Mercurial > repos > bgruening > deeptools_compute_matrix
changeset 0:f1db8b6a8743 draft
planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit e1fd513c18e0d5b53071d99f539ac3509ced01aa-dirty
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/computeMatrix.xml Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,277 @@ +<tool id="deeptools_compute_matrix" name="computeMatrix" version="@WRAPPER_VERSION@.0"> + <description>preparation step to plot a heatmap or a profile</description> + <macros> + <token name="@BINARY@">computeMatrix</token> + <import>deepTools_macros.xml</import> + </macros> + <expand macro="requirements" /> + <command> +<![CDATA[ + #import tempfile + + #for $rf in $regionsFiles: + cat "$rf.regionsFile" >> ./temp_input_path; + #if str($rf.label.value).strip(): + echo "\#$rf.label.value" >> ./temp_input_path; + #else: + echo "\#$rf.regionsFile.name" >> ./temp_input_path; + #end if + #end for + + @BINARY@ + + $mode.mode_select + --regionsFileName ./temp_input_path + --scoreFileName '$scoreFile' + --outFileName '$outFileName' + + @THREADS@ + + #if $output.showOutputSettings == "yes" + #if $output.saveData: + --outFileNameData '$outFileNameData' + #end if + #if $output.saveMatrix: + --outFileNameMatrix '$outFileNameMatrix' + #end if + + #if $output.saveSortedRegions: + --outFileSortedRegions '$outFileSortedRegions' + #end if + #end if + + #if $mode.mode_select == "reference-point": + --referencePoint $mode.referencePoint + $mode.nanAfterEnd + --beforeRegionStartLength $mode.beforeRegionStartLength + --afterRegionStartLength $mode.afterRegionStartLength + #else + --regionBodyLength $mode.regionBodyLength + --startLabel "$mode.startLabel" + --endLabel "$mode.endLabel" + #if $mode.regionStartLength.regionStartLength_select == "yes": + --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength + --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength + #end if + #end if + + #if $advancedOpt.showAdvancedOpt == "yes": + --sortRegions '$advancedOpt.sortRegions' + --sortUsing '$advancedOpt.sortUsing' + --averageTypeBins '$advancedOpt.averageTypeBins' + $advancedOpt.keepNAs + $advancedOpt.skipZeros + --binSize $advancedOpt.binSize + + #if $advancedOpt.minThreshold is not None and str($advancedOpt.minThreshold) != '': + --minThreshold $advancedOpt.minThreshold + #end if + #if $advancedOpt.maxThreshold is not None and str($advancedOpt.maxThreshold) != '': + --maxThreshold $advancedOpt.maxThreshold + #end if + #if $advancedOpt.scale is not None and str($advancedOpt.scale) != '': + --scale $advancedOpt.scale + #end if + + #end if +]]> + </command> + <inputs> + + <repeat name="regionsFiles" title="regions to plot" min="1"> + <param name="regionsFile" format="bed" type="data" label="Regions to plot" + help="File, in BED format, containing the regions to plot."/> + <param name="label" type="text" size="30" optional="true" value="" label="Label" + help="Label to use in the output."/> + </repeat> + + <param name="scoreFile" format="bigwig" type="data" + label="Score file" + help="Should be a bigWig file (containing a score, usually covering + the whole genome). You can generate a bigWig file either from a + bedGraph or WIG file using UCSC tools or from a BAM file using the + deepTool bamCoverage. (-scoreFile)"/> + + <conditional name="mode" > + <param name="mode_select" type="select" + label="computeMatrix has two main output options" + help="In the scale-regions mode, all regions in the BED file are + stretched or shrunk to the same length (bp) that is indicated + by the user. Reference-point refers to a position within the BED + regions (e.g start of region). In the reference-point mode only + those genomic positions before (downstream) and/or after (upstream) + the reference point will be plotted."> + <option value="scale-regions" selected="true">scale-regions</option> + <option value="reference-point">reference-point</option> + </param> + + <when value="scale-regions" > + <param argument="--regionBodyLength" type="integer" value="500" + label="Distance in bp to which all regions are going to be fitted" help=""/> + <param argument="--startLabel" type="text" value="TSS" size="10" + label="Label for the region start" + help ="Label shown in the plot for the start of the region. + Default is TSS (transcription start site), but could be changed to anything, + e.g. "peak start"." /> + <param argument="--endLabel" type="text" value="TES" size="10" + label="Label for the region end" + help="Label shown in the plot for the region end. Default is TES (transcription end site)."/> + <conditional name="regionStartLength"> + <param name="regionStartLength_select" type="select" label="Set distance up- and downstream of the given regions"> + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <param argument="--beforeRegionStartLength" type="integer" value="1000" min="1" + label="Distance upstream of the start site of the regions defined in the region file" + help="If the regions are genes, this would be the + distance upstream of the transcription start site."/> + <param argument="--afterRegionStartLength" type="integer" value="1000" min="1" + label="Distance downstream of the end site of the given regions" + help="If the regions are genes, this would be the + distance downstream of the transcription end site."/> + </when> + </conditional> + </when> + <when value="reference-point"> + <param name="referencePoint" type="select" label="The reference point for the plotting"> + <option value="TSS" selected="true">beginning of region (e.g. TSS)</option> + <option value="TES">end of region (e.g. TES)</option> + <option value="center">center of region</option> + </param> + <param name="nanAfterEnd" type="boolean" truevalue="--nanAfterEnd" falsevalue="" + label="Discard any values after the region end" + help="This is useful to visualize the region end when not using the + scale-regions mode and when the reference-point is set to the TSS. (--nanAfterEnd)"/> + <param name="beforeRegionStartLength" type="integer" value="1000" min="1" + label="Distance upstream of the start site of the regions defined in the region file" + help="If the regions are genes, this would be the distance upstream of the transcription start site. (--beforeRegionStartLength)"/> + <param name="afterRegionStartLength" type="integer" value="1000" min="1" + label="Distance downstream of the end site of the given regions" + help="If the regions are genes, this would be the distance downstream of the transcription end site. (--afterRegionStartLength)"/> + </when> + </conditional> + + <expand macro="input_graphic_output_settings"> + <expand macro="input_save_matrix_values" /> + </expand> + + <conditional name="advancedOpt" > + <param name="showAdvancedOpt" type="select" label="Show advanced options" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <param name="binSize" type="integer" value="50" min="1" + label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length" + help="(--binSize)"/> + + <expand macro="sortRegions" /> + <expand macro="sortUsing" /> + + <param name="averageTypeBins" type="select" + label="Define the type of statistic that should be displayed." + help="The value is computed for each bin. (--averageTypeBins)"> + <option