Mercurial > repos > bgruening > viennarna_rnafold
changeset 0:14817dcab062 draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 78112b796295701aabd1ee2268983222f0d27374
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,26 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement version="2.2.10">viennarna</requirement> + </requirements> + </xml> + <token name="@VERSION@">2.2.10</token> + <xml name="version_command"> + <version_command>@EXECUTABLE@ --version</version_command> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + + <xml name="citations"> + <citations> + <citation type="doi">10.1186/1748-7188-6-26</citation> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnafold.xml Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,346 @@ +<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.0"> + <description>Calculate minimum free energy secondary structures and partition function of RNAs</description> + <macros> + <token name="@EXECUTABLE@">RNAfold</token> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <expand macro="version_command" /> + <command> + <![CDATA[ + #if str($input_source.select_fasta) == "false" + #if str($input_source.input_sequence).lstrip()[0] == ">" + echo "${input_source.input_sequence}" > "input.fasta" && + #else + echo ">Sequence" > "input.fasta" && + echo "${input_source.input_sequence}" >> "input.fasta" && + #end if + #end if + RNAfold + -T $temperature + --dangles=$dangling + #if $layout_type ==0 + --layout-type=$general_options.layout_type + #end if + #if $measelect.mea == "yes": + --MEA=$measelect.meavalue + #if $measelect.pfScale <> 1.07 + --pfScale=$measelect.pfScale + #end if + #else + $measelect.pf + #if $measelect.pfScale <> 1.07 + --pfScale=$measelect.pfScale + #end if + #end if + $advancedOptions.noconversion + $advancedOptions.gquad + $advancedOptions.nolp + $advancedOptions.nogu + $advancedOptions.noclosinggu + $advancedOptions.notetra + $advancedOptions.circular + #if $advancedOptions.bppmThreshold <> 1e-5 + --bppmThreshold=$advancedOptions.bppmThreshold + #end if + #if $advancedOptions.nsp + --nsp='$advancedOptions.nsp' + #end if + #if $advancedOptions.betaScale <> 1.0 + --betaScale=$advancedOptions.betaScale + #end if + #if $constraints.maxBPspan <> -1 + --maxBPspan=$constraints.maxBPspan + #end if + #if str($constraints.constraintLocation.constraintSelector) == "fromFile" + --constraint='$constraints.constraintLocation.constraintsFile' + $constraints.constraintLocation.batch + $constraints.constraintLocation.canonicalBPonly + $constraints.constraintLocation.enforceConstraint + #end if + #if str($constraints.shapeOption.shapeSelector) == "isUsed" + --shape='$constraints.shapeOption.shapeFile' + #if str($constraints.shapeOption.shapeMethod.methodSelector) == "W" + #set $s="W" + --shapeMethod=$s + #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "Z" + #set $s="Zb"+str($constraints.shapeOption.shapeMethod.b) + --shapeMethod=$s + #if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C" + #set $c="C"+str($constraints.shapeOption.shapeMethod.shapeConversion.c) + --shapeConversion=$c + #else if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "L" + #set $c="Ls"+str($constraints.shapeOption.shapeMethod.shapeConversion.s)+"i"+ str($constraints.shapeOption.shapeMethod.shapeConversion.i) + --shapeConversion=$c + #else if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "O" + #set $c="Os"+str($constraints.shapeOption.shapeMethod.shapeConversion.s)+"i"+ str($constraints.shapeOption.shapeMethod.shapeConversion.i) + --shapeConversion=$c + #else + #set $c=str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) + --shapeConversion=$c + #end if + #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "D" + #set $s="Dm"+str($constraints.shapeOption.shapeMethod.m)+"b"+str($constraints.shapeOption.shapeMethod.b) + --shapeMethod=$s + #end if + #end if + #if $constraints.motif + --motif='$constraints.motif' + #end if + < + #if str($input_source.select_fasta) == "false" + "input.fasta" + #else + "${input_source.fasta_input}" + #end if + > '$tabular_file' +]]> + </command> + + <inputs> + <conditional name="input_source"> + <param name="select_fasta" type="select" label="Input from FASTA file"> + <option value="true" selected="true">Use FASTA</option> + <option value="false">Provide sequence as text-field</option> + </param> + <when value="true"> + <param format="fasta" name="fasta_input" type="data" label="Sequence to fold (FASTA file)"/> + </when> + <when value="false"> + <param name="input_sequence" type="text" label="Input sequence"/> + </when> + </conditional> + <param name="temperature" type="float" value="37.0" label="Temperature [°C]" argument="-T"/> + <param name="dangling" type="select" label="How to treat dangling end energies" argument="-d"> + <option value="0">0: ignore dangling ends</option> + <option value="1">1: unpaired bases participate in one dangling end only</option> + <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option> + <option value="3">3: allow coaxial stacking</option> + </param> + <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" > + <option value="1" selected="true">Default: Naview layout</option> + <option value="0">Simple radial layout</option> + </param> + <conditional name="measelect"> + <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA"> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="yes"> + <param name="meavalue" type="float" value="1.0" label="Gamma Value"/> + <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> + </when> + <when value="no"> + <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/> + <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> + </when> + </conditional> + <section