Mercurial > repos > abims-sbr > blastalign
changeset 2:92615a423389 draft
planemo upload for repository https://github.com/abims-sbr/adaptsearch commit 44a89d5eeb82789bfc643b33c11f391281b6374b
line wrap: on
line diff
--- a/BlastAlign.xml Thu Apr 13 09:47:31 2017 -0400 +++ b/BlastAlign.xml Wed Sep 27 10:02:43 2017 -0400 @@ -1,222 +1,114 @@ -<?xml version="1.0"?> - -<tool name="BlastAlign" id="blastalign" version="1.0"> +<tool name="BlastAlign" id="blastalign" version="2.0"> - <description> - Align the nucleic acid sequences - </description> + <description> + Align the nucleic acid sequences using BLASTN + </description> - <macros> - <import>macros.xml</import> - </macros> + <macros> + <import>macros.xml</import> + </macros> - <requirements> - <expand macro="python_required" /> - <requirement type="package" version="5.22.0">perl</requirement> - <requirement type="package" >blast-legacy</requirement> - <requirement type="package" version="1.4">blastalign</requirement> - </requirements> + <requirements> + <expand macro="python_required" /> + <requirement type="package" version="1.4">blastalign</requirement> + </requirements> - <stdio> + <stdio> <exit_code range="1:" level="fatal" /> </stdio> - - <command> - <![CDATA[ - ln -s $__tool_directory__/scripts/S02_phylip2fasta.py . - && - #if $files.type == "one" : - BlastAlign -i ${files.one_file} -o out - #if $files.options.option == "yes" : - #if $files.options.options_m.m == True : - -m ${files.options.options_m.proportion} - #else : - -m 95 - #end if - #if $files.options.options_r.r == True : - -r ${files.options.options_r.reference} - #end if - #if $files.options.options_x.x == True : - -x ${files.options.options_x.exclusion} - #end if - #if $files.options.options_n == True : - -n T - #else : - -n F - #end if - #if $files.options.options_s.s == True : - -s ${files.options.options_s.initialisation} - #end if - #elif $files.options.option == "no" : - -m 95 -n F - #end if - >${outfile}; - #if $fasta_out.value == True : - python $__tool_directory__/scripts/S02_phylip2fasta.py out.phy out.fasta >>${outfile}; - #end if - #end if - - #if $files.type == "many" : - python $__tool_directory__/scripts/S01_prepare_BlastAlign_runs.py ${files.many_files} - #if $fasta_out.value == True : - oui - #else : - non - #end if - #if $files.options.option == "yes" : - #if $files.options.options_m.m == True : - ${files.options.options_m.proportion} - #else : - 95 - #end if - #if $files.options.options_n == True : - T - #else : - F - #end if - #elif $files.options.option == "no" : - 95 F - #end if - >${outfile}; - #end if - ]]> - </command> - <inputs> - <conditional name="files"> - <param name="type" type="select" label="How many files do you want to align ? "> - <option value="one">Only one file</option> - <option value="many">Many files in zip format</option> - </param> + + <command><![CDATA[ + ln -s '$input' '$input.element_identifier'".fasta" && - <when value="one"> - <param name="one_file" type="data" format="fasta" label="Choose your file" help="Only a fasta file with nucleotides sequences" /> + BlastAlign -i '$input.element_identifier'".fasta" + -m $advanced_option.m + #if $advanced_option.r != "" + -r $advanced_option.r + #end if + #if $advanced_option.x != "" + -x $advanced_option.x + #end if + -n $advanced_option.n + #if $advanced_option.s != 0 + -s $advanced_option.s + #end if + && + ln -s '$input.element_identifier'".fasta.phy" out.phy && + ln -s '$input.element_identifier'".fasta.nxs" out.nxs && + #if $fasta_out.value == True + python $__tool_directory__/scripts/S01_phylip2fasta.py out.phy out.fasta + #end if - <conditional name="options"> - <param name="option" type="select" label="Blast advanced options "> - <option value="no">No</option> - <option value="yes">Yes</option> - </param> - <when value="yes"> - <conditional name="options_m"> - <param name="m" type="boolean" checked="False" label="Proportion of gaps allowed in any one sequence in the final alignement " /> - <when value="true"> - <param name="proportion" type="integer" value="50" min="0" max="100" label="Maximum proportion " help="By default it's 95%" /> - </when> - <when value="false" > - </when> - </conditional> + ]]></command> + <inputs> + <param name="input" type="data" format="fasta" label="Choose your file" help="A fasta file with nucleotides sequences" /> + + <section name="advanced_option" title="Blast advanced options" expanded="True"> + <param argument="-m" type="integer" value="95" min="0" max="100" label="Proportion of gaps allowed in any one sequence in the final alignement" help="default = 95, i.e. only removing sequences with extremely short matches" /> + <param argument="-r" type="text" area="True" size="1x20" label="Choose a reference sequence" help="default is to search for best candidate (if entered, the sequence will be extracted, written to a separate file, and blasted against the original input file)"/> + <param argument="-x" type="text" area="True" size="5x25" label="Choose the sequences to be excluded from this analysis" help="name of comma-separated sequences " /> + <param argument="-n" type="boolean" checked="true" truevalue="T" falsevalue="F" label="Retain original names in output files" help="option F is to output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the program" /> + <param argument="-s" type="integer" value="0" min="0" label="Number of sequences to be used in initial search for reference sequence" help="default (= 0) is to find the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large" /> + </section> + + <param name="fasta_out" type="boolean" checked="true" label="Do you want to convert the output phylip in fasta format ? " /> + </inputs> - <conditional name="options_r"> - <param name="r" type="boolean" label="Choose the reference sequence " /> - <when value="true" > - <param name="reference" type="text" area="True" size="1x20" label="Name " /> - </when> - <when value="false" > - </when> - </conditional> - - <conditional name="options_x"> - <param name="x" type="boolean" label="Choose the sequences to be excluded from this analysis " /> - <when value="true"> - <param name="exclusion" type="text" area="True" size="5x25" label="name of comma-separated sequences " /> - </when> - <when value="false" > - </when> - </conditional> - - <param name="options_n" type="boolean" label="retain original names in output files "/> - - <conditional name="options_s"> - <param name="s" type="boolean" label="Choose the number of sequences to be used in initial search for reference sequence " /> - <when value="true"> - <param name="initialisation" type="integer" value="10" min="0" label="Number of sequences "/> - </when> - <when value="false" > - </when> - </conditional> - </when> - <when value="no" > - </when> - </conditional> - </when> - - <when value="many"> - <param name="many_files" type="data" format="no_unzip.zip,zip" label="Choose your ZIP file" help="Only a zip file containing fasta file with nucleotides sequences" /> + <outputs> + <data format="phy" name="phy" from_work_dir="out.phy" label="Alignment of ${input.name} in phylip" /> + <data format="nxs" name="nxs" from_work_dir="out.nxs" label="Alignment of ${input.name} in nexus" /> + <data format="fasta" name="fasta" from_work_dir="out.fasta" label="Alignment of ${input.name} in fasta"> + <filter>fasta_out == True</filter> + </data> + </outputs> - <conditional name="options"> - <param name="option" type="select" label="Blast advanced options "> - <option value="no">No</option> - <option value="yes">Yes</option> - </param> - <when value="yes"> - <conditional name="options_m"> - <param name="m" type="boolean" label="Proportion of gaps allowed in any one sequence in the final alignement " /> - <when value="true"> - <param name="proportion" type="integer" value="50" min="0" max="100" label="Maximum proportion " help="By default it's 95%" /> - </when> - <when value="false" > - </when> - </conditional> - - <param