Mercurial > repos > bgruening > viennarna_rnaplfold
changeset 0:1c53a4463457 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,27 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package" version="2.2.10">viennarna</requirement> + <yield/> + </requirements> + </xml> + <token name="@VERSION@">2.2.10</token> + <xml name="version_command"> + <version_command>@EXECUTABLE@ --version</version_command> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + + <xml name="citations"> + <citations> + <citation type="doi">10.1186/1748-7188-6-26</citation> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnafold_SHAPE.py Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,45 @@ +### overcoming the problem of SHAPE data working with a single line. +### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every +### single sequence. + +import os +import sys +from os import system +from Bio import SeqIO +import re +from subprocess import Popen, PIPE + +params_list = sys.argv[1:] +param_list_no_shape = [s for s in params_list if not "--shape=" in s ] +shape_file = [s for s in params_list if "--shape=" in s ] +assert (len(shape_file) == 1) + +shape_file = shape_file[0] +shape_file = shape_file.replace('--shape=', '') + +params_no_shape = " ".join(str(x) for x in param_list_no_shape) + +pattern = re.compile("^>.*$") +id_line = "" +with open(shape_file, 'r') as f: + content = f.read() + lines = content.split('\n') + for line in lines: + if pattern.match(line): + id_line = line.split()[0] + id_line = id_line[1:] + continue + else: + with open(id_line +'.tmp', "a") as clFile: + clFile.write(line + "\n") + +input_file = sys.stdin + +for record in SeqIO.parse(input_file, "fasta"): + seq = ">{}\n{}".format(record.id,record.seq) + cmd = " RNAfold --shape=" + record.id + '.tmp ' + params_no_shape + p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE) + out,err = p.communicate(seq.encode()) + if err: + raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err)) + print (out.decode('utf-8').strip())
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnaplfold.xml Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,125 @@ +<tool id="viennarna_rnaplfold" name="@EXECUTABLE@" version="@VERSION@.0"> + <description> predicts RNA secondary structures including pseudoknots</description> + + <macros> + <token name="@EXECUTABLE@">RNAplfold</token> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <expand macro="version_command" /> + <command> +<![CDATA[ + RNAplfold < '$input' + -T$temperature + --dangles=$dangling + --cutoff=$cutoff + --winsize=$winsize + --span=$span + $onthefly + $openingenergies + #if $varExists('$unpairedOption.ulength') + --ulength=$unpairedOption.ulength + #end if + #if $varExists('$advancedOptions.nolp') + $advancedOptions.noconversion + $advancedOptions.nolp + $advancedOptions.nogu + $advancedOptions.noclosinggu + $advancedOptions.notetra + #end if + && find -name '*_basepairs' -or -name '*_lunp' -or -name '*_openen*' > files.tmp + && tar -cf '$outputf' --files-from=files.tmp + +]]> + </command> + + <inputs> + <param format="fasta" name="input" type="data" label="Fasta file"/> + <param name="temperature" type="float" value="37.0" label="temperature [°C]" help="-T"/> + <param name="dangling" type="select" label="how to treat dangling end energies" help="-d"> + <option value="2" selected="true">unpaired bases participate in all dangling ends (2)</option> + <option value="0">ignore dangling ends (0)</option> + <option value="1">unpaired bases participate in one dangling end only (1)</option> + <option value="3">allow coaxial stacking (3)</option> + </param> + <param name="winsize" type="integer" value="70" label="Average pairing probabilities over this windowsize" help="--winsize"/> + <param name="span" type="integer" value="70" label="Maximum seperation between base pairs" help="--span, -L"/> + <param name="cutoff" type="float" value="0.01" label="Cutoff probability for report on base pairing" help="--cutoff"/> + <param name="onthefly" type="boolean" truevalue="--print_onthefly" falsevalue="" checked="false" label="Print simplified base pair probabilities (_basepairs output)" help="--print_onthefly"/> + <param name="openingenergies" type="boolean" truevalue="--opening_energies" falsevalue="" checked="false" label="Output in logarithm of the probabilities (_openen output)" help="--opening_energies"/> + <param argument="--plex_output" type="boolean" truevalue="--plex_output" falsevalue="" checked="false" label="" help=""/> + <conditional name="unpairedOption"> + <param name="unpairedSelector" type="select" label="Compute probabilty that region is unpaired (_lunp output)"> + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="yes"> + <param name="ulength" type="integer" value="31" label="Maximal lenght of unpaired region" help="--ulength"/> + </when> + <when value="no"> + </when> + </conditional> + <conditional name="advancedOptions"> + <param name="advancedSelector" type="select" label="advanced options"> + <option value="basic">basic Options</option> + <option value="advanced">advanced Options</option> + </param> + <when value="advanced"> + <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> + <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> + <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/> + <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/> + <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/> + </when> + <when value="basic"> + </when> + </conditional> + </inputs> + <outputs> + <collection name="matrix_outputs" type="list" label="rna_eps outputs"> + <discover_datasets pattern="(?P<designation>.+)_dp\.ps" ext="rna_eps" visible="true"/> + </collection> + <data format="tar" name="outputf"/> + </outputs> + <tests> + <test> + <param name="input" value="rnaplfold_input1.fa"/> + <output_collection name="matrix_outputs" type="list"> + <element name="Anolis_caro_chrUn_GL343590.trna2-A"> + <assert_contents> + <has_text_matching expression="%%Creator: ViennaRNA-@VERSION@" /> + </assert_contents> + </element> + </output_collection> + </test> + </tests> + <help> +<![CDATA[ + +**RNAplfold** + +Computes local pair probabilities for base pairs with a maximal span of L. The probabilities are averaged over all windows of size L that contain the base pair. For a sequence of length n and a window size of L the algorithm uses only O(n+L*L) memory and O(n*L*L) CPU time. Thus it is practical to "scan" very large genomes for short stable RNA structures. + + +----- + +**Input format** + +RNAPplfold requires one input file + +- Fasta file + +------ + +**Outputs** + +For each structure in the Fasta input a postscript image with dot-plot of the pairing probabilities is generated. Different output is generated with the "--ulength", "--print_onthefly" and "--opening_energies" flags. +The Dot Plot Matrices are stored in a Postscript file. +The