# HG changeset patch
# User brenninc
# Date 1458749313 14400
# Node ID 1487421505f1dc5b83c58d035ed8f4bf57d567e0
# Parent  25b07ce180d47c897167039ae701c8c1b9c4e20d
Uploaded correct tool this time

diff -r 25b07ce180d4 -r 1487421505f1 README
--- a/README	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,32 +0,0 @@
-This tool will lookup files on the Galaxy server machine, including mounted directories.
-
-The user aspects of the tool are explained in the help section of data_reader.xml
-
-Only directories that are included in the white list and not in the black list are allowed.
-
-The white and black lists can be changed without the requirement to restart the server as these are read from the tools install directory each time the tool is run.
-
-====
-
-The white list is tool-data/white-list.ini
-
-Any directory that starts with any entry from this file will be considered to have passed.
-
-The default file includes a single / so all absolute paths will pass.
-
-====
-
-The black list is tool-data/black-list.ini
-
-Any directory that contains any of the blacklisted strings anywhere in the path are excluded.
-
-The default file excludes most of the standard linux systems directories where data is unlikely to be found.
-
-It also excludes the /galaxy/ pattern to avoid users getting access to galaxy files.
-
-Also .. and ~ are excluded for security reasons.
-
-
-
-
-
diff -r 25b07ce180d4 -r 1487421505f1 data_reader.xml
--- a/data_reader.xml	Wed Mar 23 11:56:50 2016 -0400
+++ b/data_reader.xml	Wed Mar 23 12:08:33 2016 -0400
@@ -1,84 +1,29 @@
-<tool id="directory_data_reader" name="Directory Data Finder" version="0.2">
-    <description>Reads a particular data type from a directory on the server</description>
+<tool id="directory_table_reader" name="Directory Data Reader" version="0.2">
+    <description>Reads data from preconfigured directories table.</description>
     <command interpreter="python">
-<![CDATA[
+        <![CDATA[
         directory_copier.py  
-        #if $results.required=="data"
-            --ending .${results.extension.file_type} 
-            --link
-            #if $results.start
-                --start $results.start
-            #end if      
-            #if $results.last
-                --last $results.last
+            --ending .${directory.fields.original_extension} 
+            --new_ending .${directory.fields.galaxy_extension} 
+            #if $results.required=="data"
+                --new_ending .${directory.fields.galaxy_extension} 
+                --decompress ${directory.fields.decompress} 
+                #if $results.start
+                    --start $results.start
+                #end if      
+                #if $results.last
+                    --last $results.last
+                #end if      
             #end if      
-            #if $results.extension.file_type=="fa"
-                --new_ending .fasta
-            #end if
-            #if $results.extension.file_type=="fq"
-                --new_ending .fastq
-            #end if
-            #if $results.extension.file_type=="text"
-                --new_ending .txt
-            #end if
-            #if $results.extension.file_type=="tsv"
-                --new_ending .tabular
-            #end if
-            #if $results.extension.file_type in ["fasta.gz"]
-                --decompress
-                --new_ending .fasta
-            #end if
-            #if $results.extension.file_type=="fastq"
-                --new_ending .$results.extension.new_galaxy.new_ending
-            #end if
-            #if $results.extension.file_type=="fastq.gz"
-                --decompress
-                --new_ending .${results.extension.new_galaxy.new_ending}
-            #end if
-        #else
-            --ending bam 
-            --ending csv 
-            --ending fa 
-            --ending fasta 
-            --ending fasta.gz 
-            --ending fastq 
-            --ending fastq.gz 
-            --ending fasta 
-            --ending fq 
-            --ending sam 
-            --ending tabular 
-            --ending text 
-            --ending tsv 
-            --ending txt 
-            --ending xls 
-            --ending xlsx
-        #end if      
-        #if $directory.startswith('/'):
-            --path ${directory}
-        #else
-            --path $__tool_directory__/${directory}
-        #end if      
-        --list ${listing}
-]]>
+            --path ${directory.fields.path} 
+            --list ${listing}
+        ]]>
     </command>
-    <macros>
-        <xml name="new_galaxy">
-            <conditional name="new_galaxy">
-                <param name="new_ending" type="select" label="Ending to be used for Galaxy" help="Will determine which down stream tools can be used.">
-                    <option value="fastq" selected="true">Keep data as general fastq format</option>
-                    <option value="fastqsanger">Tag data as fastq sanger in galaxy</option>
-                    <option value="fastqsolexa">Tag data as fastq solexa in galaxy</option>
-                    <option value="fastqillumina">Tag data as fastq illumina in galaxy</option>
-                </param>
-                <when value="fastq" />
-                <when value="fastqsanger" />