value="mean" selected="true">mean</option> + <option value="median">median</option> + <option value="min">min</option> + <option value="max">max</option> + <option value="sum">sum</option> + <option value="std">std</option> + </param> + + <expand macro="keepNAs" /> + <expand macro="skipZeros" /> + + <param name="minThreshold" type="float" optional="True" + label="Minimum threshold" + help="Any region containing a value that is equal or less than this numeric + value will be skipped. This is useful to skip, for example, genes where the + read count is zero for any of the bins. This could be the result of + unmappable areas and can bias the overall results. (--minThreshold)"/> + <param name="maxThreshold" type="float" optional="True" + label="Maximum threshold" + help="Any region containing a value that is equal or higher that this + numeric value will be skipped. The max threshold is useful to skip those + few regions with very high read counts (e.g. major satellites) that may + bias the average values. (--maxThreshold)"/> + <param name="scale" type="float" optional="True" label="Scaling factor" + help="If set, all values are multiplied by this number. (--scale)"/> + </when> + </conditional> + </inputs> + <outputs> + <data format="deeptools_compute_matrix_archive" name="outFileName" label="${tool.name} on ${on_string}: Matrix" /> + <expand macro="output_graphic_outputs" /> + <expand macro="output_save_matrix_values" /> + </outputs> + <!-- + computeMatrix -S test.bw -R test2.bed -a 100 -b 100 -bs 1 + --> + <tests> + <test> + <param name="regionsFile" value="computeMatrix1.bed" ftype="bed" /> + <param name="scoreFile" value="bamCoverage_result4.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="mode_select" value="reference-point" /> + <param name="binSize" value="10" /> + <param name="sortUsing" value="sum" /> + <param name="averageTypeBins" value="sum" /> + <param name="keepNAs" value="True" /> + <param name="beforeRegionStartLength" value="10" /> + <param name="afterRegionStartLength" value="10" /> + <output name="outFileName" file="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" /> + </test> + <test> + <param name="regionsFile" value="computeMatrix2.bed" ftype="bed" /> + <param name="scoreFile" value="computeMatrix2.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="mode_select" value="reference-point" /> + <param name="binSize" value="10" /> + <param name="beforeRegionStartLength" value="10" /> + <param name="afterRegionStartLength" value="10" /> + <output name="outFileName" file="computeMatrix_result2.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" /> + </test> + <test> + <param name="regionsFile" value="computeMatrix2.bed" ftype="bed" /> + <param name="scoreFile" value="computeMatrix2.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="mode_select" value="scale-regions" /> + <param name="endLabel" value="END" /> + <param name="regionStartLength" value="yes" /> + <output name="outFileName" file="computeMatrix_result3.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +This tool prepares an intermediary file (a gzipped table of values) +that contains scores associated with genomic regions that can be used +afterwards to plot a heatmap or a profile. + +Genomic regions can really be anything - genes, parts of genes, ChIP-seq +peaks, favorite genome regions... as long as you provide a proper file +in BED or INTERVAL format. If you would like to compare different groups of regions +(i.e. genes from chromosome 2 and 3), you can supply more than 1 BED file, one for each group. + +computeMatrix can also be used to filter and sort +regions according to their score by making use of its advanced output options. + + +.. image:: $PATH_TO_IMAGES/flowChart_computeMatrixetc.png + :alt: Relationship between computeMatrix, heatmapper and profiler + + +You can find more details on the computeMatrix wiki page: https://github.com/fidelram/deepTools/wiki/Visualizations#wiki-computeMatrix + + +----- + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/datatypes_conf.xml Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,7 @@ +<?xml version="1.0"?> +<datatypes> + <registration> + <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/> + <datatype extension="deeptools_coverage_matrix" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/> + </registration> +</datatypes>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/deepTools_macros.xml Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,644 @@ +<macros> + + <xml name="advancedOpt_scaffold"> + <conditional name="advancedOpt"> + <param name="showAdvancedOpt" type="select" label="Show advanced options" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <yield/> + </when> + </conditional> + </xml> + + <token name="@ADVANCED_OPTS_READ_PROCESSING@"> + --extendReads $advancedOpt.extendReads + $advancedOpt.ignoreDuplicates + $advancedOpt.centerReads + #if $advancedOpt.minMappingQuality: + --minMappingQuality '$advancedOpt.minMappingQuality' + #end if + #if $advancedOpt.samFlagInclude: + --samFlagInclude $advancedOpt.samFlagInclude + #end if + #if $advancedOpt.samFlagExclude: + --samFlagExclude $advancedOpt.samFlagExclude + #end if + </token> + + <xml name="heatmap_options"> + <expand macro="zMin_zMax" /> + <expand macro="colorMap" /> + <expand macro="plotTitle" /> + <expand macro="plotNumbers" /> + </xml> + + <token name="@HEATMAP_OPTIONS@"> + #if $zMin: + --zMin $zMin + #end if + #if $zMax: + --zMax $zMax + #end if + --colorMap '$colorMap' + $plotNumbers + </token> + + <expand macro="plotTitle" /> + <expand macro="plotNumbers" /> + <conditional name="output"> + <param name="showOutputSettings" type="select" label="Show advanced output settings" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <expand macro="input_image_file_format"/> + <param name="saveRawCounts" type="boolean" label="Save the bin counts"/> + <param name="saveCorMatrix" type="boolean" label="Save the correlation matrix"/> + </when> + </conditional> + +<!-- + $mode.advancedOpt.includeZeros + + + #if $plotTitle and str($plotTitle).strip() != "": + - -plotTitle '$plotTitle' + #end if + + +--> + + <xml name="bigwigCorrelate_mode_actions"> + <expand macro="region_limit_operation" /> + + <conditional name="advancedOpt"> + <param name="showAdvancedOpt" type="select" label="Show advanced options" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <expand macro="includeZeros" /> + <expand macro="zMin_zMax" /> + <expand macro="colorMap" /> + <expand macro="plotTitle" /> + <expand macro="plotNumbers" /> + </when> + </conditional> + </xml> + + <xml name="includeZeros"> + <param argument="--includeZeros" type="boolean" truevalue="--includeZeros" falsevalue="" + label="Include zeros" + help="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases." /> + </xml> + + <xml name="zMin_zMax"> + <param argument="--zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities" + help="If not specified the value is set automatically."/> + <param argument="--zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities" + help="If not specified the value is set automatically."