other output is packed in a tar file. + + +]]> + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,370 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%BoundingBox: 66 211 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show + +/sequence { (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) } def +/len { sequence length } bind def + +72 216 translate +72 6 mul len 1 add div dup scale +/Helvetica findfont 0.95 scalefont setfont + +drawseq +0.5 dup translate +% draw diagonal +0.04 setlinewidth +0 len moveto len 0 lineto stroke + +/min { 2 copy gt { exch } if pop } bind def + +/utri{ % i j prob utri + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.33 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/uHmotif{ % i j uHmotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/lHmotif{ % i j lHmotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/uImotif{ % i j k l uImotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup + 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll + moveto lineto lineto lineto closepath fill + grestore +} bind def +/lImotif{ % i j k l lImotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch + 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll + moveto lineto lineto lineto closepath fill + grestore +} bind def + +%data starts here + +%start of quadruplex data + +%start of Hmotif data + +%start of Imotif data + +%draw the grid +drawgrid + +%start of base pair probability data +1 71 0.011137621 ubox +1 72 0.998618513 ubox +2 70 0.011249479 ubox +2 71 0.999343269 ubox +2 72 0.029380302 ubox +3 69 0.016278852 ubox +3 70 0.998657995 ubox +3 71 0.029349731 ubox +3 72 0.013044031 ubox +4 68 0.015570075 ubox +4 69 0.999660285 ubox +4 70 0.006500567 ubox +4 71 0.013063530 ubox +5 67 0.017184802 ubox +5 68 0.995393993 ubox +5 70 0.012116272 ubox +6 20 0.003683136 ubox +6 47 0.007871866 ubox +6 67 0.961997835 ubox +6 68 0.010641824 ubox +7 19 0.003963646 ubox +7 22 0.016669769 ubox +7 23 0.006395271 ubox +7 26 0.010803708 ubox +7 45 0.003325342 ubox +7 46 0.008388346 ubox +7 66 0.889354167 ubox +8 18 0.004993356 ubox +8 21 0.043576199 ubox +8 22 0.009051039 ubox +8 23 0.003412982 ubox +8 26 0.053349931 ubox +8 44 0.006391561 ubox +8 45 0.009575801 ubox +8 46 0.006511628 ubox +8 48 0.044296110 ubox +8 66 0.051228716 ubox +9 17 0.005076838 ubox +9 20 0.044973880 ubox +9 47 0.045851242 ubox +9 67 0.006907131 ubox +10 20 0.031947572 ubox +10 25 0.993218795 ubox +10 47 0.003684611 ubox +10 61 0.005362683 ubox +11 18 0.045881626 ubox +11 19 0.032788757 ubox +11 22 0.010762380 ubox +11 24 0.996351171 ubox +11 43 0.031784396 ubox +11 45 0.044997253 ubox +11 46 0.003273388 ubox +11 60 0.005393685 ubox +12 18 0.028759750 ubox +12 19 0.007591504 ubox +12 21 0.010602364 ubox +12 23 0.996289342 ubox +12 42 0.031993047 ubox +12 44 0.044989514 ubox +12 58 0.005409282 ubox +13 18 0.016589428 ubox +13 19 0.009128152 ubox +13 22 0.996158882 ubox +13 41 0.032010508 ubox +13 43 0.044839517 ubox +13 57 0.005483356 ubox +14 20 0.079642667 ubox +14 56 0.005446527 ubox +15 20 0.129735024 ubox +15 55 0.005085787 ubox +16 20 0.018529841 ubox +16 38 0.051862141 ubox +17 21 0.010497970 ubox +17 26 0.003797728 ubox +17 37 0.052295806 ubox +17 39 0.003520191 ubox +17 42 0.004660118 ubox +17 52 0.004889289 ubox +18 25 0.005375323 ubox +18 36 0.051745231 ubox +18 38 0.003387544 ubox +19 25 0.004215070 ubox +19 36 0.018363451 ubox +19 40 0.005479857 ubox +19 50 0.005352275 ubox +20 24 0.003956630 ubox +20 34 0.049426221 ubox +20 35 0.019676299 ubox +20 39 0.005488315 ubox +20 49 0.005308891 ubox +21 33 0.037607150 ubox +21 38 0.005407841 ubox +22 32 0.023047831 ubox +22 33 0.039236028 ubox +23 32 0.049874318 ubox +23 47 0.036867639 ubox +24 31 0.055184372 ubox +24 47 0.041474959 ubox +25 30 0.055108050 ubox +25 41 0.003625640 ubox +25 45 0.072422399 ubox +25 46 0.047506335 ubox +26 36 0.020612775 ubox +26 40 0.011634581 ubox +26 47 0.044476135 ubox +27 35 0.020631543 ubox +27 39 0.011645626 ubox +27 43 0.992061337 ubox +27 45 0.025461226 ubox +27 46 0.039850990 ubox +28 34 0.019643833 ubox +28 42 0.996960401 ubox +28 44 0.021374269 ubox +28 45 0.024434496 ubox +29 41 0.997917003 ubox +29 43 0.018395309 ubox +29 45 0.003166236 ubox +30 36 0.012434123 ubox +30 40 0.998065717 ubox +30 47 0.007404570 ubox +31 35 0.012393915 ubox +31 39 0.997764981 ubox +31 41 0.005414838 ubox +31 43 0.003645699 ubox +31 46 0.007622516 ubox +32 37 0.068093187 ubox +32 39 0.013599795 ubox +32 42 0.003678913 ubox +32 45 0.007610493 ubox +33 37 0.102337630 ubox +33 39 0.003720007 ubox +33 41 0.003538594 ubox +33 44 0.007538047 ubox +34 38 0.013851913 ubox +36 41 0.007501659 ubox +38 48 0.018700348 ubox +39 47 0.020533473 ubox +40 46 0.020625702 ubox +44 68 0.005576608 ubox +44 70 0.006111196 ubox +45 50 0.003800521 ubox +45 62 0.010043051 ubox +45 65 0.003484260 ubox +45 67 0.009783316 ubox +45 68 0.032579696 ubox +45 69 0.007408521 ubox +46 61 0.010086460 ubox +46 65 0.005780351 ubox +46 67 0.077112938 ubox +46 68 0.006873266 ubox +47 60 0.010092967 ubox +47 64 0.003785455 ubox +47 66 0.084736602 ubox +48 59 0.008724857 ubox +48 67 0.019275395 ubox +49 65 0.998806957 ubox +50 57 0.009062054 ubox +50 64 0.999848265 ubox +51 56 0.007052370 ubox +51 62 0.010700667 ubox +51 63 0.999834583 ubox +52 61 0.014860342 ubox +52 62 0.999778783 ubox +52 63 0.005533111 ubox +53 61 0.998254922 ubox +53 62 0.007658167 ubox +54 59 0.156536412 ubox +55 60 0.324268739 ubox +56 60 0.024269416 ubox +1 72 0.9500000 lbox +2 71 0.9500000 lbox +3 70 0.9500000 lbox +4 69 0.9500000 lbox +5 68 0.9500000 lbox +6 67 0.9500000 lbox +7 66 0.9500000 lbox +10 25 0.9500000 lbox +11 24 0.9500000 lbox +12 23 0.9500000 lbox +13 22 0.9500000 lbox +27 43 0.9500000 lbox +28 42 0.9500000 lbox +29 41 0.9500000 lbox +30 40 0.9500000 lbox +31 39 0.9500000 lbox +49 65 0.9500000 lbox +50 64 0.9500000 lbox +51 63 0.9500000 lbox +52 62 0.9500000 lbox +53 61 0.9500000 lbox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,231 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%Title: RNA Secondary Structure Plot +%%BoundingBox: 66 210 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% to switch off outline pairs of sequence comment or +% delete the appropriate line near the end of the file + +%%BeginProlog +/RNAplot 100 dict def +RNAplot begin +/fsize 14 def +/outlinecolor {0.2 setgray} bind def +/paircolor {0.2 setgray} bind def +/seqcolor {0 setgray} bind def +/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def +/min { 2 copy gt { exch } if pop } bind def +/max { 2 copy lt { exch } if pop } bind def +/arccoords { % i j arccoords + % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j + % onto the stack + dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if + dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup + 4 -2 roll 5 -1 roll {exch} if 4 2 roll + sequence length