name="advancedOptions" title="Advanced options"> + <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> + <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> + <param name="noclosinggu" type="boolean" truevalue="" falsevalue="--noClosingGU" checked="true" label="Allow GU pairing at the ends" help="Allow pairing of G and U at the ends of helices. --noClosingGU"/> + <param name="notetra" type="boolean" truevalue="" falsevalue="--noTetra" checked="true" label="Allow stabilization for loops, hairpins etc." help=" Include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins. Mostly for testing. (--noTetra)"/> + <param name="noconversion" type="boolean" truevalue="" falsevalue="--noconv" checked="true" label="Convert Thymine to Uracil (T -> U)" help="Avoids confusion with DNA sequences (--noconv)"/> + <param name="gquad" + type="boolean" + truevalue="--gquad" + falsevalue="" + checked="false" + label="Take G Quadruplex formation into account" + argument="-g"/> + <param name="circular" + type="boolean" + truevalue="--circ" + falsevalue="" + checked="false" + label="Model as circular RNA structure" + argument="--circ"/> + <param name="bppmThreshold" + type="float" + value="1e-5" + label="Threshold for base pair probabilities" + help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." + argument="--bppmThreshold"/> + <param name="nsp" + type="text" + value="" + label="Allow other pairs in addition to the usual AU,GC,and GU pairs." + help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." + argument="--nsp"/> + <param name="betaScale" + type="float" + value="1.0" + label="Scaling of Boltzman factors" + help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." + argument="--betaScale"/> + </section> + <section name="constraints" title="Structure constraints"> + <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/> + <conditional name="constraintLocation"> + <param name="constraintSelector" type="select" label="Constraints"> + <!-- <option value="fromInput">The constraints are included in the input file</option> --> + <option value="fromFile">The constraints are in a seperate file</option> + <option value="none" selected="true">Don't use constraints</option> + </param> + <!-- <when value="fromInput"></when> --> + <when value="none"></when> + <when value="fromFile"> + <param name="constraintsFile" type="data" format="*" label="Constraints file" argument="--constraint"/> + <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" + label="Use constraints for all alignment records" + help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAalifold processes all sequence alignments in the input and applies the same provided constraints to each of them." + argument="--batch"/> + <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint" /> + <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" /> + </when> + </conditional> + <conditional name="shapeOption"> + <param name="shapeSelector" type="select" label="Shape reactivity data"> + <option value="isUsed">Use shape reactivity data</option> + <option value="notUsed" selected="true">Don't use shape reactivity data</option> + </param> + <when value ="isUsed"> + <param type="data" name="shapeFile" format="shape,*" label="Shape file" argument="--shape"/> + <conditional name="shapeMethod"> + <param name="methodSelector" type="select" label="Shape reactivity data" argument="--shapeMethod"> + <option value="D" selected="true">D: Convert by using a linear equation according to Deigan et al 2009</option> + <option value="Z">Z: Convert SHAPE reactivities to pseudo energies according to Zarringhalam et al 2012.</option> + <option value="W">W: Apply a given vector of perturbation energies to unpaired nucleotides according to Washietl et al 2012</option> + </param> + <when value="D"> + <param name="m" type="float" value="1.8" label="Slope m"/> + <param name="b" type="float" value="-0.6" label="Intercept"/> + </when> + <when value="Z"> + <param name="b" type="float" value="-0.6" label="Intercept"/> + <conditional name="shapeConversion"> + <param name="conversionSelector" type="select" label="shape reactivity data"> + <option value="M">M: Use linear mapping according to Zarringhalam et al</option> + <option value="C">C: Use a cutoff−approach to divide into paired and unpaired nucleotides</option> + <option value="S">S: Skip the normalizing step since the input data already represents probabilities for being unpaired rather than raw reactivity values</option> + <option value="L">L: Use a linear model to convert the reactivity into a probability for being unpaired</option> + <option value="O" selected="true">O: Use a linear model to convert the log of the reactivity into a probability for being unpaired</option> + </param> + <when value="M"> + </when> + <when value="C"> + <param name="c" type="float" value="0.25" label="Cutoff"/> + </when> + <when value="S"> + </when> + <when value="L"> + <param name="s" type="float" value="0.68" label="Slope"/> + <param name="i" type="float" value="0.2" label="Intercept"/> + </when> + <when value="O"> + <param name="s" type="float" value="1.6" label="Slope s"/> + <param name="i" type="float" value="-2.29" label="Intercept"/> + </when> + </conditional> + </when> + <when value="W"> + </when> + </conditional> + </when> + <when value="notUsed"> + </when> + </conditional> + <param argument="--motif" type="text" value="" label="Sequence structure energy" help="Specify stabilizing effect of ligand binding to a particular sequence/structure motif. Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free energy is known, the binding and therefore stabilizing effect of the ligand can be included in the folding recursions. Interior loop motifs are specified as concatenations of 5’ and 3’ motif, separated by an ’&’ character. Energy contributions must be specified in kcal/mol."