/> + </xml> + + <xml name="region_limit_operation"> + <param argument="--region" type="text" value="" + label="Region of the genome to limit the operation to" + help="This is useful when testing parameters to reduce the computing time. The format is chr:start:end, for example "chr10" or "chr10:456700:891000"." /> + </xml> + + <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token> + <token name="@WRAPPER_VERSION@">1.5.11</token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="2.7.10">python</requirement> + <requirement type="binary">@BINARY@</requirement> + <requirement type="package" version="2.0">deepTools</requirement> + <yield /> + </requirements> + <expand macro="stdio" /> + <version_command>@BINARY@ --version</version_command> + </xml> + + <xml name="smoothLength"> + <param argument="--smoothLength" type="integer" value="" optional="True" min="1" + label="Smooth values using the following length (in bp)" + help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/> + </xml> + + + <xml name="kmeans_clustering"> + <conditional name="used_multiple_regions"> + <param name="used_multiple_regions_options" type="select" + label="Did you compute the matrix with more than one groups of regions?" + help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions."> + <option value="yes">Yes, I used multiple groups of regions</option> + <option value="no">No, I used only one group</option> + </param> + <when value="no"> + <conditional name="clustering"> + <param name="clustering_options" type="select" label="Clustering algorithm"> + <option value="none">No clustering</option> + <option value="kmeans">Kmeans clustering</option> + </param> + <when value="kmeans"> + <param name="k_kmeans" type="integer" value="0" label="Number of clusters to compute" + help="When this option is set, then the matrix is split into clusters using the kmeans algorithm. Only works for data that is not grouped, otherwise only the first group will be clustered. If more specific clustering methods are required it is advisable to save the underlying matrix and run the clustering using other software. The plotting of the clustering may fail (Error: Segmentation fault) if a cluster has very few members compared to the total number or regions. (default: None)."/> + </when> + <when value="none" /> + </conditional> + </when> + <when value="yes" /> + </conditional> + </xml> + + <token name="@KMEANS_CLUSTERING@"> + #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no': + #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans': + #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0: + --kmeans $advancedOpt.used_multiple_regions.clustering.k_kmeans + #end if + #end if + #end if + </token> + + <xml name="samFlags"> + <param argument="--samFlagInclude" type="integer" optional="True" value="" + label="Include reads based on the SAM flag" + help= "For example, to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage."/> + <param argument="--samFlagExclude" type="integer" optional="True" value="" + label="Exclude reads based on the SAM flag" + help= "For example, to get only reads that map to the forward strand, use --samFlagExclude 16, where 16 is the SAM flag for reads that map to the reverse strand."/> + </xml> + + <xml name="read_processing_options"> + <expand macro="extendReads" /> + <expand macro="ignoreDuplicates" /> + <expand macro="centerReads" /> + <expand macro="minMappingQuality" /> + <expand macro="samFlags" /> + </xml> + + <xml name="plotNumbers"> + <param argument="--plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue="" + label="Plot the correlation value" + help="If set, then the correlation number is plotted on top of the heatmap."/> + </xml> + + <xml name="extendReads"> + <param argument="--extendReads" type="integer" value="" optional="True" + label="Extend reads to the given average fragment size" + help="(1) Single-end reads and singletons are extended to match this length. (2) Paired-end reads are extended to match the fragment size, regardless of what is set here. + By default *each* read mate is extended. + This can be modified using the SAM flags (see --samFlagInclude and --samFlagExclude options) to keep only the first or the second mate. + Unmated reads, mate reads that map on different chromosomes or too far apart are extended to the given value. + Reads are only extended if --extendReads is set to a value greater than the read length. *NOTE*: For spliced-read data, this option is not + recommended as it will extend reads over skipped regions, e.g. introns in RNA-seq data."/> + </xml> + + <xml name="corMethod"> + <param argument="--corMethod" type="select" label="Correlation method"> + <option value="spearman" selected="True">Spearman</option> + <option value="pearson">Pearson</option> + </param> + </xml> + + <xml name="distanceBetweenBins"> + <param argument="--distanceBetweenBins" type="integer" value="0" min="0" + label="Distance between bins" + help="By default, bamCorrelate considers consecutive bins of + the specified 'Bin size'. However, to reduce the + computation time, a larger distance between bins can + by given. Larger distances result in less bins being + considered."/> + </xml> + + <xml name="centerReads"> + <param argument="--centerReads" type="boolean" truevalue="--centerReads" falsevalue="" + label="Center regions with respect to the fragment length" + help="For paired-end data, the read is centered at the fragment length defined by the two ends of the fragment. For single-end data, the given fragment length is used. This option is useful to get a sharper signal around enriched regions. "/> + </xml> + + <xml name="ignoreDuplicates"> + <param argument="--ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" + label="Ignore duplicates" + help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> + </xml> + + <xml name="sortUsing"> + <param argument="--sortUsing" type="select" label="Method used for sorting" + help="For each row the method is computed."> + <option value="mean" selected="true">mean</option> + <option value="median">median</option> + <option value="min">min</option> + <option value="max">max</option> + <option value="sum">sum</option> + <option value="region_length">region length</option> + </param> + </xml> + + <xml name="sortRegions"> + <param argument="--sortRegions" type="select" label="Sort regions" + help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region."> + <option value="no">no ordering</option> + <option value="descend" selected="true">descending order</option> + <option value="ascend">ascending order</option> + </param> + </xml> + + <xml name="minMappingQuality"> + <param argument="--minMappingQuality" type="integer" optional="true" value="1" min="1" + label="Minimum mapping quality" + help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/> + </xml> + + <xml name="skipZeros"> + <param argument="--skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" + label ="Skip zeros" + help ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined." /> + </xml> + + <xml name="fragmentLength"> + <param argument="--fragmentLength" type="integer" value="300" min="1" + label="Fragment length used for the sequencing" + help ="If paired-end reads are used, the fragment length is computed from the BAM file."