-                <when value="fastqsolexa" />
-                <when value="fastqillumina" />  
-            </conditional>
-        </xml>
-    </macros>    
     <inputs>
-        <param name="directory" type="text" label="Directory to read data from." />
+        <param name="directory" type="select" label="Directory to import data from">
+            <options from_data_table="directory_data"/>
+            <validator type="no_options" message="No Data Directory Setup"/>
+        </param>
         <param name="list_name" type="text" size="25" label="output name" value="input data"/>
         <conditional name="results">
             <param name="required" type="select" label="Download data or just directory listing" help="Select type of action required.">
@@ -88,51 +33,8 @@
             <when value="data">
                 <param name="start" type="text" value="" label="String which must be at the start of each file name" />
                 <param name="last" type="text" value="" label="String which must be at the end of the file name (excluding the file type)" />
-                <conditional name="extension">
-                    <param name="file_type" type="select" label="File Type" help="File Type.">
-                        <option value="bam">*.bam files</option>
-                        <option value="csv">*.csv files</option>
-                        <option value="fa">*.fa files Files saved as *.fasta for galaxy</option>
-                        <option value="fasta">*.fasta files</option>
-                        <option value="fasta.gz">*.fasta.gz files</option>
-                        <option value="fastq">*.fastq files</option>
-                        <option value="fastq.gz">*.fastq.gz files</option>
-                        <option value="fastq">*.fastq files</option>
-                        <option value="fastq.gz">*.fastq.gz files</option>
-                        <option value="fq">*.fq files Files saved as *.fastq for galaxy</option>
-                        <option value="sam">*.sam files</option>
-                        <option value="tabular">*.tabular Files</option>
-                        <option value="text">*.text Files saved as *.txt for galaxy</option>
-                        <option value="tsv">*.tsv files saved as *.tabular for galaxy</option>
-                        <option value="txt">*.txt Files</option>
-                        <option value="xls">*.xls files</option>
-                        <option value="xlsx">*.xlsx files</option>
-                    </param>
-                    <when value="bam" />
-                    <when value="csv" />
-                    <when value="fa" />
-                    <when value="fasta" />
-                    <when value="fasta.gz" />
-                    <when value="fastq" >
-                        <expand macro="new_galaxy"/>
-                    </when>
-                    <when value="fastq.gz" >
-                        <expand macro="new_galaxy"/>
-                    </when>
-                    <when value="fq" >
-                        <expand macro="new_galaxy"/>
-                    </when>
-                    <when value="sam" />
-                    <when value="tabular" />
-                    <when value="text" />
-                    <when value="tsv" />
-                    <when value="txt" />
-                    <when value="xls" />
-                    <when value="xlsx" />
-                </conditional>
             </when>
-            <when value="listing">
-            </when>
+            <when value="listing"/>
         </conditional>
     </inputs>
     <outputs>
@@ -146,113 +48,18 @@
     </outputs>
     <tests>
         <test>
-            <param name="directory" value="test-data" />
-            <param name="list_name" value="csv_files" />
-            <param name="results|extension|file_type" value="csv"/>
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.csv" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="csv" file="sample1.csv" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fa"/>
-             <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.fasta" />
-                    <has_line line="other.fasta" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fasta" file="sample1.fasta" />
-                <element name="other" ftype="fasta" file="sample1.fasta" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fasta"/>
-            <param name="results|start" value="sam" />
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.fasta" />
-                    <not_has_text text="other.fasta" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fasta" file="sample1.fasta" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fasta.gz"/>
-            <param name="results|last" value="le1" />
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.fasta" />
-                    <not_has_text text="other.fasta" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fasta" file="sample1.fasta" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fq"/>
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.fastq" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fastq" file="sample1.fastq" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fastq"/>