dup 2 div exch 3 1 roll lt + {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} + { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if + 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll + exch add 4 -1 roll dup 5 1 roll sub 1 sub + 5 -1 roll not {4 -2 roll exch 4 2 roll} if + }ifelse + % compute the scalingfactor and prepare (1-sf) and sf*r + 2 mul exch cpr 3 1 roll div dup + 3 -1 roll mul exch 1 exch sub exch + % compute the coordinates + 3 -1 roll 1 sub coor exch get aload pop % get coord for i + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 + 5 -1 roll 1 sub coor exch get aload pop % get coord for j + % duplicate j coord + dup 3 -1 roll dup 4 1 roll exch 8 2 roll + 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 + 6 -1 roll mul 5 -1 roll add exch % calculate x2 + 6 -2 roll % reorder +} bind def +/drawoutline { + gsave outlinecolor newpath + coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence + currentdict /cutpoint known % check if cutpoint is defined + {coor 0 cutpoint getinterval + {aload pop lineto} forall % draw outline of 1st sequence + coor cutpoint 1 add get aload pop + 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence + coor cutpoint 1 add coor length cutpoint 1 add sub getinterval + {aload pop lineto} forall} % draw outline of 2nd sequence + {coor {aload pop lineto} forall} % draw outline as a whole + ifelse + stroke grestore +} bind def +/drawpairs { + paircolor + 0.7 setlinewidth + [9 3.01] 9 setdash + newpath + pairs {aload pop + currentdict (cpr) known + { exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { coor exch 1 sub get aload pop moveto + coor exch 1 sub get aload pop lineto + }ifelse + } forall + stroke +} bind def +% draw bases +/drawbases { + [] 0 setdash + seqcolor + 0 + coor { + aload pop moveto + dup sequence exch 1 getinterval cshow + 1 add + } forall + pop +} bind def + +/init { + /Helvetica findfont fsize scalefont setfont + 1 setlinejoin + 1 setlinecap + 0.8 setlinewidth + 72 216 translate + % find the coordinate range + /xmax -1000 def /xmin 10000 def + /ymax -1000 def /ymin 10000 def + coor { + aload pop + dup ymin lt {dup /ymin exch def} if + dup ymax gt {/ymax exch def} {pop} ifelse + dup xmin lt {dup /xmin exch def} if + dup xmax gt {/xmax exch def} {pop} ifelse + } forall + /size {xmax xmin sub ymax ymin sub max} bind def + 72 6 mul size div dup scale + size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div + translate +} bind def +end +%%EndProlog +RNAplot begin +% data start here +/sequence (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) def +/coor [ +[111.04756165 225.82804871] +[110.41094971 210.84155273] +[109.77433014 195.85507202] +[109.13771057 180.86859131] +[108.50109100 165.88211060] +[107.86447144 150.89561462] +[107.22785950 135.90913391] +[90.28739166 133.48460388] +[77.11851501 123.91786957] +[70.32070923 110.05319977] +[55.37474823 111.32528687] +[40.42878342 112.59737396] +[25.48282242 113.86946106] +[17.57515907 127.22043610] +[3.31690264 133.34266663] +[-11.80935574 129.88204956] +[-21.98726082 118.16923523] +[-23.30319977 102.70806122] +[-15.25116920 89.44365692] +[-0.92733771 83.47645569] +[14.16048908 87.10096741] +[24.21073341 98.92350006] +[39.15669632 97.65141296] +[54.10265732 96.37932587] +[69.04862213 95.10723114] +[75.20735168 80.83619690] +[87.46604156 71.28019714] +[84.93103027 56.49596024] +[82.39601898 41.71172333] +[79.86100006 26.92748451] +[77.32598877 12.14324570] +[63.73017883 4.41744947] +[58.32971573 -10.25800610] +[63.67453384 -24.95381927] +[77.24097443 -32.73107910] +[92.62337494 -29.91759682] +[102.55863953 -17.84181786] +[102.35564423 -2.20555139] +[92.11022949 9.60823345] +[94.64524078 24.39247131] +[97.18025208 39.17671204] +[99.71526337 53.96094894] +[102.25028229 68.74518585] +[111.61898041 69.95008087] +[120.45154572 73.97383881] +[127.89853668 80.59681702] +[133.19635010 89.34370422] +[135.74378967 99.51597595] +[135.16680908 110.24712372] +[150.04531860 112.15238953] +[164.92382812 114.05766296] +[179.80232239 115.96292877] +[194.68083191 117.86819458] +[206.04914856 107.13062286] +[221.66270447 106.26418304] +[234.14927673 115.67798615] +[237.61306763 130.92712402] +[230.41859436 144.81141663] +[215.96286011 150.77513123] +[201.07142639 146.00236511] +[192.77557373 132.74670410] +[177.89706421 130.84143066] +[163.01855469 128.93617249] +[148.14004517 127.03089905] +[133.26153564 125.12563324] +[122.21434021 135.27252197] +[122.85095978 150.25900269] +[123.48757935 165.24548340] +[124.12419128 180.23197937] +[124.76081085 195.21846008] +[125.39743042 210.20494080] +[126.03404999 225.19142151] +[129.04023743 244.33856201] +] def +/pairs [ +[1 72] +[2 71] +[3 70] +[4 69] +[5 68] +[6 67] +[7 66] +[10 25] +[11 24] +[12 23] +[13 22] +[27 43] +[28 42] +[29 41] +[30 40] +[31 39] +[49 65] +[50 64] +[51 63] +[52 62] +[53 61] +] def + +init + +% switch off outline pairs or bases by removing these lines +drawoutline +drawpairs +drawbases +% show it +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,507 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%BoundingBox: 66 211 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343590.trna2_AlaAGC) show + +/sequence { (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) } def +/len { sequence length } bind def + +72 216 translate +72 6 mul len 1 add div dup scale +/Helvetica findfont 0.95 scalefont setfont + +drawseq +0.5 dup translate +% draw diagonal +0.04 setlinewidth +0 len moveto len 0 lineto stroke + +/min { 2 copy gt { exch } if pop } bind def + +/utri{ % i j prob utri + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.33 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/uHmotif{ % i j uHmotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/lHmotif{ % i j lHmotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub + moveto lineto lineto closepath fill + grestore +} bind def +/uImotif{ % i j k l uImotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup + 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll + moveto lineto lineto lineto closepath fill + grestore +} bind def +/lImotif{ % i j k l lImotif + gsave + 1 min 2 div + 0.85 mul 0.15 add 0.95 0.99 + 3 1 roll % prepare hsb color + sethsbcolor + % now produce the coordinates for lines + 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch + 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll + moveto lineto lineto lineto closepath fill + grestore +} bind def + +%data starts here + +%start of quadruplex data + +%start of Hmotif data + +%start of Imotif data + +%draw the grid +drawgrid + +%start of base pair probability data +1 6 0.004632238 ubox +1 9 0.006654223 ubox +1 14 0.116131258 ubox +1 15 0.005506901 ubox +1 30 0.009716645 ubox +1 34 0.073740324 ubox +1 37 0.006701873 ubox +1 64 0.004871484 ubox +1 73 0.570925214 ubox +2 8 0.007083382 ubox +2 11 0.008406236 