/> + </xml> + + <xml name="scaleFactor"> + <param argument="--scaleFactor" type="float" value="1" label="Scaling factor" + help="When used in combination with --normalizeTo1x or + --normalizeUsingRPKM, the computed scaling factor will + be multiplied by the given scale factor." /> + </xml> + + <xml name="scaleFactors"> + <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/> + <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/> + </xml> + + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + <regex match="EXception:" /> + <regex match="Traceback" /> + </stdio> + </xml> + + <xml name="pseudocount"> + <param argument="--pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/> + </xml> + + <token name="@REFERENCES@"> + +.. class:: infomark + +For more information on the tools, please visit our `help site`_. + +If you would like to give us feedback or you run into any trouble, please send an email to deeptools@googlegroups.com + +This tool is developed by the `Bioinformatics and Deep-Sequencing Unit`_ at the `Max Planck Institute for Immunobiology and Epigenetics`_. + +.. _Bioinformatics and Deep-Sequencing Unit: http://www3.ie-freiburg.mpg.de/facilities/research-facilities/bioinformatics-and-deep-sequencing-unit/ +.. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de +.. _help site: https://github.com/fidelram/deepTools/wiki/ + + </token> + <xml name="citations"> + <citations> + <citation type="doi">10.1093/nar/gku365</citation> + <yield /> + </citations> + </xml> + + <xml name="multiple_input_bams"> + <param argument="--bamfiles" type="data" format="bam" + label="Bam file" multiple="true" + help="The BAM file must be sorted."/> + </xml> + + <xml name="multiple_input_bigwigs"> + <param argument="--bigwigfiles" type="data" format="bigwig" multiple="True" + label="Bigwig file" + help="The Bigwig file must be sorted."/> + </xml> + + <xml name="plotTitle"> + <param argument="--plotTitle" type="text" value="" size="30" optional="True" + label="Title of the plot" + help="Title of the plot, to be printed on top of the generated image." /> + </xml> + + <token name="@multiple_input_bams@"> +<![CDATA[ + #set files=[] + #set labels=[] + #for $counter, $bamfile in enumerate($bamfiles): + ln -s "${bamfile}" "./${counter}.bam" && + ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" && + #silent $files.append('%s.bam' % $counter) + #silent $labels.append('%s' % ($bamfile.display_name)) + #end for +]]> + </token> + + <token name="@multiple_input_bigwigs@"> +<![CDATA[ + #set files=[] + #set labels=[] + #for $counter, $bigwig in enumerate($bigwigfiles): + ln -s "${bigwig}" "${counter}.bw" && + #silent $files.append('%s.bw' % $counter) + #silent $labels.append('%s' % ($bigwig.display_name)) + #end for +]]> + </token> + + <xml name="reference_genome_source"> + <conditional name="source"> + <param name="ref_source" type="select" label="Reference genome"> + <option value="cached">locally cached</option> + <option value="history">in your history</option> + </param> + <when value="cached"> + <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> + <options from_data_table="lastz_seqs"> + <filter type="sort_by" column="1" /> + <validator type="no_options" message="No indexes are available." /> + </options> + </param> + </when> + <when value="history"> + <param name="input1" type="data" format="twobit" label="Select a reference dataset in 2bit format" /> + </when> + </conditional> + </xml> + + <token name="@reference_genome_source@"> + #if $source.ref_source=="history": + --genome $source.input1 + #else: + --genome "${source.input1_2bit.fields.path}" + #end if + </token> + + <xml name="effectiveGenomeSize"> + <conditional name="effectiveGenomeSize"> + <param name="effectiveGenomeSize_opt" type="select" label="Effective genome size" + help="The effective genome size is the portion of the genome that is mappable. Large fractions of the genome are stretches of NNNN that should be discarded. + Also, if repetitive regions were not included in the mapping of reads, the effective genome size needs to be adjusted accordingly. + See Table 2 of http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0030377 or http://www.nature.com/nbt/journal/v27/n1/fig_tab/nbt.1518_T1.html for several effective genome sizes."> + <option value="93260000">ce10 (93260000)</option> + <option value="121400000">dm3 (121400000)</option> + <option value="2451960000" selected="true">hg19 (2451960000)</option> + <option value="2150570000">mm9 (2150570000)</option> + <option value="specific">user specified</option> + </param> + <when value="specific"> + <param argument="--effectiveGenomeSize" type="integer" value="" label="Effective genome size" help="e.g. ce10: 93260000, dm3: 121400000, hg19: 2451960000, mm9: 2150570000"/> + </when> + <when value="2150570000" /> + <when value="2451960000" /> + <when value="121400000" /> + <when value="93260000" /> + </conditional> + </xml> + + <xml name="image_file_format"> + <param argument="--outFileFormat" type="select" label="Image file format"> + <option value="png" selected="true">png</option> + <option value="pdf">pdf</option> + <option value="svg">svg</option> + <option value="eps">eps</option> + </param> + </xml> + + <xml name="keepNAs"> + <param argument="--keepNAs" type="boolean" truevalue="--keepNAs" falsevalue="" checked="False" + label="Treat missing data as zero" + help="If set, missing data (NAs) will be treated as zeros. + The default is to ignore missing data and not included + in the output file. Missing data is defined as those + bins for which no overlapping reads are found." /> + </xml> + + <xml name="input_save_matrix_values"> + <param argument="--saveMatrix" type="boolean" label="Save the matrix of values underlying the heatmap"/> + </xml> + + <xml name="input_graphic_output_settings"> + <conditional name="output" > + <param name="showOutputSettings" type="select" label="Show advanced output settings" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <yield /> + <param name="saveData" type="boolean" label="Save the data underlying the average profile"/> + <param name="saveSortedRegions" type="boolean" label="Save the regions after skipping zeros or min/max threshold values" help="The order of the regions in the file follows the sorting order selected. This is useful, for example, to generate other heatmaps keeping the sorting of the first heatmap."