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.fastq" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fastq" file="sample1.fastq" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fastq"/>
-            <param name="results|extension|new_galaxy|new_ending" value="fastqsanger"/>
+            <param name="directory" value="fastq.gz_files_id" />
+            <param name="list_name" value="test_files" />
+            <param name="results|required" value="listing"/>
             <output name="listing">
                 <assert_contents>
                     <has_line line="sample1.fastqsanger" />
+                    <has_line line="other.fastqsanger" />
                 </assert_contents>
             </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fastqsanger" file="sample1.fastq" />
-           </output_collection>
-        </test>
+         </test>
         <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fastq.gz"/>
-            <output name="data_collection">
-                <assert_contents>
-                    <has_line line="sample1.fastq" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="fastq" file="sample1.fastq" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="fastq.gz"/>
-            <param name="results|extension|new_galaxy|new_ending" value="fastqsanger"/>
+            <param name="directory" value="fastq.gz_files_id" />
             <output name="listing_fastq_gz">
                 <assert_contents>
                     <has_line line="sample1.fastqsanger" />
@@ -260,126 +67,29 @@
             </output>
             <output_collection name="data_collection" type="list">
                 <element name="sample1" ftype="fastqsanger" file="sample1.fastq" />
+                <element name="other" ftype="fastqsanger" file="other.fastq" />
            </output_collection>
-        </test>
+         </test>
         <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="sam"/>
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.sam" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="sam" file="sample1.sam" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="tabular"/>
-            <output name="listing">
+            <param name="directory" value="fastq_files_id" />
+            <param name="results|start" value="sam" />
+            <output name="listing_fastq">
                 <assert_contents>
-                    <has_line line="sample1.tabular" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="tabular" file="sample1.tabular" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="text"/>
-            <output name="listing_text">
-                <assert_contents>
-                    <has_line line="sample1.txt" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="txt" file="sample1.text" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="tsv"/>
-            <output name="data_collection">
-                <assert_contents>
-                    <has_line line="sample1.tabular" />
+                    <has_line line="sample1.fastq" />
+                    <not_has_text text="other.fasta" />
                 </assert_contents>
             </output>
             <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="tabular" file="sample1.tsv" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="txt" />
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.txt" />
-                </assert_contents>  
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="txt" file="sample1.txt" />
-                <element name="sample2" ftype="txt" file="sample2.txt" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="xls"/>
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.xls" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="xls" file="sample1.xls" />
+                <element name="sample1" ftype="fastq" file="sample1.fastq" />
            </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|extension|file_type" value="xlsx"/>
-            <output name="listing">
-                <assert_contents>
-                    <has_line line="sample1.xlsx" />
-                </assert_contents>
-            </output>
-            <output_collection name="data_collection" type="list">
-                <element name="sample1" ftype="xlsx" file="sample1.xlsx" />
-           </output_collection>
-        </test>
-        <test>
-            <param name="directory" value="test-data" />
-            <param name="results|required" value="listing"/>
-            <output name="listing_all">
-                <assert_contents>
-                    <has_line line="sample1.csv" />
-                    <has_line line="sample1.fasta" />
-                    <has_line line="sample1.fasta.gz" />
-                    <has_line line="sample1.fastq" />
-                    <has_line line="sample1.fastq.gz" />
-                    <has_line line="sample1.sam" />
-                    <has_line line="sample1.tabular" />
-                    <has_line line="sample1.text" />
-                    <has_line line="sample1.tsv" />
-                    <has_line line="sample1.txt" />
-                    <has_line line="sample1.xls" />
-                    <has_line line="sample1.xlsx" />
-                 </assert_contents>
-            </output>
-        </test>
-
+         </test>
     </tests>
 
