# HG changeset patch
# User artbio
# Date 1649239902 0
# Node ID 71f1b922330ee79924be4e979db42ab33e617fa6

"planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/justgzip commit 33e1e0491fc6ba65ac9777c06a7f736592f6d2e3"

diff -r 000000000000 -r 71f1b922330e gzip.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gzip.xml	Wed Apr 06 10:11:42 2022 +0000
@@ -0,0 +1,42 @@
+<tool id="justgzip" name="Gzip datasets" version="0.2" profile="21.01">
+  <description></description>
+  <stdio>
+      <exit_code range="1:" level="fatal" description="Tool exception" />
+  </stdio>
+  <command detect_errors="exit_code"><![CDATA[  
+gzip -c '${input1}' >  '$output'
+#if ($input1.ext.startswith("fastq")  and not $input1.ext.endswith(".gz")) or $input1.ext in ["fasta", "paf", "gff3", "nii1", "nii2", "gii", "tabular"]:
+    #set ext = $input1.ext + ".gz"
+#else
+    #set ext = "gz"
+#end if
+&& echo '{"output": {"ext": "$ext"}}' >> galaxy.json
+  ]]></command>
+  <inputs>
+    <param format="data" name="input1" type="data" label="Input file" help="file to compress" />
+  </inputs>
+  <outputs>
+    <data name="output" format="auto" label="${input1.name}.gz" />
+  </outputs>
+  <tests>
+      <test>
+          <param name="input1" value="file1" ftype="fastq" />
+          <output name="output" file="file1.gz" decompress="True" ftype="fastq.gz"/>
+      </test>
+      <test>
+          <param name="input1" value="file1" ftype="fastqsanger" />
+          <output name="output" file="file1.gz" decompress="True" ftype="fastqsanger.gz" />
+      </test>   
+
+  </tests>
+  <help>
+
+.. class:: infomark
+
+**What it does**
+
+Just **gzip** datasets.
+    
+  </help>
+</tool>
+
diff -r 000000000000 -r 71f1b922330e test-data/file1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/file1	Wed Apr 06 10:11:42 2022 +0000
@@ -0,0 +1,8 @@
+@1831_573_1004/1
+AATACTTTCGGCGCCCTAAACCAGCTCACTGGGG
++
+><C&&9952+C>5<.?<79,=42<292:<(9/-7
+@1831_573_1050/1
+TTTATGGGTATGGCCGCTCACAGGCCAGCGGCCT
++
+;@@17?@=>7??@A8?==@4A?A4)&+.'&+'1,
\ No newline at end of file
diff -r 000000000000 -r 71f1b922330e test-data/file1.gz
Binary file test-data/file1.gz has changed