ubox +2 12 0.007044803 ubox +2 13 0.129102832 ubox +2 27 0.003166551 ubox +2 29 0.016103198 ubox +2 31 0.059809132 ubox +2 32 0.018860727 ubox +2 33 0.080458349 ubox +2 36 0.007548805 ubox +2 63 0.005718318 ubox +2 69 0.007556179 ubox +2 70 0.028650384 ubox +2 71 0.546628270 ubox +2 72 0.773685839 ubox +3 7 0.004749417 ubox +3 11 0.010358730 ubox +3 12 0.129015255 ubox +3 13 0.003933689 ubox +3 28 0.016108727 ubox +3 29 0.005358837 ubox +3 31 0.020535925 ubox +3 32 0.083122889 ubox +3 62 0.005713974 ubox +3 68 0.006646921 ubox +3 69 0.031485159 ubox +3 70 0.558919532 ubox +3 71 0.770984265 ubox +3 72 0.215962264 ubox +4 8 0.003846249 ubox +4 11 0.128681370 ubox +4 13 0.011210848 ubox +4 25 0.004019121 ubox +4 27 0.015919907 ubox +4 28 0.004907639 ubox +4 29 0.064014656 ubox +4 31 0.083429550 ubox +4 61 0.005688924 ubox +4 67 0.004381706 ubox +4 68 0.030984314 ubox +4 69 0.928667711 ubox +4 70 0.171363563 ubox +4 71 0.216620666 ubox +4 72 0.007349484 ubox +5 12 0.010780540 ubox +5 28 0.062660548 ubox +5 47 0.006856414 ubox +5 67 0.030480480 ubox +5 68 0.927409033 ubox +5 70 0.201662161 ubox +6 17 0.003163375 ubox +6 20 0.004307680 ubox +6 28 0.008183017 ubox +6 47 0.073508582 ubox +6 50 0.015670251 ubox +6 59 0.003724079 ubox +6 67 0.895370856 ubox +6 68 0.033940401 ubox +6 70 0.008321205 ubox +7 16 0.003361849 ubox +7 19 0.004518445 ubox +7 22 0.015784771 ubox +7 23 0.006061468 ubox +7 26 0.014487017 ubox +7 44 0.005844573 ubox +7 45 0.012806982 ubox +7 46 0.076342752 ubox +7 48 0.020848970 ubox +7 49 0.018126701 ubox +7 58 0.004549362 ubox +7 66 0.827624872 ubox +8 15 0.003431379 ubox +8 18 0.005204581 ubox +8 21 0.036410380 ubox +8 22 0.007907851 ubox +8 26 0.044491013 ubox +8 44 0.019732249 ubox +8 45 0.085065889 ubox +8 46 0.073831467 ubox +8 48 0.244628685 ubox +8 57 0.004318992 ubox +8 64 0.004391699 ubox +8 66 0.049191061 ubox +9 17 0.005251011 ubox +9 20 0.037521120 ubox +9 47 0.253722300 ubox +9 67 0.010690853 ubox +9 68 0.010096246 ubox +9 70 0.004399209 ubox +10 20 0.026215970 ubox +10 25 0.829289356 ubox +10 36 0.006465083 ubox +10 47 0.027737796 ubox +10 63 0.004597663 ubox +10 65 0.005017003 ubox +10 67 0.005447271 ubox +10 69 0.005544437 ubox +11 18 0.038327522 ubox +11 19 0.026908727 ubox +11 22 0.008733209 ubox +11 24 0.831795780 ubox +11 35 0.006471634 ubox +11 43 0.468132693 ubox +11 45 0.252989051 ubox +11 46 0.024187195 ubox +12 18 0.023602891 ubox +12 19 0.006232645 ubox +12 21 0.008604981 ubox +12 23 0.831740817 ubox +12 34 0.006375561 ubox +12 42 0.472749007 ubox +12 44 0.251590986 ubox +12 45 0.014945041 ubox +13 18 0.013723928 ubox +13 19 0.007497427 ubox +13 22 0.831631273 ubox +13 39 0.003427828 ubox +13 41 0.473909293 ubox +13 43 0.250370719 ubox +14 20 0.066488520 ubox +14 38 0.003182944 ubox +14 40 0.457844605 ubox +15 20 0.108308493 ubox +15 38 0.011419523 ubox +15 40 0.051301522 ubox +16 20 0.015471478 ubox +16 38 0.470000855 ubox +16 40 0.178550335 ubox +17 21 0.008767749 ubox +17 26 0.003387803 ubox +17 37 0.496886199 ubox +17 39 0.177094176 ubox +17 73 0.045173900 ubox +18 25 0.004902375 ubox +18 36 0.492816130 ubox +18 38 0.121851863 ubox +18 72 0.055748796 ubox +19 25 0.003883170 ubox +19 36 0.239923237 ubox +19 38 0.005417278 ubox +19 71 0.055691551 ubox +20 24 0.003644610 ubox +20 34 0.470810526 ubox +20 35 0.247657199 ubox +20 37 0.005831255 ubox +21 32 0.009783764 ubox +21 33 0.358241990 ubox +21 70 0.054635624 ubox +22 29 0.006362768 ubox +22 31 0.013177914 ubox +22 32 0.219551670 ubox +22 33 0.403084545 ubox +22 68 0.003789411 ubox +22 69 0.055392027 ubox +23 28 0.006024870 ubox +23 32 0.500859862 ubox +23 33 0.004324443 ubox +23 47 0.031904991 ubox +23 67 0.003787974 ubox +23 68 0.052636256 ubox +24 29 0.008474011 ubox +24 31 0.549100761 ubox +24 47 0.049197557 ubox +24 67 0.030536001 ubox +25 30 0.548338702 ubox +25 41 0.004144135 ubox +25 45 0.067140277 ubox +25 46 0.053750180 ubox +26 36 0.057394616 ubox +26 40 0.012772171 ubox +26 47 0.064315077 ubox +26 50 0.004714852 ubox +27 35 0.057448226 ubox +27 39 0.013170691 ubox +27 43 0.815569764 ubox +27 45 0.049009957 ubox +27 46 0.063413875 ubox +27 49 0.005262423 ubox +27 53 0.004564973 ubox +28 34 0.054697757 ubox +28 42 0.820379890 ubox +28 44 0.048191892 ubox +28 45 0.035895579 ubox +28 46 0.029285776 ubox +28 48 0.006599916 ubox +28 52 0.004579520 ubox +29 41 0.821245880 ubox +29 43 0.046763735 ubox +29 45 0.057920583 ubox +29 46 0.006457134 ubox +29 51 0.004606001 ubox +30 36 0.024024302 ubox +30 40 0.821070294 ubox +30 47 0.027558338 ubox +30 50 0.004615290 ubox +31 35 0.023900118 ubox +31 39 0.821259198 ubox +31 41 0.031662456 ubox +31 43 0.068739658 ubox +31 45 0.005088084 ubox +31 46 0.028387067 ubox +31 49 0.004618779 ubox +32 37 0.056070394 ubox +32 39 0.007808716 ubox +32 41 0.004679327 ubox +32 42 0.069668252 ubox +32 44 0.005113833 ubox +32 45 0.028339924 ubox +32 48 0.003694275 ubox +33 37 0.084188349 ubox +33 39 0.012554387 ubox +33 41 0.069738589 ubox +33 43 0.004988753 ubox +33 44 0.028077519 ubox +33 48 0.005052659 ubox +34 38 0.015647295 ubox +34 40 0.068716940 ubox +34 47 0.005883003 ubox +35 72 0.003223293 ubox +36 41 0.028025736 ubox +36 45 0.006071525 ubox +37 47 0.004492398 ubox +37 67 0.004929165 ubox +38 46 0.004623641 ubox +38 66 0.005612639 ubox +38 73 0.096471321 ubox +39 65 0.006372388 ubox +39 72 0.134387529 ubox +40 64 0.006366003 ubox +40 73 0.044296160 ubox +41 63 0.006315212 ubox +41 71 0.157425382 ubox +41 72 0.055795571 ubox +42 47 0.003279277 ubox +42 70 0.158258676 ubox +43 63 0.003504831 ubox +43 69 0.159460464 ubox +43 71 0.083592343 ubox +43 72 0.004963441 ubox +44 67 0.003632562 ubox +44 68 0.157762054 ubox +44 70 0.122775573 ubox +45 56 0.003216980 ubox +45 62 0.033079448 ubox +45 63 0.006333865 ubox +45 65 0.005683413 ubox +45 67 0.142807045 ubox +45 68 0.102004762 ubox +45 69 0.139542279 ubox +45 70 0.038496405 ubox +45 71 0.007227554 ubox +45 72 0.051023600 ubox +46 55 0.003223253 ubox +46 61 0.033233869 ubox +46 62 0.005934201 ubox +46 65 0.014068389 ubox +46 67 0.151344698 ubox +46 68 0.117431569 ubox +46 69 0.048110592 ubox +46 70 0.005932615 ubox +46 71 0.051023157 ubox +47 60 0.033207628 ubox +47 64 0.011567823 ubox +47 66 0.169443202 ubox +48 59 0.032419774 ubox +48 67 0.054982355 ubox +48 68 0.015912705 ubox +48 70 0.010752649 ubox +49 56 0.003800040 ubox +49 59 0.006023614 ubox +49 63 0.008508712 ubox +49 65 0.996813137 ubox +49 67 0.013145831 ubox +49 69 0.007555919 ubox +50 57 0.025044897 ubox +50 58 0.008142900 ubox +50 64 0.998396751 ubox +50 66 0.013239028 ubox +51 56 0.028984258 ubox +51 62 0.014992485 ubox +51 63 0.999154389 ubox +51 65 0.013340412 ubox +52 56 0.007696861 ubox +52 61 0.018442907 ubox +52 62 0.999085217 ubox +52 63 0.014927477 ubox +52 72 0.003975401 ubox +53 61 0.997430929 ubox +53 62 0.015882748 ubox +53 71 0.003986825 ubox +54 59 0.163009340 ubox +54 70 0.003908232 ubox +55 60 0.162646810 ubox +56 60 0.056948332 ubox +57 68 0.004617988 ubox +58 67 0.004981508 ubox +59 66 0.005078979 ubox +60 65 0.005070973 ubox +2 71 0.9500000 lbox +3 70 0.9500000 lbox +4 69 0.9500000 lbox +5 68 0.9500000 lbox +6 67 0.9500000 lbox +7 66 0.9500000 lbox +10 25 0.9500000 lbox +11 24 0.9500000 lbox +12 23 0.9500000 lbox +13 22 0.9500000 lbox +27 43 0.9500000 lbox +28 42 0.9500000 lbox +29 41 0.9500000 lbox +30 40 0.9500000 lbox +31 39 0.9500000 lbox +49 65 0.9500000 lbox +50 64 0.9500000 lbox +51 63 0.9500000 lbox +52 62 0.9500000 lbox +53 61 0.9500000 lbox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,230 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%Title: RNA Secondary Structure Plot +%%BoundingBox: 66 210 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% to switch off outline pairs of sequence comment or +% delete the appropriate line near the end of the file + +%%BeginProlog +/RNAplot 100 dict def +RNAplot begin +/fsize 14 def +/outlinecolor {0.2 setgray} bind def +/paircolor {0.2 setgray} bind def +/seqcolor {0 setgray} bind def +/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def +/min { 2 copy gt { exch } if pop } bind def +/max { 2 copy lt { exch } if pop } bind def +/arccoords { % i j arccoords + % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j + % onto the stack + dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if + dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup + 4 -2 roll 5 -1 roll {exch} if 4 2 roll + sequence length dup 2 div exch 3 1 roll lt + {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} + { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if + 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll + exch add 4 -1 roll dup 5 1 roll sub 1 sub + 5 -1 roll not {4 -2 roll exch 4 2 roll} if + }ifelse + % compute the scalingfactor and prepare (1-sf) and sf*r + 2 mul exch cpr 3 1 roll div dup + 3 -1 roll mul exch 1 exch sub exch + % compute the coordinates + 3 -1 roll 1 sub coor exch get aload pop % get coord for i + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 + 5 -1 roll 1 sub coor exch get aload pop % get coord for j + % duplicate j coord + dup 3 -1 roll dup 4 1 roll exch 8 2 roll + 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 + 6 -1 roll mul 5 -1 roll add exch % calculate x2 + 6 -2 roll % reorder +} bind def +/drawoutline { + gsave outlinecolor newpath + coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence + currentdict /cutpoint known % check if cutpoint is defined + {coor 0 cutpoint getinterval + {aload pop lineto} forall % draw outline of 1st sequence + coor cutpoint 1 add get aload pop + 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence + coor cutpoint 1 add coor length cutpoint 1 add sub getinterval + {aload pop lineto} forall} % draw outline of 2nd sequence + {coor {aload pop lineto} forall} % draw outline as a whole + ifelse + stroke grestore +} bind def +/drawpairs { + paircolor + 0.7 setlinewidth + [9 3.01] 9 setdash + newpath + pairs {aload pop + currentdict (cpr) known + { exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { coor exch 1 sub get aload pop moveto + coor exch 1 sub get aload pop lineto + }ifelse + } forall + stroke +} bind def +% draw bases +/drawbases { + [] 0 setdash + seqcolor + 0 + coor { + aload pop moveto + dup sequence exch 1 getinterval cshow + 1 add + } forall + pop +} bind def + +/init { + /Helvetica findfont fsize scalefont setfont + 1 setlinejoin + 1 setlinecap + 0.8 setlinewidth + 72 216 translate + % find the coordinate range + /xmax -1000 def /xmin 10000 def + /ymax -1000 def /ymin 10000 def + coor { + aload pop + dup ymin lt {dup /ymin exch def} if + dup ymax gt {/ymax exch def} {pop} ifelse + dup xmin lt {dup /xmin exch def} if + dup xmax gt {/xmax exch def} {pop} ifelse + } forall + /size {xmax xmin sub ymax ymin sub max} bind def + 72 6 mul size div dup scale + size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div + translate +} bind def +end +%%EndProlog +RNAplot begin +% data start here +/sequence (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) def +/coor [ +[102.34599304 225.12051392] +[110.41094971 210.84155273] +[109.77433014 195.85507202] +[109.13771057 180.86859131] +[108.50109100 165.88211060] +[107.86447144 150.89561462] +[107.22785950 135.90913391] +[90.28739166 133.48460388] +[77.11851501 123.91786957] +[70.32070923 110.05319977] +[55.37474823 111.32528687] +[40.42878342 112.59737396] +[25.48282242 113.86946106] +[17.57515907 127.22043610] +[3.31690264 133.34266663] +[-11.80935574 129.88204956] +[-21.98726082 118.16923523] +[-23.30319977 102.70806122] +[-15.25116920 89.44365692] +[-0.92733771 83.47645569] +[14.16048908 87.10096741] +[24.21073341 98.92350006] +[39.15669632 97.65141296] +[54.10265732 96.37932587] +[69.04862213 95.10723114] +[75.20735168 80.83619690] +[87.46604156 71.28019714] +[84.93103027 56.49596024] +[82.39601898 41.71172333] +[79.86100006 26.92748451] +[77.32598877 12.14324570] +[63.73017883 4.41744947] +[58.32971573 -10.25800610] +[63.67453384 -24.95381927] +[77.24097443 -32.73107910] +[92.62337494 -29.91759682] +[102.55863953 -17.84181786] +[102.35564423 -2.20555139] +[92.11022949 9.60823345] +[94.64524078 24.39247131] +[97.18025208 39.17671204] +[99.71526337 53.96094894] +[102.25028229 68.74518585] +[111.61898041 69.95008087] +[120.45154572 73.97383881] +[127.89853668 80.59681702] +[133.19635010 89.34370422] +[135.74378967 99.51597595] +[135.16680908 110.24712372] +[150.04531860 112.15238953] +[164.92382812 114.05766296] +[179.80232239 115.96292877] +[194.68083191 117.86819458] +[206.04914856 107.13062286] +[221.66270447 106.26418304] +[234.14927673 115.67798615] +[237.61306763 130.92712402] +[230.41859436 144.81141663] +[215.96286011 150.77513123] +[201.07142639 146.00236511] +[192.77557373 132.74670410] +[177.89706421 130.84143066] +[163.01855469 128.93617249] +[148.14004517 127.03089905] +[133.26153564 125.12563324] +[122.21434021 135.27252197] +[122.85095978 150.25900269] +[123.48757935 165.24548340] +[124.12419128 180.23197937] +[124.76081085 195.21846008] +[125.39743042 210.20494080] +[134.64427185 223.74850464] +[127.29573059 238.40902710] +] def +/pairs [ +[2 71] +[3 70] +[4 69] +[5 68] +[6 67] +[7 66] +[10 25] +[11 24] +[12 23] +[13 22] +[27 43] +[28 42] +[29 41] +[30 40] +[31 39] +[49 65] +[50 64] +[51 63] +[52 62] +[53 61] +] def + +init + +% switch off outline pairs or bases by removing these lines +drawoutline +drawpairs +drawbases +% show it +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kinfold_input.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,1 @@ +ACUGAUCGUAGUCAC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mfe_struct_result.fasta Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>test_seq mfe: -13.6 +ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG +.(((((((((.......)))))))))........