     <help>
 <![CDATA[
 This tool will lookup files on the Galaxy server machine, including mounted directories.
 
-Only directories that are included in the white list and not in the black list are allowed.
-If the directory you require does not pass the white list or blacklist test please contact the local galaxy admin.
-(Admins see README)
-
-This tool only supports a limited set of types and file extenstions. 
-No other files are ever returned either by data or listing.
+Only directories and ending combinations set up by a Galaxy admin can be listed or loaded in this way.
 These endings are case senitive.
 
 ====
@@ -388,11 +98,11 @@
 
 The tool will return two things.
 
-1. A Dataset collection of all the detected files.
+1. A Dataset collection of all the detected files. (If data requested)
 
 2. A file with the names of all the detected files. These will be sorted in the same order as galaxy builds the dataset collection. 
 
-The files can be filtered by setting a specific start strinf for the file name. 
+The files can be filtered by setting a specific start string for the file name. 
 Only files that start with this string (case senstive) will be included.
 
 Files can also be filter for the last part before the file extsentions.
@@ -404,18 +114,10 @@
 
 Setting last R1_001 will return the read1 files:   C01_R1_001.fasta   C02_R1_001.fasta
 
-As Galaxy detects the file type based on the extension this tool will change the exstension for supported alternative file ends.
-    This includes (manually) setting the exstension to fastqsanger, fastqsolexa, fastqillumina for tools that specify one of these.
-
-This tool will unzip gz files.
+As Galaxy detects the file type based on the extension this tool will change the exstension as setup by the admin.
 
-====
-
-The listing option will return a txt file with all the files found with any of the supported endings. Other files in that directory are not included.
+This tool will unzip gz files if requested to by the admin,
 
-The file exstensions are left as in the directory.
-
-File start and last filters are not supported in this mode.
 ]]>
     </help>
     <citations>
diff -r 25b07ce180d4 -r 1487421505f1 directory_copier.py
--- a/directory_copier.py	Wed Mar 23 11:56:50 2016 -0400
+++ b/directory_copier.py	Wed Mar 23 12:08:33 2016 -0400
@@ -10,34 +10,6 @@
     sys.exit(1)
 
 
-def get_tool_data(name):
-    root_dir = os.path.dirname((os.path.realpath(__file__)))
-    path = os.path.join(root_dir,"tool-data",name)
-    if not(os.path.isfile(path)): 
-        report_error(name,"file not found in tool's tool-data folder. Please ask you galaxy admin to add it back")
-    return path
-
-
-def check_white_list(path_to_check):
-    white_list = get_tool_data("white-list.ini")
-    with open(white_list, 'r') as white_list_file:
-        for line in white_list_file:
-            line = line.strip()
-            if len(line) >= 1 and path_to_check.startswith(line):
-                return True
-    report_error(path_to_check,"has not been included in the white list. Please contact the local galaxy admin to add it.")
-
-
-def check_black_list(path_to_check):
-    black_list = get_tool_data("black-list.ini")
-    with open(black_list, 'r') as black_list_file:
-        for line in black_list_file:
-            line = line.strip()
-            if len(line) >= 1 and line in path_to_check:
-                report_error(line,"has been black list so",path_to_check,"is not allowed. Please contact the local galaxy admin to change that, or add a symlink.")
-    return True
-
-
 def check_pattern_get_new_name(a_file, ending, options):
     if options.start:
         if not(a_file.startswith(options.start)):
@@ -130,9 +102,5 @@
     path = options.path.strip()
     if path[-1] != '/':
         path = path + "/"
-    check_white_list(path)
-    print path, "white listed"
-    check_black_list(path)
-    print path, "not black listed"
     copy_and_link(path, options)
 
