# +#john_12 john_12 John's fastq files batch 12 fastq.gz fastqsanger Yes /data/john/batch12 +# +#Your directory_data.loc file should contain an entry for each path and extension pair +# +
--- a/tool-data/white-list.ini Wed Mar 23 11:56:50 2016 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,15 +0,0 @@ -# This file only works if saved as {tool}/tool-data/white_list.ini - -# Start of paths that will be accepted by the directory reader -# No jokers including * currently supported. -# Even files listed here will be checked against the black list - -# To accept all paths just keep line with a single slash -/ - -# Add directories absolulute for example -/home/joe_blog/galaxy_data - -# relative test_data as it only make sense for planemo tests -test-data/ -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Wed Mar 23 12:08:33 2016 -0400 @@ -0,0 +1,6 @@ +<tables> + <table name="directory_data" comment_char="#"> + <columns>value, dbkey, name, original_extension, galaxy_extension, decompress, path</columns> + <file path="tool-data/directory_data.loc" /> + </table> +</tables>