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_input1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1> +.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2> +k l en structure
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_input1.clustal Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,1 @@ +(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_input1.clustal Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL34 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL35 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_input1.stk Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,5 @@ +# STOCKHOLM 1.0 +#=GF SQ 2 +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_result_MEA.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25) +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-26.77] +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 + -0.25 d=1.28} +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-26.45 = -26.20 + -0.25 MEA=70.93} + frequency of mfe structure in ensemble 0.773705; ensemble diversity 2.40
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_resultfa.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_resultstk.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_input1.fas Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_input1.dbn Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,1 @@ +f: 4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_input1.dbn Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input2.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1_mea.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,14 @@ +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88} + frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88] +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64} +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81} + frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1_pf.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,12 @@ +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} + frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88] +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64} + frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result2.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37) +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result3.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Sequence +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +> comment 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,102 @@ +> comment 1 +0 0.0407267 +1 0.0435052 +2 0.0470227 +3 0.0505646 +4 0.0553391 +5 0.0603894 +6 0.0662047 +7 0.0718158 +8 0.0782007 +9 0.0863514 +10 0.0950516 +11 0.10505 +12 0.115613 +13 0.128245 +14 0.141712 +15 0.157281 +16 0.17497 +17 0.195056 +18 0.216799 +19 0.241743 +20 0.270432 +21 0.302132 +22 0.337644 +23 0.377263 +24 0.421546 +25 0.470799 +26 0.525589 +27 0.587016 +28 0.653829 +29 0.726606 +30 0.806458 +31 0.892656 +32 0.984857 +33 1.08272 +34 1.18601 +35 1.29332 +36 1.40305 +37 1.51467 +38 1.62618 +39 1.73524 +40 1.84032 +41 1.9407 +42 2.03385 +43 2.11859 +44 2.19443 +45 2.26182 +46 2.31999 +47 2.36969 +48 2.41182 +49 2.44826 +50 2.47967 +51 2.50769 +52 2.534 +53 2.55942 +54 2.5851 +55 2.61217 +56 2.64151 +57 2.67329 +58 2.70759 +59 2.74465 +60 2.78458 +61 2.8279 +62 2.8742 +63 2.92425 +64 2.97698 +65 3.03283 +66 3.09163 +67 3.15591 +68 3.23033 +69 3.3067 +70 3.38122 +71 3.45791 +72 3.54606 +73 3.63843 +74 3.73392 +75 3.83847 +76 3.94646 +77 4.05462 +78 4.16571 +79 4.28366 +80 4.39944 +81 4.50863 +82 4.61035 +83 4.70186 +84 4.78345 +85 4.85204 +86 4.90509 +87 4.9392 +88 4.95425 +89 4.95214 +90 4.93688 +91 4.91166 +92 4.87691 +93 4.8314 +94 4.78561 +95 4.75271 +96 4.71866 +97 4.66056 +98 4.57671 +99 4.48395 +100 4.39006
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnainverse_input1.clu Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). +gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_input1.clustal Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73 +((((........)))). ( -5.10) 10 - 26 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,28 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +.((((....)))). ( -0.10) 56 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -7.70) 48 +.((((..(((((.......)))))..)))). (-10.30) 42 +.(((((...(((((.......))))).))))). (-11.50) 40 +.((.(((((...(((((.......))))).))))))) (-12.10) 37 +.(((((.......))))). ( -5.80) 26 +.((.(((((.......)))))..)). ( -6.70) 23 +.((((....)))). ( -3.20) 21 +.((.((((....)))).)). ( -4.70) 18 +.((((........)))). ( -5.30) 9 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA + (-22.00) +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -9.20) 48 +.((((..(((((.......)))))..)))). (-11.80) 42 +.(((((...(((((.......))))).))))). (-13.30) 40 +.((.(((((...(((((.......))))).))))))) (-13.60) 37 +.(((((.......))))). ( -7.70) 26 +.((.(((((.......)))))..)). ( -8.60) 23 +.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16 +.((((........)))). ( -5.30) 9 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA + (-29.60)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fas Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,1 @@ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,7 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +68.8844 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +8.66253
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90) +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-A (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-A (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result1.ps Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,242 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show + +/sequence { (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1568 ubox +2 71 0.9619 ubox +3 69 0.1395 ubox +3 70 0.7414 ubox +3 72 0.8060 ubox +4 68 0.1157 ubox +4 69 0.6748 ubox +4 71 0.4682 ubox +5 67 0.1065 ubox +5 68 0.6724 ubox +5 70 0.3765 ubox +6 47 0.1250 ubox +6 67 0.6497 ubox +7 46 0.1273 ubox +7 66 0.6008 ubox +8 45 0.1294 ubox +8 48 0.2252 ubox +9 47 0.2335 ubox +10 25 0.7863 ubox +11 24 0.7884 ubox +11 43 0.5215 ubox +11 45 0.2330 ubox +12 23 0.7883 ubox +12 42 0.5493 ubox +12 44 0.2317 ubox +13 22 0.7882 ubox +13 41 0.5528 ubox +13 43 0.2306 ubox +14 40 0.5338 ubox +15 20 0.1027 ubox +16 