Mercurial > repos > artbio > justgzip
changeset 0:71f1b922330e draft default tip
"planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/justgzip commit 33e1e0491fc6ba65ac9777c06a7f736592f6d2e3"
| author | artbio |
|---|---|
| date | Wed, 06 Apr 2022 10:11:42 +0000 |
| parents | |
| children | |
| files | gzip.xml test-data/file1 test-data/file1.gz |
| diffstat | 3 files changed, 50 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/gzip.xml Wed Apr 06 10:11:42 2022 +0000 @@ -0,0 +1,42 @@ +<tool id="justgzip" name="Gzip datasets" version="0.2" profile="21.01"> + <description></description> + <stdio> + <exit_code range="1:" level="fatal" description="Tool exception" /> + </stdio> + <command detect_errors="exit_code"><![CDATA[ +gzip -c '${input1}' > '$output' +#if ($input1.ext.startswith("fastq") and not $input1.ext.endswith(".gz")) or $input1.ext in ["fasta", "paf", "gff3", "nii1", "nii2", "gii", "tabular"]: + #set ext = $input1.ext + ".gz" +#else + #set ext = "gz" +#end if +&& echo '{"output": {"ext": "$ext"}}' >> galaxy.json + ]]></command> + <inputs> + <param format="data" name="input1" type="data" label="Input file" help="file to compress" /> + </inputs> + <outputs> + <data name="output" format="auto" label="${input1.name}.gz" /> + </outputs> + <tests> + <test> + <param name="input1" value="file1" ftype="fastq" /> + <output name="output" file="file1.gz" decompress="True" ftype="fastq.gz"/> + </test> + <test> + <param name="input1" value="file1" ftype="fastqsanger" /> + <output name="output" file="file1.gz" decompress="True" ftype="fastqsanger.gz" /> + </test> + + </tests> + <help> + +.. class:: infomark + +**What it does** + +Just **gzip** datasets. + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/file1 Wed Apr 06 10:11:42 2022 +0000 @@ -0,0 +1,8 @@ +@1831_573_1004/1 +AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG ++ +><C&&9952+C>5<.?<79,=42<292:<(9/-7 +@1831_573_1050/1 +TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT ++ +;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1, \ No newline at end of file