/> + </section> + <section name="IDs" title="Naming Conventions"> + <param name="auto_id" + type="boolean" truevalue="--auto-id" falsevalue="" checked="false" + label="Automatically generate an ID for each alignment." + help="If this flag is active, RNAalifold ignores any IDs retrieved from the input and automatically generates an ID for each alignment." + argument="--auto-id"/> + <param name="id_prefix" + type="text" value="alignment" + label="Prefix for automatically generated IDs (as used in output file names)" + help="If this parameter is set, each alignment will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated alignment), etc. where xxxx is the alignment number beginning with the second alignment in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input alignment." + argument="--id-prefix"/> + <param name="id_digits" + type="integer" value="4" min="1" max="18" + label="The number of digits of the counter in automatically generated alignment IDs" + help="When alignments IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." + argument="--id-digits"/> + <param name="id_start" + type="integer" value="1" min="0" + label="First number in automatically generated alignment IDs" + help="When alignment IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous alignment IDs, i.e. it activates the −−continuous−ids flag.." + argument="--id-start"/> + </section> + </inputs> + <outputs> + <data format="dbn" name="tabular_file"/> + <collection name="sequence_outputs" type="list" label="rna_eps outputs"> + <discover_datasets pattern="(?P<designation>.+)_ss\.ps" ext="eps" /> + </collection> + <collection name="matrix_outputs" type="list" label="rna_eps outputs"> + <filter>measelect['pf'] is True</filter> + <discover_datasets pattern="(?P<designation>.+)_dp\.ps" ext="rna_eps" visible="true"/> + </collection> + </outputs> + <tests> + <test> + <param name="select_fasta" value="true" /> + <param name="fasta_input" value="rnafold_input1.fa"/> + <output name="out_file1" file="rnafold_result1.txt"/> + </test> + + <test> + <param name="select_fasta" value="true" /> + <param name="fasta_input" value="rnafold_input2.fa"/> + <param name="temperature" value="75"/> + <output name="out_file1" file="rnafold_result2.txt"/> + </test> + + <test> + <param name="select_fasta" value="false" /> + <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/> + <output name="out_file1" file="rnafold_result3.txt"/> + </test> + </tests> + <help> +<![CDATA[ +**RNAfold** + +The program reads RNA sequences, calculates their minimum free +energy (mfe) structure and the mfe structure in dot-bracket notation. + +If the -p option was given it also computes the +partition function (pf) and base pairing probability matrix. + +The dot plot of the base pairing probability matrix shows a matrix of squares with area proportional to the pairing +probability in the upper right half, and one square for each pair in the +minimum free energy structure in the lower left half. For each pair i-j with +probability p>10E-6 there is a line of the form + +i j sqrt(p) ubox + +in the PostScript file, so that the pair probabilities can be easily extracted. + +The sequences have to be provided in FASTA format. The first word (max. 42 char) of the FASTA header will be used for output file names. PostScript files "name_ss.ps" and "name_dp.ps" are produced for the structure and dot plot, respectively. +The program will read the whole FASTA input file and provide output for each found sequence. + + +----- + +**Input format** + +RNAfold requires one input file or a plain RNA sequence + +------ + +**Outputs** + +- Secondary structures in dot-bracket notation + +- several possible postscript images bundled together in a tar file + - secondary structure for each sequence in the input file + - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence + +]]> + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/kinfold_input.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,1 @@ +ACUGAUCGUAGUCAC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_input1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +.((((((..(((..........))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rna2dfold_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) <ref 1> +.((((((..(((..........))).(((((.......))))).....(((((.......))))))))))).. (-17.30) <ref 2> +k l en structure
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_input1.clustal Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaaliduplex_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,1 @@ +(((((((..(.......((((..(..((((((..((((((.......((((((..(..(((((..(((((((.&)))))))..).......))))..)..))))))..)))))).......))))))..)..)))))..))))))). 1,73 : 1,73 (-40.30)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_input1.clustal Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaalifold_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-26.45 = -26.20 + -0.25)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_input1.fas Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnacofold_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((((((((.(((((((((((..&.))))))..((((........)))).(((((.......))))).....))))))))))).))))))))))).. (-55.90)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_input1.dbn Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnadistance_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,1 @@ +f: 4
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaduplex_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_input1.dbn Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))..