name="options_n" type="boolean" label="retain original names in output files "/> - </when> - <when value="no" > - </when> - </conditional> - </when> - </conditional> - - <param name="fasta_out" type="boolean" checked="True" label="Do you want to convert the output phylip in fasta format ? " /> - <param name="files_failed" type="boolean" label="Do you want to have a file containing a list of files failed with BlastAlign ? " /> - </inputs> + <tests> + <test> + <param name="input" ftype="fasta" value="inputs/locus1_sp2.fasta" /> + <section name="advanced_option"> + <param name="m" value="95" /> + <param name="r" value="" /> + <param name="x" value="" /> + <param name="n" value="False" /> + <param name="s" value="0" /> + </section> + <param name="fasta_out" value="True" /> + <output name="phy" value="outputs/locus1_sp2.phy" /> + <output name="nxs" value="outputs/locus1_sp2.nxs" /> + <output name="fasta" value="outputs/locus1_sp2.fasta" /> + </test> + <test> + <param name="input" ftype="fasta" value="inputs/locus1_sp3.fasta" /> + <section name="advanced_option"> + <param name="m" value="95" /> + <param name="r" value="" /> + <param name="x" value="" /> + <param name="n" value="False" /> + <param name="s" value="0" /> + </section> + <param name="fasta_out" value="True" /> + <output name="phy" value="outputs/locus1_sp3.phy" /> + <output name="nxs" value="outputs/locus1_sp3.nxs" /> + <output name="fasta" value="outputs/locus1_sp3.fasta" /> + </test> - <outputs> - <data format="txt" name="outfile" label="Alignment" /> - <data format="phy" name="phy" from_work_dir="out.phy" label="Alignment_${files.one_file.name}_phylip"> - <filter>files['type'] == "one"</filter> - </data> - <data format="nxs" name="nxs" from_work_dir="out.nxs" label="Alignment_${files.one_file.name}_nexus"> - <filter>files['type'] == "one"</filter> - </data> - <data format="fasta" name="fasta" from_work_dir="out.fasta" label="Alignment_${files.one_file.name}_fasta"> - <filter>((files['type'] == "one" and fasta_out == True))</filter> - </data> - <data format="no_unzip.zip" name="phy_zip" from_work_dir="Alignment_locus_phy.zip" label="Alignment_locus_phylip"> - <filter>files['type'] == "many"</filter> - </data> - <data format="no_unzip.zip" name="nxs_zip" from_work_dir="Alignment_locus_nxs.zip" label="Alignment_locus_nexus"> - <filter>files['type'] == "many"</filter> - </data> - <data format="no_unzip.zip" name="fasta_zip" from_work_dir="Alignment_locus_fasta.zip" label="Alignment_locus_fasta"> - <filter>((files['type'] == "many" and fasta_out == True))</filter> - </data> + <!--locus10_sp2.fasta locus1_sp3.fasta locus2_sp2.fasta locus3_sp2.fasta locus4_sp2.fasta locus5_sp2.fasta locus6_sp2.fasta locus7_sp2.fasta locus8_sp2.fasta locus9_sp2.fasta--> + </tests> + + <help> - <data format="txt" name="out_failed" from_work_dir="list_files_failed.txt" label="Alignment_files_failed"> - <filter>files_failed == True</filter> - </data> - </outputs> +.. class:: infomark - <tests> - <test> - <param name="type" value="many"/> - <param name="many_files" ftype="zip" value="test_4_output_POGS_input_BlastAlign.zip" /> - <param name="option" value="no" /> - <param name="fasta_out" value="True" /> - <param name="files_failed" value="True" /> - <output name="outfile" value="test_05.out" /> - </test> - </tests> +**Authors** The script in perl was written by **Robert Belshaw** and **Aris Katzourakis**. - <help> +@HELP_AUTHORS@ + ============ What it does ============ -| This tool takes **nucleic sequences in fasta format** or **zip file containing fasta files** and returns a multiple alignement (in Nexus and Phylip formats) using BLAST+ -| -| The script in perl was written by **Robert Belshaw** and **Aris Katzourakis**. -| The script in python was written by **Eric Fontanillas**. -| The wrapper was written by **Julie Baffard**. +| This tool takes **nucleic sequences in fasta format** or **'dataset collection list' containing fasta files** and returns