diff -r 25b07ce180d4 -r 1487421505f1 test-data/other.csv
--- a/test-data/other.csv	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,18 +0,0 @@
-A,top,line,with,fluff,across,many,columns
-more,,,,,,,
-stuff,,,,,,,
-in,,,,,,,
-several,,,,,,,
-lines,,,,,,,
-then blanks,,,,,,,
-,,,,,,,
-,,,,,,,
-An,the,the,more,the,more,,
-unimportant,x,y,unimportant,value,more,,
-column,axis,axis,stuff,column,fluff,,
-asas,alpha,foo,23,2,999,,
-dad,alpha,bar,21,3,23,,
-sd,beta,foo,21,999,34,,
-wwd,gamma,foo,34,3,999,,
-sd,gamma,bar,32,5,23,,
-sdee,beta,bar,323,5,23,,
diff -r 25b07ce180d4 -r 1487421505f1 test-data/other.fa
--- a/test-data/other.fa	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
-TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT
-@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
-GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC
-@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
-TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT
-
diff -r 25b07ce180d4 -r 1487421505f1 test-data/other.fasta
--- a/test-data/other.fasta	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
-TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT
-@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
-GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC
-@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
-TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT
-
diff -r 25b07ce180d4 -r 1487421505f1 test-data/other.fasta.gz
Binary file test-data/other.fasta.gz has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/other.fastq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/other.fastq	Wed Mar 23 12:08:33 2016 -0400
@@ -0,0 +1,12 @@
+@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
+GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC
++SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
+hhhhgfhhcghghggfcffdhfehhhhcehdchhdhahehffffde`bVd
+@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
+TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT
++SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
+hhhhhhhhhhghhghhhhhfhhhhhfffffe`ee[`X]b[d[ed`[Y[^Y
+@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
+TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT
++SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
+dhhhgchhhghhhfhhhhhdhhhhehhghfhhhchfddffcffafhfghe
diff -r 25b07ce180d4 -r 1487421505f1 test-data/other.fastq.gz
Binary file test-data/other.fastq.gz has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.bmp
Binary file test-data/sample1.bmp has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.csv
--- a/test-data/sample1.csv	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,18 +0,0 @@
-A,top,line,with,fluff,across,many,columns
-more,,,,,,,
-stuff,,,,,,,
-in,,,,,,,
-several,,,,,,,
-lines,,,,,,,
-then blanks,,,,,,,
-,,,,,,,
-,,,,,,,
-An,the,the,more,the,more,,
-unimportant,x,y,unimportant,value,more,,
-column,axis,axis,stuff,column,fluff,,
-asas,alpha,foo,23,2,999,,
-dad,alpha,bar,21,3,23,,
-sd,beta,foo,21,999,34,,
-wwd,gamma,foo,34,3,999,,
-sd,gamma,bar,32,5,23,,
-sdee,beta,bar,323,5,23,,
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.fa
--- a/test-data/sample1.fa	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
-TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT
-@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
-GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC
-@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
-TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT
-
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.fasta
--- a/test-data/sample1.fasta	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
-TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT
-@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
-GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC
-@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
-TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT
-
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.fasta.gz
Binary file test-data/sample1.fasta.gz has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.fq
--- a/test-data/sample1.fq	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,12 +0,0 @@
-@SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
-TTGCCTGCCTATCATTTTAGTGCCTGTGAGGTGGAGATGTGAGGATCAGT
-+SRR566546.970 HWUSI-EAS1673_11067_FC7070M:4:1:2299:1109 length=50
-hhhhhhhhhhghhghhhhhfhhhhhfffffe`ee[`X]b[d[ed`[Y[^Y
-@SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
-GATTTGTATGAAAGTATACAACTAAAACTGCAGGTGGATCAGAGTAAGTC
-+SRR566546.971 HWUSI-EAS1673_11067_FC7070M:4:1:2374:1108 length=50
-hhhhgfhhcghghggfcffdhfehhhhcehdchhdhahehffffde`bVd
-@SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
-TGCATGATCTTCAGTGCCAGGACCTTATCAAGCGGTTTGGTCCCTTTGTT
-+SRR566546.972 HWUSI-EAS1673_11067_FC7070M:4:1:2438:1109 length=50
-dhhhgchhhghhhfhhhhhdhhhhehhghfhhhchfddffcffafhfghe
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.jpeg
Binary file test-data/sample1.jpeg has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.jpg
Binary file test-data/sample1.jpg has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.png
Binary file test-data/sample1.png has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.ps
--- a/test-data/sample1.ps	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,284 +0,0 @@
-%!PS-Adobe-3.0 EPSF-3.0
-%%DocumentNeededResources: font Helvetica
-%%+ font Helvetica-Bold
-%%+ font Helvetica-Oblique
-%%+ font Helvetica-BoldOblique
-%%+ font Symbol
-%%Title: R Graphics Output
-%%Creator: R Software
-%%Pages: (atend)
-%%BoundingBox: 0 0 720 720
-%%EndComments
-%%BeginProlog
-/bp  { gs sRGB gs } def
-% begin .ps.prolog
-/gs  { gsave } bind def
-/gr  { grestore } bind def
-/ep  { showpage gr gr } bind def
-/m   { moveto } bind def
-/l  { rlineto } bind def
-/np  { newpath } bind def
-/cp  { closepath } bind def
-/f   { fill } bind def
-/o   { stroke } bind def
-/c   { newpath 0 360 arc } bind def
-/r   { 4 2 roll moveto 1 copy 3 -1 roll exch 0 exch rlineto 0 rlineto -1 mul 0 exch rlineto closepath } bind def
-/p1  { stroke } bind def
-/p2  { gsave bg fill grestore newpath } bind def
-/p3  { gsave bg fill grestore stroke } bind def
-/p6  { gsave bg eofill grestore newpath } bind def
-/p7  { gsave bg eofill grestore stroke } bind def
-/t   { 5 -2 roll moveto gsave rotate
-       1 index stringwidth pop
-       mul neg 0 rmoveto show grestore } bind def
-/ta  { 4 -2 roll moveto gsave rotate show } bind def
-/tb  { 2 -1 roll 0 rmoveto show } bind def
-/cl  { grestore gsave newpath 3 index 3 index moveto 1 index
-       4 -1 roll lineto  exch 1 index lineto lineto
-       closepath clip newpath } bind def
-/rgb { setrgbcolor } bind def
-/s   { scalefont setfont } bind def
-% end   .ps.prolog
-/sRGB { [ /CIEBasedABC
-          << /DecodeLMN
-               [ { dup 0.03928 le
-                        {12.92321 div}
-                        {0.055 add 1.055 div 2.4 exp }
-                     ifelse
-                 } bind dup dup
-               ]
-             /MatrixLMN [0.412457 0.212673 0.019334
-                         0.357576 0.715152 0.119192
-                         0.180437 0.072175 0.950301]
-             /WhitePoint [0.9505 1.0 1.0890]
-           >>
-         ] setcolorspace } bind def
-/srgb { setcolor } bind def
-%%IncludeResource: font Helvetica
-/Helvetica findfont
-dup length dict begin
-  {1 index /FID ne {def} {pop pop} ifelse} forall
-  /Encoding ISOLatin1Encoding def
-  currentdict
-  end
-/Font1 exch definefont pop
-%%IncludeResource: font Helvetica-Bold
-/Helvetica-Bold findfont
-dup length dict begin
-  {1 index /FID ne {def} {pop pop} ifelse} forall