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaeval_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_input2.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +>Anolis_carolinensis_chrUn_GL343207.trna3-A +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result2.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37) +>Anolis_carolinensis_chrUn_GL343207.trna3-A +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result3.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Sequence +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +> comment 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaheat_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,102 @@ +> comment 1 +0 0.0407267 +1 0.0435052 +2 0.0470227 +3 0.0505646 +4 0.0553391 +5 0.0603894 +6 0.0662047 +7 0.0718158 +8 0.0782007 +9 0.0863514 +10 0.0950516 +11 0.10505 +12 0.115613 +13 0.128245 +14 0.141712 +15 0.157281 +16 0.17497 +17 0.195056 +18 0.216799 +19 0.241743 +20 0.270432 +21 0.302132 +22 0.337644 +23 0.377263 +24 0.421546 +25 0.470799 +26 0.525589 +27 0.587016 +28 0.653829 +29 0.726606 +30 0.806458 +31 0.892656 +32 0.984857 +33 1.08272 +34 1.18601 +35 1.29332 +36 1.40305 +37 1.51467 +38 1.62618 +39 1.73524 +40 1.84032 +41 1.9407 +42 2.03385 +43 2.11859 +44 2.19443 +45 2.26182 +46 2.31999 +47 2.36969 +48 2.41182 +49 2.44826 +50 2.47967 +51 2.50769 +52 2.534 +53 2.55942 +54 2.5851 +55 2.61217 +56 2.64151 +57 2.67329 +58 2.70759 +59 2.74465 +60 2.78458 +61 2.8279 +62 2.8742 +63 2.92425 +64 2.97698 +65 3.03283 +66 3.09163 +67 3.15591 +68 3.23033 +69 3.3067 +70 3.38122 +71 3.45791 +72 3.54606 +73 3.63843 +74 3.73392 +75 3.83847 +76 3.94646 +77 4.05462 +78 4.16571 +79 4.28366 +80 4.39944 +81 4.50863 +82 4.61035 +83 4.70186 +84 4.78345 +85 4.85204 +86 4.90509 +87 4.9392 +88 4.95425 +89 4.95214 +90 4.93688 +91 4.91166 +92 4.87691 +93 4.8314 +94 4.78561 +95 4.75271 +96 4.71866 +97 4.66056 +98 4.57671 +99 4.48395 +100 4.39006
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnainverse_input1.clu Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). +gggccccnnaauunnnnnnnnaauunGGGGcnnnnnnnAAAAAnnnnnuuuuannnnnnnuaaaaggggcccn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_input1.clustal Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,7 @@ +CLUSTAL 2.1 multiple sequence alignment + + +Anolis_carolinensis_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +Anolis_carolinensis_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA + ************************************** ************** ******* ********* +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalalifold_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-19.05) 17 - 73 +((((........)))). ( -5.10) 10 - 26 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUCGAUGCCCACAUUCUCCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnalfold_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,28 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +.((((....)))). ( -0.10) 56 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -7.70) 48 +.((((..(((((.......)))))..)))). (-10.30) 42 +.(((((...(((((.......))))).))))). (-11.50) 40 +.((.(((((...(((((.......))))).))))))) (-12.10) 37 +.(((((.......))))). ( -5.80) 26 +.((.(((((.......)))))..)). ( -6.70) 23 +.((((....)))). ( -3.20) 21 +.((.((((....)))).)). ( -4.70) 18 +.((((........)))). ( -5.30) 9 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA + (-22.00) +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.(((..((((....)))).))). ( -3.40) 51 +.