/> + </when> + </conditional> + </xml> + + <xml name="input_image_file_format"> + <param name="outFileFormat" type="select" label="Image file format"> + <option value="png" selected="true">png</option> + <option value="pdf">pdf</option> + <option value="svg">svg</option> + <option value="eps">eps</option> + <option value="emf">emf</option> + </param> + </xml> + + <xml name="output_image_file_format"> + <data format="png" name="outFileName" label="${tool.name} image"> + <change_format> + <when input="output.outFileFormat" value="pdf" format="pdf" /> + <when input="output.outFileFormat" value="svg" format="svg" /> + <when input="output.outFileFormat" value="eps" format="eps" /> + <when input="output.outFileFormat" value="emf" format="emf" /> + </change_format> + </data> + </xml> + + <xml name="output_save_matrix_values"> + <data format="tabular" name="outFileNameMatrix" label="${tool.name} on ${on_string}: Heatmap values"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveMatrix'] is True + )) + </filter> + </data> + </xml> + + <xml name="output_graphic_outputs"> + <data format="tabular" name="outFileNameData" label="${tool.name} on ${on_string}: averages per matrix column"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveData'] is True + )) + </filter> + </data> + <data format="bed" name="outFileSortedRegions" label="${tool.name} on ${on_string}: sorted/filtered regions"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveSortedRegions'] is True + )) + </filter> + </data> + </xml> + + <xml name="colorMap"> + <param name="colorMap" type="select" label="Color map to use for the heatmap" help=" Available color map names can be found here: http://www.astro.lsa.umich.edu/~msshin/science/code/matplotlib_cm/"> + <option value="RdYlBu" selected="true">RdYlBu</option> + <option value="Accent">Accent</option> + <option value="Spectral">Spectral</option> + <option value="Set1">Set1</option> + <option value="Set2">Set2</option> + <option value="Set3">Set3</option> + <option value="Dark2">Dark2</option> + <option value="Reds">Reds</option> + <option value="Oranges">Oranges</option> + <option value="Greens">Greens</option> + <option value="Blues">Blues</option> + <option value="Greys">Greys</option> + <option value="Purples">Purples</option> + <option value="Paired">Paired</option> + <option value="Pastel1">Pastel1</option> + <option value="Pastel2">Pastel2</option> + <option value="spring">spring</option> + <option value="summer">summer</option> + <option value="autumn">autumn</option> + <option value="winter">winter</option> + <option value="hot">hot</option> + <option value="coolwarm">coolwarm</option> + <option value="cool">cool</option> + <option value="seismic">seismic</option> + <option value="terrain">terrain</option> + <option value="ocean">ocean</option> + <option value="rainbow">rainbow</option> + <option value="bone">bone</option> + <option value="flag">flag</option> + <option value="prism">prism</option> + <option value="cubehelix">cubehelix</option> + <option value="binary">binary</option> + <option value="pink">pink</option> + <option value="gray">gray</option> + <option value="copper">copper</option> + <option value="BrBG">BrBG</option> + <option value="BuGn">BuGn</option> + <option value="BuPu">BuPu</option> + <option value="GnBu">GnBu</option> + <option value="OrRd">OrRd</option> + <option value="PiYG">PiYG</option> + <option value="PRGn">PRGn</option> + <option value="PuOr">PuOr</option> + <option value="PuRd">PuRd</option> + <option value="PuBu">PuBu</option> + <option value="RdBu">RdBu</option> + <option value="RdGy">RdGy</option> + <option value="RdPu">RdPu</option> + <option value="YlGn">YlGn</option> + <option value="PuBuGn">PuBuGn</option> + <option value="RdYlGn">RdYlGn</option> + <option value="YlGnBu">YlGnBu</option> + <option value="YlOrBr">YlOrBr</option> + <option value="YlOrRd">YlOrRd</option> + <option value="gist_gray">gist_gray</option> + <option value="gist_stern">gist_stern</option> + <option value="gist_earth">gist_earth</option> + <option value="gist_yarg">gist_yarg</option> + <option value="gist_ncar">gist_ncar</option> + <option value="gist_rainbow">gist_rainbow</option> + <option value="gist_heat">gist_heat</option> + <option value="gnuplot">gnuplot</option> + <option value="gnuplot2">gnuplot2</option> + <option value="CMRmap">CMRmap</option> + <option value="bwr">bwr</option> + <option value="hsv">hsv</option> + <option value="brg">brg</option> + <option value="jet">jet</option> + <option value="afmhot">afmhot</option> + <option value="Accent_r">Accent reversed</option> + <option value="Spectral_r">Spectral reversed</option> + <option value="Set1_r">Set1 reversed</option> + <option value="Set2_r">Set2 reversed</option> + <option value="Set3_r">Set3 reversed</option> + <option value="Dark2_r">Dark2 reversed</option> + <option value="Reds_r">Reds reversed</option> + <option value="Oranges_r">Oranges reversed</option> + <option value="Greens_r">Greens reversed</option> + <option value="Blues_r">Blues reversed</option> + <option value="Greys_r">Greys reversed</option> + <option value="Purples_r">Purples reversed</option> + <option value="Paired_r">Paired reversed</option> + <option value="Pastel1_r">Pastel1 reversed</option> + <option value="Pastel2_r">Pastel2 reversed</option> + <option value="spring_r">spring reversed</option> + <option value="summer_r">summer reversed</option> + <option value="autumn_r">autumn reversed</option> + <option value="winter_r">winter reversed</option> + <option value="hot_r">hot reversed</option> + <option value="coolwarm_r">coolwarm reversed</option> + <option value="cool_r">cool reversed</option> + <option value="seismic_r">seismic reversed</option> + <option value="terrain_r">terrain reversed</option> + <option value="ocean_r">ocean reversed</option> + <option value="rainbow_r">rainbow reversed</option> + <option value="bone_r">bone reversed</option> + <option value="flag_r">flag reversed</option> + <option value="prism_r">prism reversed</option> + <option value="cubehelix_r">cubehelix reversed</option> + <option value="binary_r">binary reversed</option> + <option value="pink_r">pink reversed</option> + <option value="gray_r">gray reversed</option> + <option value="copper_r">copper reversed</option> + <option value="BrBG_r">BrBG reversed</option> + <option value="BuGn_r">BuGn reversed</option> + <option value="BuPu_r">BuPu reversed</option> + <option value="GnBu_r">GnBu reversed</option> + <option value="OrRd_r">OrRd reversed</option> + <option value="PiYG_r">PiYG reversed</option> + <option value="PRGn_r">PRGn reversed</option> + <option value="PuOr_r">PuOr reversed</option> + <option value="PuRd_r">PuRd reversed</option> + <option value="PuBu_r">PuBu reversed</option> + <option value="RdBu_r">RdBu reversed</option> + <option value="RdGy_r">RdGy reversed</option> + <option value="RdPu_r">RdPu reversed</option> + <option value="YlGn_r">YlGn reversed</option> + <option value="PuBuGn_r">PuBuGn reversed</option> + <option value="RdYlBu_r">RdYlBu reversed</option> + <option value="RdYlGn_r">RdYlGn reversed</option> + <option value="YlGnBu_r">YlGnBu reversed</option> + <option value="YlOrBr_r">YlOrBr reversed</option> + <option value="YlOrRd_r">YlOrRd reversed</option> + <option value="gist_gray_r">gist_gray reversed</option> + <option value="gist_stern_r">gist_stern reversed</option> + <option value="gist_earth_r">gist_earth reversed</option> + <option value="gist_yarg_r">gist_yarg reversed</option> + <option value="gist_ncar_r">gist_ncar reversed</option> + <option value="gist_rainbow_r">gist_rainbow reversed</option> + <option value="gist_heat_r">gist_heat reversed</option> + <option value="gnuplot_r">gnuplot reversed</option> + <option value="gnuplot2_r">gnuplot2 reversed</option> + <option value="CMRmap_r">CMRmap reversed</option> + <option value="bwr_r">bwr reversed</option> + <option value="hsv_r">hsv reversed</option> + <option value="brg_r">brg reversed</option> + <option value="jet_r">jet reversed</option> + <option value="afmhot_r">afmhot reversed</option> + </param> + + </xml> + +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/readme.rst Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,74 @@ +======================== +Galaxy deeptools wrapper +======================== + +deepTools are user-friendly tools for the normalization and visualization of +deep-sequencing data. +They address the challenge of visualizing the large amounts of data that are now +routinely generated from sequencing centers in a meaningful way. +To do so, deepTools contain useful routines to process the mapped reads data +through removal of duplicates and different filtering options to create coverage +files in standard bedGraph and bigWig file formats. deepTools allow the creation +of normalized coverage files or the comparison between two files +(for example, treatment and control). Finally, using such normalized and +standardized files, multiple visualizations can be created to identify +enrichments with functional annotations of the genome. +For a gallery of images that can be produced and a description +of the tools see our poster_. + +.. _poster: http://f1000.com/posters/browse/summary/1094053 + +deeptools is developed under here: + + https://github.com/fidelram/deepTools + +For support, questions, or feature requests contact: deeptools@googlegroups.com + + +============ +Installation +============ + +Requirements: python-2.7 + +Galaxy should be able to automatically install all other dependencies, such as numpy or scipy. + +For the best performance we recommend to install blas/lapack/atlas in your environment before +installing deepTools from the Tool Shed. + + +======== +Citation +======== + +deeptools are currently under review. In the meantime please refere to https://github.com/fidelram/deepTools. + + +======= +History +======= + + * v1.0: Initial public release + * v1.5.8.2: Include new citation tag, update version to 1.5.8.2 and change wrapper version + + +Licence (MIT) +============= + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in +all copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN +THE SOFTWARE.
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repository_dependencies.xml Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,4 @@ +<?xml version="1.0"?> +<repositories> + <repository changeset_revision="26e3ae5f74ed" name="data_manager_twobit_builder" owner="devteam" toolshed="https://testtoolshed.g2.bx.psu.edu" /> +</repositories>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCompare_result1.bg Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,1 @@ +chrM 0 16569 1.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCorrelate_regions.bed Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,3 @@ +chrM 1 10 +chrM 5 15 +chrM 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCoverage_result3.bg Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,8 @@ +chrM 0 10 18498299.57 +chrM 10 200 9768764.94 +chrM 200 210 10184457.07 +chrM 210 220 9976611.00 +chrM 220 230 7690304.31 +chrM 230 240 6027535.81 +chrM 240 250 3325537.00 +chrM 250 16569 623538.2
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCoverage_result4.bg Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,472 @@ +phiX174 0 10 16038.46 +phiX174 10 20 48115.38 +phiX174 20 70 144346.15 +phiX174 70 80 192461.54 +phiX174 80 90 176423.08 +phiX174 90 100 160384.62 +phiX174 100 120 112269.23 +phiX174 120 140 144346.15 +phiX174 140 150 160384.62 +phiX174 150 160 128307.69 +phiX174 160 170 160384.62 +phiX174 170 180 176423.08 +phiX174 180 200 208500.00 +phiX174 200 210 192461.54 +phiX174 210 220 240576.92 +phiX174 220 230 272653.85 +phiX174 230 240 336807.69 +phiX174 240 250 320769.23 +phiX174 250 260 288692.31 +phiX174 260 270 336807.69 +phiX174 270 280 400961.54 +phiX174 280 300 417000.00 +phiX174 300 310 352846.15 +phiX174 310 320 320769.23 +phiX174 320 330 368884.62 +phiX174 330 340 352846.15 +phiX174 340 350 288692.31 +phiX174 350 360 256615.38 +phiX174 360 370 224538.46 +phiX174 370 380 240576.92 +phiX174 380 390 304730.77 +phiX174 390 400 256615.38 +phiX174 400 410 240576.92 +phiX174 410 420 224538.46 +phiX174 420 450 288692.31 +phiX174 450 460 304730.77 +phiX174 460 470 336807.69 +phiX174 470 490 417000.00 +phiX174 490 510 497192.31 +phiX174 510 520 465115.38 +phiX174 520 530 561346.15 +phiX174 530 540 497192.31 +phiX174 540 550 529269.23 +phiX174 550 560 545307.69 +phiX174 560 570 641538.46 +phiX174 570 580 625500.00 +phiX174 580 590 561346.15 +phiX174 590 600 609461.54 +phiX174 600 610 545307.69 +phiX174 610 630 625500.00 +phiX174 630 640 577384.62 +phiX174 640 650 513230.77 +phiX174 650 660 545307.69 +phiX174 660 670 561346.15 +phiX174 670 680 593423.08 +phiX174 680 690 657576.92 +phiX174 690 700 641538.46 +phiX174 700 710 561346.15 +phiX174 710 730 593423.08 +phiX174 730 740 513230.77 +phiX174 740 760 593423.08 +phiX174 760 770 497192.31 +phiX174 770 780 513230.77 +phiX174 780 790 529269.23 +phiX174 790 800 545307.69 +phiX174 800 810 449076.92 +phiX174 810 820 433038.46 +phiX174 820 830 368884.62 +phiX174 830 840 320769.23 +phiX174 840 850 352846.15 +phiX174 850 860 304730.77 +phiX174 860 870 336807.69 +phiX174 870 880 256615.38 +phiX174 880 890 352846.15 +phiX174 890 900 384923.08 +phiX174 900 910 465115.38 +phiX174 910 920 545307.69 +phiX174 920 930 561346.15 +phiX174 930 940 545307.69 +phiX174 940 950 577384.62 +phiX174 950 960 593423.08 +phiX174 960 970 513230.77 +phiX174 970 980 481153.85 +phiX174 980 990 433038.46 +phiX174 990 1000 417000.00 +phiX174 1000 1010 449076.92 +phiX174 1010 1030 577384.62 +phiX174 1030 1040 753807.69 +phiX174 1040 1050 785884.62 +phiX174 1050 1060 817961.54 +phiX174 1060 1070 866076.92 +phiX174 1070 1080 834000.00 +phiX174 1080 1090 866076.92 +phiX174 1090 1100 769846.15 +phiX174 1100 1110 737769.23 +phiX174 1110 1120 657576.92 +phiX174 1120 1130 641538.46 +phiX174 1130 1140 625500.00 +phiX174 1140 1150 673615.38 +phiX174 1150 1160 625500.00 +phiX174 1160 1170 593423.08 +phiX174 1170 1180 609461.54 +phiX174 1180 1190 577384.62 +phiX174 1190 1200 513230.77 +phiX174 1200 1210 481153.85 +phiX174 1210 1220 561346.15 +phiX174 1220 1230 481153.85 +phiX174 1230 1240 449076.92 +phiX174 1240 1250 352846.15 +phiX174 1250 1260 336807.69 +phiX174 1260 1270 400961.54 +phiX174 1270 1280 352846.15 +phiX174 1280 1290 368884.62 +phiX174 1290 1300 320769.23 +phiX174 1300 1310 384923.08 +phiX174 1310 1320 513230.77 +phiX174 1320 1330 497192.31 +phiX174 1330 1340 513230.77 +phiX174 1340 1350 481153.85 +phiX174 1350 1370 497192.31 +phiX174 1370 1390 465115.38 +phiX174 1390 1400 352846.15 +phiX174 1400 1410 449076.92 +phiX174 1410 1430 481153.85 +phiX174 1430 1450 545307.69 +phiX174 1450 1460 561346.15 +phiX174 1460 1470 577384.62 +phiX174 1470 1480 609461.54 +phiX174 1480 1490 593423.08 +phiX174 1490 1500 545307.69 +phiX174 1500 1510 657576.92 +phiX174 1510 1520 625500.00 +phiX174 1520 1540 785884.62 +phiX174 1540 1550 721730.77 +phiX174 1550 1570 753807.69 +phiX174 1570 1580 769846.15 +phiX174 1580 1590 673615.38 +phiX174 1590 1600 625500.00 +phiX174 1600 1610 561346.15 +phiX174 1610 1620 529269.23 +phiX174 1620 1630 497192.31 +phiX174 1630 1640 465115.38 +phiX174 1640 1650 481153.85 +phiX174 1650 1660 497192.31 +phiX174 1660 1670 529269.23 +phiX174 1670 1680 593423.08 +phiX174 1680 1690 513230.77 +phiX174 1690 1700 529269.23 +phiX174 1700 1710 593423.08 +phiX174 1710 1720 545307.69 +phiX174 1720 1730 