-  /Encoding ISOLatin1Encoding def
-  currentdict
-  end
-/Font2 exch definefont pop
-%%IncludeResource: font Helvetica-Oblique
-/Helvetica-Oblique findfont
-dup length dict begin
-  {1 index /FID ne {def} {pop pop} ifelse} forall
-  /Encoding ISOLatin1Encoding def
-  currentdict
-  end
-/Font3 exch definefont pop
-%%IncludeResource: font Helvetica-BoldOblique
-/Helvetica-BoldOblique findfont
-dup length dict begin
-  {1 index /FID ne {def} {pop pop} ifelse} forall
-  /Encoding ISOLatin1Encoding def
-  currentdict
-  end
-/Font4 exch definefont pop
-%%IncludeResource: font Symbol
-/Symbol findfont
-dup length dict begin
-  {1 index /FID ne {def} {pop pop} ifelse} forall
-  currentdict
-  end
-/Font5 exch definefont pop
-%%EndProlog
-%%Page: 1 1
-bp
-59.04 433.44 689.76 660.96 cl
-0 0 0 srgb
-2.25 setlinewidth
-[] 0 setdash
-0 setlinecap
-1 setlinejoin
-10.00 setmiterlimit
-np
-101.87 476.98 m
-155.73 0 l
-o
-0.75 setlinewidth
-[ 2.25 3.75] 0 setdash
-1 setlinecap
-np
-179.73 441.87 m
-0 0 l
-o
-np
-179.73 512.09 m
-0 0 l
-o
-0.75 setlinewidth
-[] 0 setdash
-np
-140.80 441.87 m
-77.87 0 l
-o
-np
-140.80 512.09 m
-77.87 0 l
-o
-np
-101.87 441.87 m
-155.73 0 l
-0 70.22 l
--155.73 0 l
-0 -70.22 l
-o
-2.25 setlinewidth
-[] 0 setdash
-0 setlinecap
-np
-296.53 652.53 m
-155.74 0 l
-o
-0.75 setlinewidth
-[ 2.25 3.75] 0 setdash
-1 setlinecap
-np
-374.40 652.53 m
-0 0 l
-o
-np
-374.40 652.53 m
-0 0 l
-o
-0.75 setlinewidth
-[] 0 setdash
-np
-335.47 652.53 m
-77.86 0 l
-o
-np
-335.47 652.53 m
-77.86 0 l
-o
-np
-296.53 652.53 m
-155.74 0 l
-0 0 l
--155.74 0 l
-0 0 l
-o
-2.25 setlinewidth
-[] 0 setdash
-0 setlinecap
-np
-491.20 582.31 m
-155.73 0 l
-o
-0.75 setlinewidth
-[ 2.25 3.75] 0 setdash
-1 setlinecap
-np
-569.07 512.09 m
-0 0 l
-o
-np
-569.07 652.53 m
-0 0 l
-o
-0.75 setlinewidth
-[] 0 setdash
-np
-530.13 512.09 m
-77.87 0 l
-o
-np
-530.13 652.53 m
-77.87 0 l
-o
-np
-491.20 512.09 m
-155.73 0 l
-0 140.44 l
--155.73 0 l
-0 -140.44 l
-o
-0.00 0.00 720.00 720.00 cl
-0 0 0 srgb
-0.75 setlinewidth
-[] 0 setdash
-1 setlinecap
-1 setlinejoin
-10.00 setmiterlimit
-np
-179.73 433.44 m
-389.34 0 l
-o
-np
-179.73 433.44 m
-0 -7.20 l
-o
-np
-374.40 433.44 m
-0 -7.20 l
-o
-np
-569.07 433.44 m
-0 -7.20 l
-o
-/Font1 findfont 7 s
-182.25 419.04 (alpha) 1 90 t
-376.91 419.04 (beta) 1 90 t
-571.58 419.04 (gamma) 1 90 t
-np
-59.04 441.87 m
-0 210.66 l
-o
-np
-59.04 441.87 m
--7.20 0 l
-o
-np
-59.04 476.98 m
--7.20 0 l
-o
-np
-59.04 512.09 m
--7.20 0 l
-o
-np
-59.04 547.20 m
--7.20 0 l
-o
-np
-59.04 582.31 m
--7.20 0 l
-o
-np
-59.04 617.42 m
--7.20 0 l
-o
-np
-59.04 652.53 m
--7.20 0 l
-o
-44.64 439.35 (2.0) 1 0 t
-44.64 474.46 (2.5) 1 0 t
-44.64 509.58 (3.0) 1 0 t
-44.64 544.69 (3.5) 1 0 t
-44.64 579.80 (4.0) 1 0 t
-44.64 614.91 (4.5) 1 0 t
-44.64 650.02 (5.0) 1 0 t
-np
-59.04 433.44 m
-630.72 0 l
-0 227.52 l
--630.72 0 l
-0 -227.52 l
-o
-ep
-%%Trailer
-%%Pages: 1
-%%EOF
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.sam
--- a/test-data/sample1.sam	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,14 +0,0 @@
-@SQ	SN:ref	LN:45
-@SQ	SN:ref2	LN:40
-r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
-r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
-r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
-r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
-r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
-r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
-x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
-x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
-x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
-x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
-x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
-x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.tabular