(((((.......))))). ( -9.20) 48 +.((((..(((((.......)))))..)))). (-11.80) 42 +.(((((...(((((.......))))).))))). (-13.30) 40 +.((.(((((...(((((.......))))).))))))) (-13.60) 37 +.(((((.......))))). ( -7.70) 26 +.((.(((((.......)))))..)). ( -8.60) 23 +.(((.(((((.(((((.......)))))..)).(((((.......)))))..)))))) (-20.00) 16 +.((((........)))). ( -5.30) 9 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) 1 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA + (-29.60)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_input1.fas Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,1 @@ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA&UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapaln_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,7 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +68.8844 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapdist_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +8.66253
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnapkplex_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90) +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplex_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +.((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result1.ps Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,242 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343590.trna2-A) show + +/sequence { (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1568 ubox +2 71 0.9619 ubox +3 69 0.1395 ubox +3 70 0.7414 ubox +3 72 0.8060 ubox +4 68 0.1157 ubox +4 69 0.6748 ubox +4 71 0.4682 ubox +5 67 0.1065 ubox +5 68 0.6724 ubox +5 70 0.3765 ubox +6 47 0.1250 ubox +6 67 0.6497 ubox +7 46 0.1273 ubox +7 66 0.6008 ubox +8 45 0.1294 ubox +8 48 0.2252 ubox +9 47 0.2335 ubox +10 25 0.7863 ubox +11 24 0.7884 ubox +11 43 0.5215 ubox +11 45 0.2330 ubox +12 23 0.7883 ubox +12 42 0.5493 ubox +12 44 0.2317 ubox +13 22 0.7882 ubox +13 41 0.5528 ubox +13 43 0.2306 ubox +14 40 0.5338 ubox +15 20 0.1027 ubox +16 38 0.5325 ubox +16 40 0.1646 ubox +17 37 0.5639 ubox +17 39 0.1633 ubox +18 36 0.5591 ubox +18 38 0.1125 ubox +19 36 0.2406 ubox +20 34 0.5341 ubox +20 35 0.2514 ubox +21 33 0.4064 ubox +22 32 0.2491 ubox +22 33 0.4413 ubox +23 32 0.5541 ubox +24 31 0.6100 ubox +25 30 0.6092 ubox +26 36 0.2144 ubox +27 35 0.2146 ubox +27 43 0.7269 ubox +28 34 0.2043 ubox +28 42 0.7445 ubox +29 41 0.7467 ubox +30 40 0.7468 ubox +31 39 0.7470 ubox +38 73 0.3242 ubox +39 72 0.3055 ubox +40 73 0.1211 ubox +41 71 0.2953 ubox +41 72 0.1146 ubox +42 70 0.2588 ubox +43 69 0.2613 ubox +43 71 0.2848 ubox +44 68 0.2587 ubox +44 70 0.3418 ubox +45 67 0.2339 ubox +45 68 0.1772 ubox +45 69 0.3617 ubox +45 70 0.1014 ubox +45 72 0.3111 ubox +46 67 0.2550 ubox +46 68 0.3039 ubox +46 69 0.1150 ubox +46 71 0.2540 ubox +47 66 0.2925 ubox +48 67 0.1378 ubox +49 65 0.9938 ubox +50 64 0.9971 ubox +51 63 0.9980 ubox +52 62 0.9980 ubox +53 61 0.9963 ubox +54 59 0.1628 ubox +55 60 0.1625 ubox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplfold_result2.ps Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,212 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Title: RNA Dot Plot +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Oct 4 14:45:55 2016 +%%BoundingBox: 66 530 520 650 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +%This file contains the square roots of the base pair probabilities in the form +% i j sqrt(p(i,j)) ubox + +%%BeginProlog +/DPdict 100 dict def +DPdict begin +/logscale false def +/lpmin 1e-05 log def + +/box { %size