529269.23 +phiX174 1730 1740 577384.62 +phiX174 1740 1750 529269.23 +phiX174 1750 1760 433038.46 +phiX174 1760 1770 417000.00 +phiX174 1770 1780 368884.62 +phiX174 1780 1790 352846.15 +phiX174 1790 1810 336807.69 +phiX174 1810 1820 320769.23 +phiX174 1820 1830 465115.38 +phiX174 1830 1860 705692.31 +phiX174 1860 1870 801923.08 +phiX174 1870 1880 737769.23 +phiX174 1880 1890 673615.38 +phiX174 1890 1900 705692.31 +phiX174 1900 1910 609461.54 +phiX174 1910 1920 400961.54 +phiX174 1920 1930 465115.38 +phiX174 1930 1940 545307.69 +phiX174 1940 1950 449076.92 +phiX174 1950 1960 481153.85 +phiX174 1960 1970 529269.23 +phiX174 1970 1980 673615.38 +phiX174 1980 1990 641538.46 +phiX174 1990 2000 657576.92 +phiX174 2000 2010 673615.38 +phiX174 2010 2020 641538.46 +phiX174 2020 2030 657576.92 +phiX174 2030 2050 673615.38 +phiX174 2050 2060 481153.85 +phiX174 2060 2070 513230.77 +phiX174 2070 2080 481153.85 +phiX174 2080 2100 513230.77 +phiX174 2100 2110 529269.23 +phiX174 2110 2120 513230.77 +phiX174 2120 2130 529269.23 +phiX174 2130 2140 545307.69 +phiX174 2140 2150 513230.77 +phiX174 2150 2160 545307.69 +phiX174 2160 2170 417000.00 +phiX174 2170 2180 352846.15 +phiX174 2180 2190 433038.46 +phiX174 2190 2200 449076.92 +phiX174 2200 2210 433038.46 +phiX174 2210 2220 481153.85 +phiX174 2220 2230 545307.69 +phiX174 2230 2240 593423.08 +phiX174 2240 2250 625500.00 +phiX174 2250 2260 721730.77 +phiX174 2260 2270 625500.00 +phiX174 2270 2290 593423.08 +phiX174 2290 2300 609461.54 +phiX174 2300 2310 737769.23 +phiX174 2310 2320 769846.15 +phiX174 2320 2330 866076.92 +phiX174 2330 2340 850038.46 +phiX174 2340 2350 898153.85 +phiX174 2350 2360 801923.08 +phiX174 2360 2370 914192.31 +phiX174 2370 2380 801923.08 +phiX174 2380 2390 641538.46 +phiX174 2390 2400 593423.08 +phiX174 2400 2410 417000.00 +phiX174 2410 2420 400961.54 +phiX174 2420 2430 352846.15 +phiX174 2430 2440 481153.85 +phiX174 2440 2450 449076.92 +phiX174 2450 2460 609461.54 +phiX174 2460 2470 673615.38 +phiX174 2470 2480 737769.23 +phiX174 2480 2490 753807.69 +phiX174 2490 2500 769846.15 +phiX174 2500 2510 785884.62 +phiX174 2510 2520 641538.46 +phiX174 2520 2530 657576.92 +phiX174 2530 2540 529269.23 +phiX174 2540 2550 465115.38 +phiX174 2550 2560 384923.08 +phiX174 2560 2570 433038.46 +phiX174 2570 2590 465115.38 +phiX174 2590 2600 449076.92 +phiX174 2600 2620 529269.23 +phiX174 2620 2630 545307.69 +phiX174 2630 2640 689653.85 +phiX174 2640 2650 625500.00 +phiX174 2650 2660 561346.15 +phiX174 2660 2670 545307.69 +phiX174 2670 2680 609461.54 +phiX174 2680 2700 657576.92 +phiX174 2700 2710 625500.00 +phiX174 2710 2720 593423.08 +phiX174 2720 2740 657576.92 +phiX174 2740 2750 817961.54 +phiX174 2750 2760 866076.92 +phiX174 2760 2770 850038.46 +phiX174 2770 2780 882115.38 +phiX174 2780 2790 962307.69 +phiX174 2790 2800 817961.54 +phiX174 2800 2810 834000.00 +phiX174 2810 2820 801923.08 +phiX174 2820 2830 673615.38 +phiX174 2830 2840 705692.31 +phiX174 2840 2860 625500.00 +phiX174 2860 2870 609461.54 +phiX174 2870 2880 705692.31 +phiX174 2880 2890 657576.92 +phiX174 2890 2900 609461.54 +phiX174 2900 2910 657576.92 +phiX174 2910 2930 561346.15 +phiX174 2930 2940 513230.77 +phiX174 2940 2950 561346.15 +phiX174 2950 2960 497192.31 +phiX174 2960 2970 577384.62 +phiX174 2970 2980 593423.08 +phiX174 2980 2990 513230.77 +phiX174 2990 3000 529269.23 +phiX174 3000 3010 561346.15 +phiX174 3010 3020 513230.77 +phiX174 3020 3030 465115.38 +phiX174 3030 3040 433038.46 +phiX174 3040 3050 417000.00 +phiX174 3050 3060 545307.69 +phiX174 3060 3070 561346.15 +phiX174 3070 3080 625500.00 +phiX174 3080 3100 577384.62 +phiX174 3100 3110 721730.77 +phiX174 3110 3120 673615.38 +phiX174 3120 3130 641538.46 +phiX174 3130 3140 609461.54 +phiX174 3140 3160 673615.38 +phiX174 3160 3180 769846.15 +phiX174 3180 3190 705692.31 +phiX174 3190 3200 657576.92 +phiX174 3200 3210 673615.38 +phiX174 3210 3220 737769.23 +phiX174 3220 3230 657576.92 +phiX174 3230 3240 705692.31 +phiX174 3240 3250 625500.00 +phiX174 3250 3260 545307.69 +phiX174 3260 3270 593423.08 +phiX174 3270 3280 625500.00 +phiX174 3280 3290 577384.62 +phiX174 3290 3300 529269.23 +phiX174 3300 3310 513230.77 +phiX174 3310 3320 529269.23 +phiX174 3320 3330 609461.54 +phiX174 3330 3340 657576.92 +phiX174 3340 3370 641538.46 +phiX174 3370 3390 657576.92 +phiX174 3390 3400 577384.62 +phiX174 3400 3430 481153.85 +phiX174 3430 3440 513230.77 +phiX174 3440 3450 609461.54 +phiX174 3450 3460 577384.62 +phiX174 3460 3480 673615.38 +phiX174 3480 3490 721730.77 +phiX174 3490 3500 834000.00 +phiX174 3500 3510 801923.08 +phiX174 3510 3520 898153.85 +phiX174 3520 3530 769846.15 +phiX174 3530 3540 753807.69 +phiX174 3540 3550 785884.62 +phiX174 3550 3560 753807.69 +phiX174 3560 3570 689653.85 +phiX174 3570 3580 497192.31 +phiX174 3580 3590 465115.38 +phiX174 3590 3610 433038.46 +phiX174 3610 3620 417000.00 +phiX174 3620 3630 400961.54 +phiX174 3630 3640 384923.08 +phiX174 3640 3650 352846.15 +phiX174 3650 3660 433038.46 +phiX174 3660 3680 400961.54 +phiX174 3680 3690 417000.00 +phiX174 3690 3700 336807.69 +phiX174 3700 3710 384923.08 +phiX174 3710 3720 433038.46 +phiX174 3720 3730 625500.00 +phiX174 3730 3740 593423.08 +phiX174 3740 3750 705692.31 +phiX174 3750 3760 673615.38 +phiX174 3760 3780 657576.92 +phiX174 3780 3790 625500.00 +phiX174 3790 3800 497192.31 +phiX174 3800 3810 417000.00 +phiX174 3810 3820 449076.92 +phiX174 3820 3830 433038.46 +phiX174 3830 3840 545307.69 +phiX174 3840 3850 625500.00 +phiX174 3850 3860 769846.15 +phiX174 3860 3870 801923.08 +phiX174 3870 3880 769846.15 +phiX174 3880 3890 721730.77 +phiX174 3890 3900 673615.38 +phiX174 3900 3910 641538.46 +phiX174 3910 3920 593423.08 +phiX174 3920 3930 449076.92 +phiX174 3930 3950 400961.54 +phiX174 3950 3960 433038.46 +phiX174 3960 3970 529269.23 +phiX174 3970 3980 593423.08 +phiX174 3980 3990 561346.15 +phiX174 3990 4000 641538.46 +phiX174 4000 4010 625500.00 +phiX174 4010 4020 609461.54 +phiX174 4020 4030 641538.46 +phiX174 4030 4040 657576.92 +phiX174 4040 4050 545307.69 +phiX174 4050 4060 481153.85 +phiX174 4060 4070 449076.92 +phiX174 4070 4080 400961.54 +phiX174 4080 4090 433038.46 +phiX174 4090 4100 529269.23 +phiX174 4100 4110 400961.54 +phiX174 4110 4120 368884.62 +phiX174 4120 4130 304730.77 +phiX174 4130 4150 368884.62 +phiX174 4150 4160 336807.69 +phiX174 4160 4170 384923.08 +phiX174 4170 4180 272653.85 +phiX174 4180 4190 336807.69 +phiX174 4190 4200 352846.15 +phiX174 4200 4210 368884.62 +phiX174 4210 4230 320769.23 +phiX174 4230 4250 336807.69 +phiX174 4250 4260 384923.08 +phiX174 4260 4280 481153.85 +phiX174 4280 4290 449076.92 +phiX174 4290 4300 465115.38 +phiX174 4300 4310 529269.23 +phiX174 4310 4320 609461.54 +phiX174 4320 4330 577384.62 +phiX174 4330 4340 465115.38 +phiX174 4340 4350 417000.00 +phiX174 4350 4360 433038.46 +phiX174 4360 4380 513230.77 +phiX174 4380 4390 481153.85 +phiX174 4390 4400 449076.92 +phiX174 4400 4410 529269.23 +phiX174 4410 4420 657576.92 +phiX174 4420 4430 705692.31 +phiX174 4430 4440 785884.62 +phiX174 4440 4450 817961.54 +phiX174 4450 4460 801923.08 +phiX174 4460 4470 769846.15 +phiX174 4470 4480 882115.38 +phiX174 4480 4490 689653.85 +phiX174 4490 4500 625500.00 +phiX174 4500 4510 609461.54 +phiX174 4510 4520 465115.38 +phiX174 4520 