--- a/test-data/sample1.tabular	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-An_unimportant_column	the_x_axis	the_y_axis	stuff	the_value_column	more_more_fluff
-13	asas	alpha	foo	23	2	999
-14	dad	alpha	bar	21	3	23
-15	sd	beta	foo	21	999	34
-16	wwd	gamma	foo	34	3	999
-17	sd	gamma	bar	32	5	23
-18	sdee	beta	bar	323	5	23
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.text
--- a/test-data/sample1.text	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-text1
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.tiff
Binary file test-data/sample1.tiff has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.tsv
--- a/test-data/sample1.tsv	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,7 +0,0 @@
-An_unimportant_column	the_x_axis	the_y_axis	stuff	the_value_column	more_more_fluff
-13	asas	alpha	foo	23	2	999
-14	dad	alpha	bar	21	3	23
-15	sd	beta	foo	21	999	34
-16	wwd	gamma	foo	34	3	999
-17	sd	gamma	bar	32	5	23
-18	sdee	beta	bar	323	5	23
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.txt
--- a/test-data/sample1.txt	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-1
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.xls
Binary file test-data/sample1.xls has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample1.xlsx
Binary file test-data/sample1.xlsx has changed
diff -r 25b07ce180d4 -r 1487421505f1 test-data/sample2.txt
--- a/test-data/sample2.txt	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-2
diff -r 25b07ce180d4 -r 1487421505f1 tool-data/black-list.ini
--- a/tool-data/black-list.ini	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,24 +0,0 @@
-# This file only works if saved as {tool}/tool-data/black_list.ini
-# It may be empty but it must exists
-
-# Parts of paths that will be blocked even if whitelisted.
-# so for example /usr/home/galaxy/ will be blocked if /galaxy/ if nlisted here
-
-/bin/
-/boot/
-/dev/
-/galaxy/
-/lib/
-/lib32/
-/lib64/
-/media/
-/opt/
-/root/
-/run/
-/sbin/
-/srv/
-/sys/
-/var/
-/usr/
-..
-~
diff -r 25b07ce180d4 -r 1487421505f1 tool-data/directory_data.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/directory_data.loc.sample	Wed Mar 23 12:08:33 2016 -0400
@@ -0,0 +1,19 @@
+#This file lists the directories that can be read in
+
+#This file has the format (white space characters are TAB characters):
+#
+#<unique_build_id>	<dbkey>	<display_name>	<original_extension>	<galaxy_extension>	<decompress>	<path>
+#
+#original_extension should not include the starting .
+#
+#galaxy_extension should be one listed in galaxy/config/datatypes_conf.xml (or xml.sample)
+#
+#decompress should be No or Yes
+#
+#So, data_manager.loc could look something like this: (whitespace is tabs)
+#
+#john_12	john_12	John's fastq files batch 12	fastq.gz	fastqsanger	Yes	/data/john/batch12
+#
+#Your directory_data.loc file should contain an entry for each path and extension pair
+#
+
diff -r 25b07ce180d4 -r 1487421505f1 tool-data/white-list.ini
--- a/tool-data/white-list.ini	Wed Mar 23 11:56:50 2016 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,15 +0,0 @@
-# This file only works if saved as {tool}/tool-data/white_list.ini
-
-# Start of paths that will be accepted by the directory reader
-# No jokers including * currently supported.
-# Even files listed here will be checked against the black list
-
-# To accept all paths just keep line with a single slash
-/
-
-# Add directories absolulute for example
-/home/joe_blog/galaxy_data
-
-# relative test_data as it only make sense for planemo tests
-test-data/
-
diff -r 25b07ce180d4 -r 1487421505f1 tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Wed Mar 23 12:08:33 2016 -0400
@@ -0,0 +1,6 @@
+<tables>
+    <table name="directory_data" comment_char="#">
+        <columns>value, dbkey, name, original_extension, galaxy_extension, decompress, path</columns>
+        <file path="tool-data/directory_data.loc" />
+    </table>
+</tables>