38 0.5325 ubox +16 40 0.1646 ubox +17 37 0.5639 ubox +17 39 0.1633 ubox +18 36 0.5591 ubox +18 38 0.1125 ubox +19 36 0.2406 ubox +20 34 0.5341 ubox +20 35 0.2514 ubox +21 33 0.4064 ubox +22 32 0.2491 ubox +22 33 0.4413 ubox +23 32 0.5541 ubox +24 31 0.6100 ubox +25 30 0.6092 ubox +26 36 0.2144 ubox +27 35 0.2146 ubox +27 43 0.7269 ubox +28 34 0.2043 ubox +28 42 0.7445 ubox +29 41 0.7467 ubox +30 40 0.7468 ubox +31 39 0.7470 ubox +38 73 0.3242 ubox +39 72 0.3055 ubox +40 73 0.1211 ubox +41 71 0.2953 ubox +41 72 0.1146 ubox +42 70 0.2588 ubox +43 69 0.2613 ubox +43 71 0.2848 ubox +44 68 0.2587 ubox +44 70 0.3418 ubox +45 67 0.2339 ubox +45 68 0.1772 ubox +45 69 0.3617 ubox +45 70 0.1014 ubox +45 72 0.3111 ubox +46 67 0.2550 ubox +46 68 0.3039 ubox +46 69 0.1150 ubox +46 71 0.2540 ubox +47 66 0.2925 ubox +48 67 0.1378 ubox +49 65 0.9938 ubox +50 64 0.9971 ubox +51 63 0.9980 ubox +52 62 0.9980 ubox +53 61 0.9963 ubox +54 59 0.1628 ubox +55 60 0.1625 ubox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result2.ps Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,212 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show + +/sequence { (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1914 ubox +2 71 0.9787 ubox +3 69 0.1660 ubox +3 70 0.7676 ubox +3 72 0.8449 ubox +4 68 0.1377 ubox +4 69 0.7113 ubox +4 71 0.4928 ubox +5 67 0.1266 ubox +5 68 0.7090 ubox +5 70 0.3955 ubox +6 67 0.6860 ubox +7 66 0.6345 ubox +10 25 0.9888 ubox +11 24 0.9915 ubox +12 23 0.9914 ubox +13 22 0.9913 ubox +15 20 0.1291 ubox +17 73 0.1217 ubox +18 72 0.1091 ubox +27 43 0.9522 ubox +28 42 0.9836 ubox +29 41 0.9874 ubox +30 40 0.9886 ubox +31 39 0.9883 ubox +33 37 0.1014 ubox +38 73 0.1170 ubox +39 72 0.1080 ubox +41 71 0.1523 ubox +42 70 0.1341 ubox +43 69 0.1387 ubox +43 71 0.2800 ubox +44 68 0.1392 ubox +44 70 0.3364 ubox +45 67 0.1266 ubox +45 68 0.1838 ubox +45 69 0.3586 ubox +45 72 0.3252 ubox +46 67 0.2524 ubox +46 68 0.3007 ubox +46 69 0.1142 ubox +46 71 0.2655 ubox +47 66 0.2807 ubox +48 67 0.1394 ubox +49 65 0.9981 ubox +50 64 0.9997 ubox +51 63 0.9997 ubox +52 62 0.9997 ubox +53 61 0.9981 ubox +54 59 0.1565 ubox +55 60 0.3242 ubox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.dbn Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1a.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +>homo +CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1b.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +>ACA51 +AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>ACA51 +>homo +<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 : 8,65 (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) +UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,7 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0] +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0] +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_input1.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,4 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_result1.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC + 55, 58 (0.019) for u= 4 +RNAup output in file: Anolis_caro_chrUn_GL343590.trna2-AlaAGC_u1.out +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC + 16, 19 (0.004) for u= 4 +RNAup output in file: Anolis_caro_chrUn_GL343207.trna3-AlaAGC_u1.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3.fa Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,6 @@ +>SECIS_1 test +AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU +>6S_1 test1 +GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU +>6S_2 +UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3.react Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,447 @@ +>SECIS_1 +1 0.0657466222 +2 0.1280448842 +3 0.2786665403 +4 0.1391216354 +5 0.0272299574 +6 0.1717063095 +7 0.488732281 +8 3.3015172695 +9 0.414494604 +10 0.1957445189 +11 0.4670328791 +12 0.1943420556 +13 0.2099109521 +14 0.5846784488 +15 0.1296563697 +16 0.0359267698 +17 0.0438238841 +18 1.6364597431 +19 1.72206594665E-17 +20 0.0099928394 +21 0.0475042774 +22 0.0065948845 +23 0.0574522715 +24 0.2126102485 +25 1.2006488448 +26 0.6040825271 +27 0.4114049219 +28 1.1514597937 +29 1.216707413 +30 0.0186005737 +31 0.0841609069 +32 0.086771667 +33 1.1672973211 +34 0.8144419625 +35 0.2583987716 +36 0.0182542709 +37 0.0875979754 +38 0.094456587 +39 0.5206337515 +40 0.000517531 +41 0.0253820905 +42 0.2076338063 +43 0.0087295599 +44 0.0129264641 +45 0.0127365182 +46 0.1193338151 +47 0.0186183812 +48 0.3581141112 +49 0.0941009884 +50 0.2050905673 +51 0.0209195644 +52 0.6030952711 +53 5.2129588113 +54 0.1747678483 +55 1.2231479801 +56 0.4978854319 +57 0.5711590135 +58 0.2793524314 +59 0.0037936012 +60 0.2158137729 +61 0.5646393912 +62 0.6229186627 +63 0.0193621982 +>6S_1 +1 0.1158690877 +2 0.0774028501 +3 0.2349947573 +4 1.72206594665E-17 +5 0.0926174169 +6 0.0505177415 +7 0.0457131819 +8 0.0194615986 +9 2.1495069267 +10 0.0409639397 +11 0.2185631969 +12 0.1776745985 +13 0.0086422926 +14 0.0241577615 +15 0.0092855631 +16 0.3453240509 +17 0.1535840586 +18 0.0180643958 +19 0.1188776616 +20 0.3091581196 +21 0.3748109806 +22 0.6187506508 +23 0.3511511383 +24 0.6512026704 +25 0.3096370415 +26 0.5283368492 +27 0.7500060952 +28 0.0352720444 +29 0.3776026196 +30 0.3489100484 +31 1.3035405919 +32 0.1023638167 +33 0.133082988 +34 0.0024118398 +35 0.0281166587 +36 0.2818828676 +37 0.1316060603 +38 0.1813992598 +39 0.0047490217 +40 0.0204058553 +41 0.0675891142 +42 0.045119933 +43 0.0266727645 +44 0.0673921107 +45 0.0085752561 +46 0.495476266 +47 0.8224799434 +48 0.5574272341 +49 0.2431151153 +50 0.256015696 +51 0.0386339787 +52 0.6618567864 +53 0.0707284393 +54 1.1215284869 +55 0.0463423016 +56 0.3338809513 +57 0.3987796157 +58 1.1046527917 +59 0.6156154318 +60 0.1179259769 +61 2.0333569471 +62 0.1224421595 +63 0.0266055429 +64 0.0298356423 +65 0.3004015135 +66 2.1966900004 +67 0.0222153137 +68 0.0095300422 +69 0.0503009918 +70 0.0418994997 +71 0.0384566069 +72 2.6211662666 +73 0.1704872628 +74 0.8386436572 +75 0.6961218859 +76 0.1995308419 +77 0.0552442152 +78 0.1937915065 +79 0.1239592493 +80 0.0782601391 +81 0.0138965117 +82 0.0231978646 +83 0.0150709773 +84 0.4084290821 +85 0.0792668417 +86 1.0630476211 +87 0.2524739666 +88 0.0229636507 +89 0.1153934877 +90 0.2693801005 +91 0.0071337145 +92 1.0279231796 +93 0.0574241281 +94 0.103312087 +95 