4540 433038.46 +phiX174 4540 4550 497192.31 +phiX174 4550 4560 481153.85 +phiX174 4560 4570 433038.46 +phiX174 4570 4580 465115.38 +phiX174 4580 4590 417000.00 +phiX174 4590 4600 433038.46 +phiX174 4600 4610 529269.23 +phiX174 4610 4620 513230.77 +phiX174 4620 4630 577384.62 +phiX174 4630 4640 609461.54 +phiX174 4640 4660 689653.85 +phiX174 4660 4670 721730.77 +phiX174 4670 4680 673615.38 +phiX174 4680 4690 609461.54 +phiX174 4690 4700 689653.85 +phiX174 4700 4720 481153.85 +phiX174 4720 4730 400961.54 +phiX174 4730 4740 465115.38 +phiX174 4740 4760 561346.15 +phiX174 4760 4780 593423.08 +phiX174 4780 4790 609461.54 +phiX174 4790 4800 689653.85 +phiX174 4800 4810 673615.38 +phiX174 4810 4820 657576.92 +phiX174 4820 4830 593423.08 +phiX174 4830 4850 625500.00 +phiX174 4850 4860 577384.62 +phiX174 4860 4870 513230.77 +phiX174 4870 4880 497192.31 +phiX174 4880 4890 593423.08 +phiX174 4890 4900 513230.77 +phiX174 4900 4910 481153.85 +phiX174 4910 4920 417000.00 +phiX174 4920 4930 384923.08 +phiX174 4930 4950 352846.15 +phiX174 4950 4960 272653.85 +phiX174 4960 4970 176423.08 +phiX174 4970 4980 240576.92 +phiX174 4980 4990 208500.00 +phiX174 4990 5020 288692.31 +phiX174 5020 5030 352846.15 +phiX174 5030 5040 336807.69 +phiX174 5040 5050 368884.62 +phiX174 5050 5060 304730.77 +phiX174 5060 5070 288692.31 +phiX174 5070 5080 240576.92 +phiX174 5080 5090 304730.77 +phiX174 5090 5100 272653.85 +phiX174 5100 5110 224538.46 +phiX174 5110 5120 256615.38 +phiX174 5120 5130 320769.23 +phiX174 5130 5140 417000.00 +phiX174 5140 5160 497192.31 +phiX174 5160 5170 481153.85 +phiX174 5170 5180 577384.62 +phiX174 5180 5190 561346.15 +phiX174 5190 5200 529269.23 +phiX174 5200 5210 465115.38 +phiX174 5210 5220 449076.92 +phiX174 5220 5230 400961.54 +phiX174 5230 5240 449076.92 +phiX174 5240 5250 368884.62 +phiX174 5250 5260 272653.85 +phiX174 5260 5270 304730.77 +phiX174 5270 5280 336807.69 +phiX174 5280 5290 272653.85 +phiX174 5290 5300 192461.54 +phiX174 5300 5310 144346.15 +phiX174 5310 5340 96230.77 +phiX174 5340 5350 64153.85 +phiX174 5350 5386 32076.9
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamFingerprint_result2.tabular Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,16071 @@ +'bowtie2-test1.bam' 'bowtie2-test1.bam' +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +35 35 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +33 33 +27 27 +25 25 +24 24 +21 21 +20 20 +19 19 +19 19 +19 19 +17 17 +17 17 +15 15 +15 15 +15 15 +10 10 +6 6 +5 5 +5 5 +5 5 +5 5 +5 5 +5 5 +5 5 +3 3 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0 +0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamPEFragmentSize_result1.txt Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,20 @@ +Sample size: 3 + + +Fragment lengths: +Min.: 241 +1st Qu.: 241.5 +Mean: 244.666666667 +Median: 242.0 +3rd Qu.: 246.5 +Max.: 251 +Std: 4.49691252108 + +Read lengths: +Min.: 251 +1st Qu.: 251.0 +Mean: 251.0 +Median: 251.0 +3rd Qu.: 251.0 +Max.: 251 +Std: 0.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bigwigCompare_result2.bg Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,3 @@ +ch1 0 400 1.0 +ch2 0 400 1.0 +ch3 0 400 1.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeGCBias_result1.tabular Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,301 @@ +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeMatrix1.bed Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,8 @@ +phiX174 1000 1500 CG11023 0 + +phiX174 150 1750 cda5 0 - +phiX174 150 177 cda8 0 - +phiX174 75 1500 cda9 0 + +phiX174 101 175 C11023 0 + +phiX174 125 150 ca5 0 - +phiX174 450 1750 ca8 0 + +phiX174 80 1500 cda9 0 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeMatrix2.bed Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,6 @@ +ch1 100 150 CG11023 0 + +ch2 150 175 cda5 0 - +ch3 100 125 cda8 0 + +ch1 75 125 C11023 0 + +ch2 125 150 ca5 0 - +ch3 75 100 ca8 0 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/plotCorrelation_result1.tabular Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,3 @@ + 'bowtie2-test1.bam' 'bowtie2-test1.bam' +'bowtie2-test1.bam' 1.0000 1.0000 +'bowtie2-test1.bam' 1.0000 1.0000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/deepTools_seqs.loc.sample Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,27 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of 2bit genome files for use with deepTools. You will +#need to supply these files and then create a deepTools_seqs.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The deepTools_seqs.loc +#file has this format: +# +#<unique_build_id> <display_name> <file_path> +# +#So, for example, if your deepTools_seqs.loc began like this: +# +#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit +#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit +#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit +# +#then your /depot/data2/galaxy/twobit/ directory +#would need to contain the following 2bit files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit +# +#Your deepTools_seqs.loc file should include an entry per line for +#each file you have stored that you want to be available. Note that +#your files should all have the extension '2bit'. +# +#Please note that the <unique_build_id> is also used as "Species name abbreviation".
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/lastz_seqs.loc.sample Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of 2bit genome files for use with deepTools. +#This file is named lastz_seqs.loc file to make use of an already existing loc +#file from the lastz tool that is created by the twobit data-manager. +#You will need to supply these files and then create a lastz_seqs.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The lastz_seqs.loc +#file has this format: +# +#<unique_build_id> <display_name> <file_path> +# +#So, for example, if your lastz_seqs.loc began like this: +# +#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit +#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit +#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit +# +#then your /depot/data2/galaxy/twobit/ directory +#would need to contain the following 2bit files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit +# +#Your lastz_seqs.loc file should include an entry per line for +#each file you have stored that you want to be available. Note that +#your files should all have the extension '2bit'. +# +#Please note that the <unique_build_id> is also used as "Species name abbreviation".
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Locations of 2bit sequence files for use in Lastz --> + <table name="lastz_seqs" comment_char="#"> + <columns>value, name, path</columns> + <file path="tool-data/lastz_seqs.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Wed Dec 16 16:42:28 2015 -0500 @@ -0,0 +1,9 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="python" version="2.7.10"> + <repository changeset_revision="a28e3c30828d" name="package_python_2_7_10" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + </package> + <package name="deepTools" version="2.0"> + <repository changeset_revision="747571992679" name="package_python_2_7_deeptools_2_0" owner="iuc" toolshed="https://testtoolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>