x y box - draws box centered on x,y + 2 index 0.5 mul sub % x -= 0.5 + exch 2 index 0.5 mul sub exch % y -= 0.5 + 3 -1 roll dup rectfill +} bind def + +/ubox { + logscale { + log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if + } if + 3 1 roll + exch len exch sub 1 add box +} bind def + +/lbox { + 3 1 roll + len exch sub 1 add box +} bind def + +/drawseq { +% print sequence along all 4 sides +[ [0.7 -0.3 0 ] + [0.7 0.7 len add 0] + [-0.3 len sub -0.4 -90] + [-0.3 len sub 0.7 len add -90] +] { + gsave + aload pop rotate translate + 0 1 len 1 sub { + dup 0 moveto + sequence exch 1 getinterval + show + } for + grestore + } forall +} bind def + +/drawgrid{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { + dup dup + 0 moveto + len lineto + dup + len exch sub 0 exch moveto + len exch len exch sub lineto + stroke + } for + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +end +%%EndProlog +DPdict begin +%delete next line to get rid of title +270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show + +/sequence { (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) } def +/winSize 70 def +/len { sequence length } bind def + +292 416 translate +72 6 mul len 1 add winSize add 2 sqrt mul div dup scale +/Helvetica findfont 0.95 scalefont setfont + +/drawseq_turn {% print sequence at bottom + gsave + len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate + 0 1 len 1 sub { + dup dup 2 sqrt mul 0 moveto + sequence exch 1 getinterval + show + } for + grestore +} bind def +/drawgrid_turn{ + 0.01 setlinewidth + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + dup winSize gt + {dup dup len exch sub winSize add lineto} + {dup len lineto}ifelse + dup len exch sub moveto %moveto diagonal? + dup len winSize sub le + {dup dup len exch sub dup winSize exch sub len add exch lineto} + {dup dup len exch sub len exch lineto}ifelse stroke pop pop + } for + len log 0.9 sub cvi 10 exch exp % grid spacing + dup 1 gt { + dup dup 20 div dup 2 array astore exch 40 div setdash + } { [0.3 0.7] 0.1 setdash } ifelse + 0 exch len { %for (0, gridspacing, len) + dup dup %duplicate what - gridspacing?? + dup len exch sub moveto %moveto diagonal? + len exch sub 0.7 sub exch 0.7 sub exch lineto + stroke + }for + winSize len moveto len winSize lineto stroke + [] 0 setdash + 0.04 setlinewidth + currentdict /cutpoint known { + cutpoint 1 sub + dup dup -1 moveto len 1 add lineto + len exch sub dup + -1 exch moveto len 1 add exch lineto + stroke + } if + 0.5 neg dup translate +} bind def + +0.5 dup translate +drawseq_turn +45 rotate + + +%draw the grid +drawgrid_turn + +%start of base pair probability data +2 70 0.1914 ubox +2 71 0.9787 ubox +3 69 0.1660 ubox +3 70 0.7676 ubox +3 72 0.8449 ubox +4 68 0.1377 ubox +4 69 0.7113 ubox +4 71 0.4928 ubox +5 67 0.1266 ubox +5 68 0.7090 ubox +5 70 0.3955 ubox +6 67 0.6860 ubox +7 66 0.6345 ubox +10 25 0.9888 ubox +11 24 0.9915 ubox +12 23 0.9914 ubox +13 22 0.9913 ubox +15 20 0.1291 ubox +17 73 0.1217 ubox +18 72 0.1091 ubox +27 43 0.9522 ubox +28 42 0.9836 ubox +29 41 0.9874 ubox +30 40 0.9886 ubox +31 39 0.9883 ubox +33 37 0.1014 ubox +38 73 0.1170 ubox +39 72 0.1080 ubox +41 71 0.1523 ubox +42 70 0.1341 ubox +43 69 0.1387 ubox +43 71 0.2800 ubox +44 68 0.1392 ubox +44 70 0.3364 ubox +45 67 0.1266 ubox +45 68 0.1838 ubox +45 69 0.3586 ubox +45 72 0.3252 ubox +46 67 0.2524 ubox +46 68 0.3007 ubox +46 69 0.1142 ubox +46 71 0.2655 ubox +47 66 0.2807 ubox +48 67 0.1394 ubox +49 65 0.9981 ubox +50 64 0.9997 ubox +51 63 0.9997 ubox +52 62 0.9997 ubox +53 61 0.9981 ubox +54 59 0.1565 ubox +55 60 0.3242 ubox +showpage +end +%%EOF