0.2100864561 +96 0.0252070712 +97 0.6067864142 +98 0.0607860625 +99 0.5416948523 +100 0.7090251541 +101 2.0470096713 +102 0.0368697578 +103 0.1221648319 +104 0.0484836208 +105 0.7188621431 +106 0.2405585888 +107 0.1071170724 +108 0.6859305671 +109 0.0997679124 +110 0.0342400356 +111 0.0201635 +112 0.4527960874 +113 0.7018417748 +114 0.2561295384 +115 0.2788440973 +116 0.2437240042 +117 0.0984135237 +118 0.1146045041 +119 0.2116296362 +120 0.0360702095 +121 0.2006613525 +122 0.0635994434 +123 0.8384420629 +124 0.3546527057 +125 0.014380068 +126 0.0041004554 +127 0.2404132813 +128 0.0016204246 +129 0.016365643 +130 0.0025333389 +131 0.0207130798 +132 0.2199275512 +133 0.2973627433 +134 1.7680018464 +135 0.3120917444 +136 0.854288287 +137 0.4309335923 +138 2.3003988746 +139 0.047166557 +140 0.7391255635 +141 0.1357653755 +142 0.4672659386 +143 0.3601080698 +144 0.9111911856 +145 0.7435427597 +146 0.3353115579 +147 1.0513358906 +148 0.1406855309 +149 0.3543459659 +150 0.0561408821 +151 0.563013834 +152 0.1549691284 +153 0.7460309808 +154 0.0486849156 +155 0.1080587915 +156 0.0699642772 +157 0.4423435657 +158 0.0171555252 +159 0.0064557797 +160 0.4739275466 +161 0.2617128164 +162 0.0879369647 +163 0.0062762841 +164 0.1060085461 +165 0.0971932081 +166 0.3139785044 +167 0.0771649003 +168 0.0753029618 +169 0.5676607679 +170 0.9836368904 +171 0.6193661835 +172 0.3890022353 +173 0.3304911731 +174 0.9354752573 +175 2.5683088408 +176 0.6777050636 +177 0.0195000778 +178 0.0532349161 +179 0.0993391181 +180 0.0667310411 +181 0.0123690861 +182 0.0165201319 +183 0.2056431695 +184 0.0114477122 +185 0.1684423923 +186 0.6236165725 +187 0.2533573459 +188 7.4644850979 +189 1.72206594665E-17 +190 0.0510513818 +191 0.071993023 +192 0.093087642 +193 0.026770297 +194 0.1003921418 +195 0.731799564 +196 0.3882654324 +>6S_2 +1 5.135077189 +2 0.0137794619 +3 0.0198585136 +4 0.0394762621 +5 0.1032256038 +6 0.0124879331 +7 0.050343991 +8 0.0266906427 +9 0.0867862234 +10 0.0250443701 +11 0.1241682715 +12 0.0888505404 +13 1.72206594665E-17 +14 0.0443782398 +15 0.0331749933 +16 1.190843321 +17 0.0083605324 +18 0.1025127456 +19 0.0318835351 +20 0.6764653014 +21 1.6659553696 +22 0.0532195755 +23 0.1306535914 +24 3.2368938797 +25 0.2999875752 +26 0.1771608894 +27 0.0735275063 +28 1.1463641343 +29 0.3436951718 +30 0.6339043401 +31 0.8229568123 +32 0.0567986298 +33 0.3413998482 +34 0.1291037675 +35 0.561127074 +36 0.0076983354 +37 0.147000237 +38 0.0214390185 +39 0.5304305785 +40 0.0785507542 +41 0.0483731004 +42 0.0976091996 +43 1.2125480978 +44 0.1865263845 +45 0.6312459899 +46 0.1817958047 +47 2.8617198725 +48 0.2055922577 +49 1.3068827801 +50 0.2629492567 +51 0.8571308379 +52 0.2726647331 +53 1.129084224 +54 0.275119436 +55 0.5874419445 +56 0.3657294569 +57 0.2500734975 +58 1.0443534711 +59 4.5331285532 +60 0.2551985691 +61 0.1800315837 +62 1.2079574507 +63 0.1377332438 +64 0.034281766 +65 0.0098202871 +66 0.9938878178 +67 0.0331980613 +68 0.2884058117 +69 0.1471099733 +70 0.0250835628 +71 0.0040433138 +72 2.1207460501 +73 0.7413016698 +74 0.2856087978 +75 0.1043896327 +76 2.5426831833 +77 0.024753755 +78 0.0197741979 +79 0.0256614712 +80 0.0931195919 +81 0.2341548619 +82 0.9442989 +83 0.6902004027 +84 0.2615426874 +85 0.1968596889 +86 0.1317761893 +87 0.3101105886 +88 0.3109082689 +89 0.6036478733 +90 0.1383132052 +91 1.72206594665E-17 +92 1.3701244222 +93 0.0259262955 +94 0.0427849321 +95 0.0059202715 +96 0.4620195968 +97 1.1627066739 +98 0.1193652803 +99 0.5039174355 +100 0.7685843498 +101 3.3504451177 +102 0.0156110762 +103 0.0405202895 +104 0.0448853051 +105 0.1130352336 +106 0.0128895533 +107 0.0140152443 +108 0.8487385272 +109 0.5411302314 +110 0.1921994675 +111 0.0804367301 +112 2.1393979849 +113 0.657192459 +114 0.9680746376 +115 0.0181673032 +116 0.1293355582 +117 0.0385348779 +118 0.0599847607 +119 0.0286153267 +120 0.0529816257 +121 0.0738905329 +122 1.9826160191 +123 0.6850277412 +124 0.0240149916 +125 0.1003714264 +126 0.0282377438 +127 0.016091267 +128 0.0654324545 +129 1.3672926211 +130 0.3123897874 +131 0.0125997931 +132 0.0326682275 +133 0.8141700098 +134 2.7208263459 +135 0.9376426669 +136 0.2104407859 +137 0.9213456642 +138 0.9496557623 +139 0.0158974709 +140 1.0394051723 +141 3.395502997 +142 0.2786545217 +143 0.0944673368 +144 0.1658691067 +145 1.5138095878 +146 0.2388473327 +147 0.0071582802 +148 0.0399196127 +149 0.0269685694 +150 0.0343298406 +151 0.0260244978 +152 0.1131275763 +153 0.0217325853 +154 0.1015784545 +155 0.0991349861 +156 1.4195713543 +157 0.5085589945 +158 0.1250938659 +159 0.788081555 +160 0.1135816768 +161 0.0633806979 +162 2.7826494 +163 1.8003487205 +164 0.7686439584 +165 0.0397996113 +166 0.8340757785 +167 0.0060961894 +168 0.0003936337 +169 0.0179660084 +170 0.033466093 +171 0.0469772809 +172 0.1070226766 +173 0.3447929483 +174 0.8559366126 +175 0.1279778477 +176 0.2188243998 +177 0.0449863446 +178 0.0382790499 +179 0.0022221768 +180 0.0311889472 +181 0.0257878168 +182 0.0172539125 +183 0.2710934097 +184 0.0914500662 +185 0.208503114 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3_result.txt Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,9 @@ +>SECIS_1 +AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU +.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97) +>6S_1 +GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU +(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38) +>6S_2 +UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC +.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_sequence_input.fasta Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,2 @@ +>test_seq +ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trajectory_result.tabular Wed Dec 20 07:18:05 2017 -0500 @@ -0,0 +1,10 @@ +..(((....))) -0.4 0.0550686 3.9 6.46108 12 +.((((....)))) -3 0.0600001 5.96046e-09 6.46108 13 +(((((....))))) -4.7 0.065 0 6.46108 14 +(((((....)))))..((((....)))) -5.3 0.135069 3.9 6.46108 28 +(((((....))))).(((((....))))) -5.8 0.14 1.90735e-07 6.46108 29 +(((((....))))).......(((....)))... -6.9 0.17246 6.7 7.46108 34 +(((((....)))))......((((....)))).. -7.8 0.17246 9.53674e-08 7.46108 34 +(((((....))))).....(((((....))))). -10.7 0.17246 1.90735e-07 7.46108 34 +(((((....)))))....((((((....)))))) -13.1 0.17246 -1.90735e-07 7.46108 34 +.(((((((((.......)))))))))........ -13.6 123.457 12.5 13 34