a multiple alignement (in Nexus and Phylip formats) using BLAST+ +| -------- @@ -227,33 +119,29 @@ The choice of several parameters for the blast is possible. **-m [maximum proportion of gaps allowed in any one sequence in the final alignement]** - | integer (between 0 and 100) - | By default : 95%, i.e. only removes sequences with extremely short matches. - | We find 50 the most useful. - | + | integer (between 0 and 100) + | By default : 95%, i.e. only removes sequences with extremely short matches. + | We find 50 the most useful. + | **-r [name of reference sequence]** - | text - | Default is searching for best candidate. - | If entered, the sequence will be extracted, written to a separate file, and blasted against the original input file. - | + | text + | Default is searching for best candidate. + | If entered, the sequence will be extracted, written to a separate file, and blasted against the original input file. + | **-x [name of comma-separated sequences to be excluded from this analysis]** - | text - | + | text + | **-n** - | If it's checked : retain original names in output files. - | If isn't checked : to output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the tool. - | + | If it's checked : retain original names in output files. + | If isn't checked : to output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the tool. + | **-s [number of sequences to be used in initial search for reference sequence]** - | integer (between 0 and total number of sequences) - | Default is finding the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large. - -.. class:: infomark - -m and n are the only parameters which can used for the 2 options (one file and many files). + | integer (between 0 and total number of sequences) + | Default is finding the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large. -------- @@ -264,40 +152,24 @@ This tool, produces the following files : **Alignment** - | is the output with important informations. - | when the alignment failed with BlastAlign, the name of the file is writting down this output. - | + | is the output with important informations. + | when the alignment failed with BlastAlign, the name of the file is writting down this output. + | **Alignement_file_failed** - | is the output containing the files failed during the run of BlastAlign. - | + | is the output containing the files failed during the run of BlastAlign. + | **Alignment_{inputfile}_phylip** - | is the output with the aligned sequences in Phylip format when you choose "one file" option. - | + | is the output with the aligned sequences in Phylip format. + | **Alignment_{inputfile}_nexus** - | is the output with the aligned sequences in Nexus format when you choose "one file" option. - | + | is the output with the aligned sequences in Nexus format. + | **Alignment_{input_file}_fasta** - | is the output with the aligned sequences in Fasta format when you choose "one file" and "fasta forme" options - | - -**Alignment_locus_phylip** - | is the output with the aligned sequences in Phylip format when you choose "many files" option. - | - -**Alignment_locus_nexus** - | is the output with the aligned sequences in Nexus format when you choose "many files" option. - | - -**Alignment_locus_fasta** - | is the output with the aligned sequences in Fasta forme when you choose "many file" and "fasta forme" options - -.. class:: warningmark - -The zip outputs have to be downloaded (and extracts the files with a file archiver software), you cannot visualize them with the "eye icon" through the interface. + | is the output with the aligned sequences in Fasta format. -------- @@ -327,11 +199,6 @@ CCAGTGTAGATTTGTTCAAGAAGGTGTGCTGGCGTTGTTTGAATTTTGTAATAGTACCATGATTTAAATACCCGGTTAACGGCCTACCTGTTATGTAGAAATTGTAGAGAAAAAATTAAATCAATTTTGTATGAACTATAAGCAGCAGCTAATATATTTGCAGTTT TACATGTTTATCTGTTCATCAGCATGGGTCAGAGAATGACCGTACTTTGCTGGTGATAGAATGCTTGTATTCAAAGTTTAATAAATGGTTGTAAGCCATTTAAAAAAAAAAAAAAA -**Parameters** - -| option : one file. It's the same for the option "many files" except that the output files are in zip format (inside : 1 file corresponding to one output of BlastAlign) -| no option for the run Blast. So, by default it's -m 95 -n F - ---------------- The output files ---------------- @@ -340,23 +207,16 @@ ************************ BlastAlign ************************ -| +| | This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus and Phylip formats) using BLASTN -| +| | Input file locus_2_sp_8.fasta has 2 sequences and is 1894 bytes | (maximum number of sequences that will be used to search for the reference sequence is 770) -| -| +| +| | BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 720 by aligning to sequence Pf2101/11000920 (proportion of gaps in each sequence is less than 0.95) |Â -.. class:: infomark - -| if you choose the option "many files" -| there will be as template output that number of file in the input zip. -| -| - **Alignment_{inputfile}_phylip** | 2 720 S @@ -370,15 +230,8 @@ | tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaact | ggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt---------------------------------------------- | ------------- -| - -.. class:: infomark +| -| If you choose the option "many file" -| Save as *Galaxy{number}-[Alignment_locus_phy].zip* -| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.phy -| -|Â **Alignment_{inputfile}_nexus** @@ -403,15 +256,8 @@ | ------------- | ; | end; -| - -.. class:: infomark +| -| If you choose the option "many file" -| Save as *Galaxy{number}-[Alignment_locus_nxs].zip* -| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.nxs -| -| **Alignment_{inputfile}_fasta** @@ -428,13 +274,26 @@ actagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaactggctacatccg tgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt--------------------------------------------------------- -.. class:: infomark + +--------------------------------------------------- + +Changelog +--------- + +**Version 2.0 - 21/04/2017** + + - NEW: BlastAlign will now be launched on one file at once. Although, it will manage a Dataset Collection to deal with numerous files. + -| If you choose the option "many file" -| Save as *Galaxy{number}-[Alignment_locus_fasta].zip* -| If you unzip the file, a number of files are extracted (depends on the number of locus) : {name_of_file}.fasta - </help> +**Version 1.0 - 13/04/2017** + + - TEST: Add funtional test with planemo - <expand macro="citations" /> + - IMPROVEMENT: Use conda dependencies for blastalign, blast-legacy, perl, python + + + </help> + + <expand macro="citations" /> </tool>
--- a/README.md Thu Apr 13 09:47:31 2017 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,7 +0,0 @@ -Changelog - -Version 1.0 - 13/04/2017 - - - Add functional test with planemo - - Planemo test with conda dependencies for blastalign, blast-legacy, perl, python - - Scripts renamed + symlinks to the directory 'scripts'
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README.rst Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,14 @@ +Changelog +--------- + +**Version 2.0 - 21/04/2017** + + - NEW: BlastAlign will now be launched on one file at once. Although, it will manage a Dataset Collection to deal with numerous files. + + +**Version 1.0 - 13/04/2017** + + - TEST: Add funtional test with planemo + + - IMPROVEMENT: Use conda dependencies for blastalign, blast-legacy, perl, python +