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.dbn Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,3 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-21.90)
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaplot_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1a.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +>homo +CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAAAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAACAGGGAAGAGCCCAGCGCCGAAUCCCCGCCCCGCGGGGCGCGGGACAUGUGGCGUACGGAAGACCCGCUCCCCGGCGCCGCUCGUGGGGGGCCCAAGUCCUUCUGAUCGAGGCCCAGCCCGUGGACGGUGUGAGGCCGGUAGCGGCCGGCGCGCGCCCGGGUCUUCCCGGAGUCGGGUUGCUUGGGAAUGCAGCCCAAAGCGGGUGGUAAACUCCAUCUAAGGCUAAAUACCGGCACGAGACCGAUAGUCAACAAGUACCGUAAGGGAAAGUUGAAAAGAACUUUGAAGAGAGAGUUCAAGAGGGCGUGAAACCGUUAAGAGGUAAACGGGUGGGGUCCGCGCAGUCCGCCCGGAGGAUUCAACCCGGCGGCGGGUCCGGCCGUGUCGGCGGCCCGGCGGAUCUUUCCCGCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAGGGGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCGGCGGGGGACCGUCCCCCGACCGGCGACCGGCCGCCGCCGGGCGCAUUUCCACCGCGGCGGUGCGCCGCGACCGGCUCCGGGACGGCUGGGAAGGCCCGGCGGGGAAGGUGGCUCGGGGGGCCCCGUCCGUCCGUCCGUCCUCCUCCUCCCCCGUCUCCGCCCCCCGGCCCCGCGUCCUCCCUCGGGAGGGCGCGCGGGUCGGGGCGGCGGCGGCGGCGGCGGUGGCGGCGGCGGCGGGGGCGGCGGGACCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCGAAUCCCGGGGCCGAGGGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGCCCACCCCCGCGGGGAAUCCCCCGCGAGGGGGGUCUCCCCCGCGGGGGCGCGCCGGCGUCUCCUCGUGGGGGGGCCGGGCCACCCCUCCCACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGCGGGUCGCGCCGUCGGGCCCGGGGGAGGUUCUCUCGGGGCCACGCGCGCGUCCCCCGAAGAGGGGGACGGCGGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCCGUCUUGAAACACGGACCAAGGAGUCUAACACGUGCGCGAGUCGGGGGCUCGCACGAAAGCCGCCGUGGCGCAAUGAAGGUGAAGGCCGGCGCGCUCGCCGGCCGAGGUGGGAUCCCGAGGCCUCUCCAGUCCGCCGAGGGCGCACCACCGGCCCGUCUCGCCCGCCGCGCCGGGGAGGUGGAGCACGAGCGCACGUGUUAGGACCCGAAAGAUGGUGAACUAUGCCUGGGCAGGGCGAAGCCAGAGGAAACUCUGGUGGAGGUCCGUAGCGGUCCUGACGUGCAAAUCGGUCGUCCGACCUGGGUAUAGGGGCGAAAGACUAAUCGAACCAUCUAGUAGCUGGUUCCCUCCGAAGUUUCCCUCAGGAUAGCUGGCGCUCUCGCAGACCCGACGCACCCCCGCCACGCAGUUUUAUCCGGUAAAGCGAAUGAUUAGAGGUCUUGGGGCCGAAACGAUCUCAACCUAUUCUCAAACUUUAAAUGGGUAAGAAGCCCGGCUCGCUGGCGUGGAGCCGGGCGUGGAAUGCGAGUGCCUAGUGGGCCACUUUUGGUAAGCAGAACUGGCGCUGCGGGAUGAACCGAACGCCGGGUUAAGGCGCCCGAUGCCGACGCUCAUCAGACCCCAGAAAAGGUGUUGGUUGAUAUAGACAGCAGGACGGUGGCCAUGGAAGUCGGAAUCCGCUAAGGAGUGUGUAACAACUCACCUGCCGAAUCAACUAGCCCUGAAAAUGGAUGGCGCUGGAGCGUCGGGCCCAUACCCGGCCGUCGCCGGCAGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGCGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCGGCGGCGGCGGGGGUGUGGGGUCCUUCCCCCGCCCCCCCCCCCACGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGACGCUACGCCGCGACGAGUAGGAGGGCCGCUGCGGUGAGCCUUGAAGCCUAGGGCGCGGGCCCGGGUGGAGCCGCCGCAGGUGCAGAUCUUGGUGGUAGUAGCAAAUAUUCAAACGAGAACUUUGAAGGCCGAAGUGGAGAAGGGUUCCAUGUGAACAGCAGUUGAACAUGGGUCAGUCGGUCCUGAGAGAUGGGCGAGCGCCGUUCCGAAGGGACGGGCGAUGGCCUCCGUUGCCCUCGGCCGAUCGAAAGGGAGUCGGGUUCAGAUCCCCGAAUCCGGAGUGGCGGAGAUGGGCGCCGCGAGGCGUCCAGUGCGGUAACGCGACCGAUCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGUUCUCUUUUCUUUGUGAAGGGCAGGGCGCCCUGGAAUGGGUUCGCCCCGAGAGAGGGGCCCGUGCCUUGGAAAGCGUCGCGGUUCCGGCGGCGUCCGGUGAGCUCUCGCUGGCCCUUGAAAAUCCGGGGGAGAGGGUGUAAAUCUCGCGCCGGGCCGUACCCAUAUCCGCAGCAGGUCUCCAAGGUGAACAGCCUCUGGCAUGUUGGAACAAUGUAGGUAAGGGAAGUCGGCAAGCCGGAUCCGUAACUUCGGGAUAAGGAUUGGCUCUAAGGGCUGGGUCGGUCGGGCUGGGGCGCGAAGCGGGGCUGGGCGCGCGCCGCGGCUGGACGAGGCGCGCGCCCCCCCCACGCCCGGGGCACCCCCCUCGCGGCCCUCCCCCGCCCCACCCGCGCGCGCCGCUCGCUCCCUCCCCACCCCGCGCCCUCUCUCUCUCUCUCUCCCCCGCUCCCCGUCCUCCCCCCUCCCCGGGGGAGCGCCGCGUGGGGGCGCGGCGGGGGGAGAAGGGUCGGGGCGGCAGGGGCCGCGCGGCGGCCGCCGGGGCGGCCGGCGGGGGCAGGUCCCCGCGAGGGGGGCCCCGGGGACCCGGGGGGCCGGCGGCGGCGCGGACUCUGGACGCGAGCCGGGCCCUUCCCGUGGAUCGCCCCAGCUGCGGCGGGCGUCGCGGCCGCCCCCGGGGAGCCCGGCGGCGGCGCGGCGCGCCCCCCACCCCCACCCCACGUCUCGGUCGCGCGCGCGUCCGCUGGGGGCGGGAGCGGUCGGGCGGCGGCGGUCGGCGGGCGGCGGGGCGGGGCGGUUCGUCCCCCCGCCCUACCCCCCCGGCCCCGUCCGCCCCCCGUUCCCCCCUCCUCCUCGGCGCGCGGCGGCGGCGGCGGCAGGCGGCGGAGGGGCCGCGGGCCGGUCCCCCCCGCCGGGUCCGCCCCCGGGGCCGCGGUUCCGCGCGCGCCUCGCCUCGGCCGGCGCCUAGCAGCCGACUUAGAACUGGUGCGGACCAGGGGAAUCCGACUGUUUAAUUAAAACAAAGCAUCGCGAAGGCCCGCGGCGGGUGUUGACGCGAUGUGAUUUCUGCCCAGUGCUCUGAAUGUCAAAGUGAAGAAAUUCAAUGAAGCGCGGGUAAACGGCGGGAGUAACUAUGACUCUCUUAAGGUAGCCAAAUGCCUCGUCAUCUAAUUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCACUGUCCCUACCUACUAUCCAGCGAAACCACAGCCAAGGGAACGGGCUUGGCGGAAUCAGCGGGGAAAGAAGACCCUGUUGAGCUUGACUCUAGUCUGGCACGGUGAAGAGACAUGAGAGGUGUAGAAUAAGUGGGAGGCCCCCGGCGCCCCCCCGGUGUCCCCGCGAGGGGCCCGGGGCGGGGUCCGCGGCCCUGCGGGCCGCCGGUGAAAUACCACUACUCUGAUCGUUUUUUCACUGACCCGGUGAGGCGGGGGGGCGAGCCCGAGGGGCUCUCGCUUCUGGCGCCAAGCGCCCGCCCGGCCGGGCGCGACCCGCUCCGGGGACAGUGCCAGGUGGGGAGUUUGACUGGGGCGGUACACCUGUCAAACGGUAACGCAGGUGUCCUAAGGCGAGCUCAGGGAGGACAGAAACCUCCCGUGGAGCAGAAGGGCAAAAGCUCGCUUGAUCUUGAUUUUCAGUACGAAUACAGACCGUGAAAGCGGGGCCUCACGAUCCUUCUGACCUUUUGGGUUUUAAGCAGGAGGUGUCAGAAAAGUUACCACAGGGAUAACUGGCUUGUGGCGGCCAAGCGUUCAUAGCGACGUCGCUUUUUGAUCCUUCGAUGUCGGCUCUUCCUAUCAUUGUGAAGCAGAAUUCGCCAAGCGUUGGAUUGUUCACCCACUAAUAGGGAACGUGAGCUGGGUUUAGACCGUCGUGAGACAGGUUAGUUUUACCCUACUGAUGAUGUGUUGUUGCCAUGGUAAUCCUGCUCAGUACGAGAGGAACCGCAGGUUCAGACAUUUGGUGUAUGUGCUUGGCUGAGGAGCCAAUGGGGCGAAGCUACCAUCUGUGGGAUUAUGACUGAACGCCUCUAAGUCAGAAUCCCGCCCAGGCGAACGAUACGGCAGCGCCGCGGAGCCUCGGUUGGCCUCGGAUAGCCGGUCCCCCGCCUGUCCCCGCCGGCGGGCCGCCCCCCCCUCCACGCGCCCCGCCGCGGGAGGGCGCGUGCCCCGCCGCGCGCCGGGACCGGGGUCCGGUGCGGAGUGCCCUUCGUCCUGGGAAACGGGGCGCGGCCGGAAAGGCGGCCGCCCCCUCGCCCGUCACGCACCGCACGUUCGUGGGGAACCUGGCGCUAAACCAUUCGUAGACGACCUGCUUCUGGGUCGGGGUUUCGUACGUAGCAGAGCAGCUCCCUCGCUGCGAUCUAUUGAAAGUCAGCCCUCGACACAAGGGUUUGUC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_input1b.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,2 @@ +>ACA51 +AACCTACCCCATATACACCTCAGCTCAGGCCCTGTGCCTGGTCTGTATTGTGAATGGGGGAACATAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasnoop_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>ACA51 +>homo +<<<<<.<<<<.|.<<.<<<&...(((>>>.>>.((((...............................))))..>>>>.>>>>>))) 4468,4486;4479 : 8,65 (-35.60 = -16.10 + -7.60 + -12.40 + -3.60 + 4.1 ) (-23.60) +UGUUCACCCACUAAUAGGG&AACCUACCCCAUAUACACCUCAGCUCAGGCCCUGUGCCUGGUCUGUAUUGUGAAUGGGGGAACAUAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnasubopt_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,7 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-A [0] +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00 +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00 +>Anolis_carolinensis_chrUn_GL343207.trna3-A [0] +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00 +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_input1.fa Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,4 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnaup_result1.txt Wed Oct 05 11:50:25 2016 -0400 @@ -0,0 +1,6 @@ +>Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC + 55, 58 (0.019) for u= 4 +RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out +>Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC + 16, 19 (0.004) for u= 4 +RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out