--- a/macros.xml Thu Apr 13 09:47:31 2017 -0400 +++ b/macros.xml Wed Sep 27 10:02:43 2017 -0400 @@ -1,9 +1,24 @@ <macros> - <xml name="python_required"> - <requirement type="package" version="2.7">python</requirement> + <xml name="python_required"> + <requirement type="package" version="2.7">python</requirement> </xml> + <token name="@HELP_AUTHORS@"> +.. class:: infomark + +**Authors** Eric Fontanillas creates the scripts of this pipeline. + +.. class:: infomark + +**Galaxy integration** ABiMS TEAM + + | Contact support.abims@sb-roscoff.fr for any questions or concerns about the Galaxy implementation of this tool. + +--------------------------------------------------- + + </token> + <xml name="citations"> <citations> <citation type="bibtex">Credits : ABIMS team, Roscoff Marine Station</citation>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/scripts/S01_phylip2fasta.py Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,54 @@ +#!/usr/bin/python + +## AUTHOR: Eric Fontanillas +## LAST VERSION: 20/08/14 by Julie BAFFARD + +## DESCRIPTION: formatting a fasta format into phylip format for using with PAML + +import string, os, sys + +if len(sys.argv) == 1: + print "put arguments!!" + print "USAGE: $T4S02_phylip2fasta.py INPUT OUTPUT" + + +## INPUT +f1 = sys.argv[1] +F1 = open("%s" %f1, 'r') + +## OUTPUT +f2 = sys.argv[2] +F2 = open("%s" %f2, 'w') + +###### def1 ###### +# Dans un multialignement fasta, cette fonction permet de formatter les noms de chaque sequence fasta + +def format(File_IN): + c = 0 + fichier = "" + while 1 : + c = c + 1 + next = File_IN.readline() + if not next : + break + + S1 = string.split(next, "\t") # list : [name, sequence] --- BUG CORRECTED : "\t" instead of " " + fasta_name = S1[0] # get sequence name + fasta_seq = S1[1][:-1] # get sequence without the terminal '\n' + fichier = fichier + ">" + fasta_name + "\n" + fasta_seq + "\n" + + return (fichier,c) +#-#-#-#-#-#-#-#-#-#-# + +################### +### RUN RUN RUN ### +################### + +F1.readline() ## jump the first line + +fichier_txt, c = format(F1) ### DEF1 ### + +F2.write(fichier_txt) + +F1.close() +F2.close()
--- a/scripts/S01_prepare_BlastAlign_runs.py Thu Apr 13 09:47:31 2017 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,119 +0,0 @@ -#!/usr/bin/python - -## AUTHOR: Eric Fontanillas -## LAST VERSION: 20/08/14 by Julie BAFFARD - -## DESCRIPTION: Prepare to run multialign on assemblages on several cluster nodes - -import os,sys -script_path = os.path.dirname(sys.argv[0]) -############################################### -### DEF 1 : Split a list in several sublist ### -############################################### -def chunks(list, n): - """ Yield successive n-sized chunks from l. - """ - for i in xrange(0, len(list), n): - yield list[i:i+n] -###################################### - - -########################################## -### DEF 2 : Prepare run for blastalign ### -########################################## -def prepare_BLASTALIGN_runs(list_file): - - ln = len(list_file) - i = 0 - list_of_sublist = list(chunks(list_file, 5000)) ### DEF2 ### - - list_files_failed = [] - - k=0 - for sublist in list_of_sublist: - for fasta_file in sublist: - i = i + 1 - S1 = string.split(fasta_file, ".") - fasta_name = S1[0] - - # filter the "N" - f = open("./%s.fasta" %fasta_name, "r") - nextline=f.readlines() - f.close() - - j = 0 - while j<len(nextline) : - if not nextline[j].startswith(">") : - nextline[j] = nextline[j].upper() - nombre = nextline[j].rfind("N") - if nombre != -1 : - nextline[j] = nextline[j].replace("N", "") - j+=1 - nextline = "".join(nextline) - - files = open("./%s.fasta" %fasta_name, "w") - files.write(nextline) - files.close() - - ## run individual script - os.system("BlastAlign -m %s -n %s -i ./%s.fasta\n" %(sys.argv[3],sys.argv[4],fasta_name)) - - try: - phylip_file = open("./%s.fasta.phy" %fasta_name, "r") - except IOError: - list_files_failed.append(fasta_file) - - if sys.argv[2] == "oui" : - try: # in the case BlastAlign failed (there is no .fasta.phy in that case) - with open("%s.fasta.phy" %fasta_name): os.system("python %s/S02_phylip2fasta.py ./%s.fasta.phy ./%s.fasta.fasta\n" %(script_path,fasta_name, fasta_name)) - except IOError: - pass - - os.system("rm -f ./%s.fasta\n" %fasta_name) - - if os.path.isfile("%s.fasta.fasta" %fasta_name): # in the case BlastAlign failed (there is no .fasta.fasta in that case) - os.system("mv ./%s.fasta.fasta ./%s.fasta\n" %(fasta_name, fasta_name)) - - return(list_files_failed) - -###################################### - -################### -### RUN RUN RUN ### -################### - -import string, os, time, re, sys, zipfile, re - -## 1 ## INPUT/OUTPUT -list_file = [] -zfile = zipfile.ZipFile(sys.argv[1]) -for name in zfile.namelist() : - list_file.append(name) - zfile.extract(name, "./") - -## 2 ## RUN -list_files_failed = prepare_BLASTALIGN_runs(list_file) ### DEF2 ### -f_failed = open("./list_files_failed.txt", "w") -f_failed.write("Number of files failed with BlastAlign : %d\n" %len(list_files_failed)) -for files in list_files_failed : - f_failed.write("\t%s \n" %files) - - -#Convertion in zip format -f_phylip = zipfile.ZipFile("Alignment_locus_phy.zip", "w") -f_nexus = zipfile.ZipFile("Alignment_locus_nxs.zip", "w") -f_fasta = zipfile.ZipFile("Alignment_locus_fasta.zip", "w") - -phylip = "^.*fasta.phy$" -nexus = "^.*fasta.nxs$" -fasta = "^.*fasta$" - -folder = os.listdir("./") - -for files in folder : - if re.match(phylip, files) : - f_phylip.write("./%s" %files) - if re.match(nexus, files) : - f_nexus.write("./%s" %files) - if re.match(fasta, files) : - f_fasta.write("./%s" %files)
--- a/scripts/S02_phylip2fasta.py Thu Apr 13 09:47:31 2017 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,54 +0,0 @@ -#!/usr/bin/python - -## AUTHOR: Eric Fontanillas -## LAST VERSION: 20/08/14 by Julie BAFFARD - -## DESCRIPTION: formatting a fasta format into phylip format for using with PAML - -import string, os, sys - -if len(sys.argv) == 1: - print "put arguments!!" - print "USAGE: $T4S02_phylip2fasta.py INPUT OUTPUT" - - -## INPUT -f1 = sys.argv[1] -F1 = open("%s" %f1, 'r') - -## OUTPUT -f2 = sys.argv[2] -F2 = open("%s" %f2, 'w') - -###### def1 ###### -# Dans un multialignement fasta, cette fonction permet de formatter les noms de chaque sequence fasta - -def format(File_IN): - c = 0 - fichier = "" - while 1 : - c = c + 1 - next = File_IN.readline() - if not next : - break - - S1 = string.split(next, "\t") # list : [name, sequence] --- BUG CORRECTED : "\t" instead of " " - fasta_name = S1[0] # get sequence name - fasta_seq = S1[1][:-1] # get sequence without the terminal '\n' - fichier = fichier + ">" + fasta_name + "\n" + fasta_seq + "\n" - - return (fichier,c) -#-#-#-#-#-#-#-#-#-#-# - -################### -### RUN RUN RUN ### -################### - -F1.readline() ## jump the first line - -fichier_txt, c = format(F1) ### DEF1 ### - -F2.write(fichier_txt) - -F1.close() -F2.close()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus10_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap2_1/1_1.000_160 +ATACTCAGGCACACAGCATTTGTCGTACTAGGCGAGAGAGAGAGAGGAACGACTAATTGCAACCACGATTACGTTACATTTGTTTACAAACCAAACGTACTGGCGTCGAAGATAATTAAGAGGAAGCTGACTGAATGCGATTGGCGTTGGTCTACGGGTT +>Pf5_1/1_1.000_160 +ATACTCAGGCACACAGCATTTGTCGTACTAGGCGAGAGAGAGAGAGGAACGACTAATTGCAACCACGATTACGTTACATTTGTTTACAAACCAAACGTACTGGCGTCGAAGATAATTAAGAGGAAGCTGACTGAATGCGATTGGCGTTGGTCTACGGGTT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus1_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac7_1/1_1.000_160 +GCACCTAGAATTACCCGAAGTTGCTTGGCAATAGCGACACCTAACGGTCGCCATGATATTTGCAGGAAGAAGGCATGTGGTACCATTGGGAACCGTCAAGCGTTTCCTCAGCCCTGTGGCAGCTGCCCGTCTGCGCCCGTGTTTGACCTTGAGCACCAAG +>Am3_1/1_1.000_160 +GCACCTAGAATTACCCGAAGTTGCTTGGCAATAGCGACACCTAACGGTCGCCATGATATTTGCAGGAAGAAGGCATGTGGTACCATTGGGAACCGTCAAGCGTTTCCTCAGCCCTGTGGCAGCTGCCCGTCTGCGCCCGTGTTTGACCTTGAGCACCAAG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus1_sp3.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,6 @@ +>Ac5_1/1_1.000_160 +GCACCGGGATGCGGATTTGCTGACGATATGGCAAAAGCATTGTCAGCGTGCGGAACCTGTTTATGTCACACCACTGGCATCTTCCTGGCCGTCGCAGCCTTCGTTCTGACGGCACTCGGTATTGTCTGCGTCACGCGATCAGCTGACCCGAGCCTTTGGT +>Am1_1/1_1.000_160 +GCACCGGGATGCGGATTTGCTGACGATATGGCAAAAGCATTGTCAGCGTGCGGAACCTGTTTATGTCACACCACTGGCATCTTCCTGGCCGTCGCAGCCTTCGTTCTGACGGCACTCGGTATTGTCTGCGTCACGCGATCAGCTGACCCGAGCCTTTGGT +>Pf7_1/1_1.000_160 +GCACCGGGATGCGGATTTGCTGACGATATGGCAAAAGCATTGTCAGCGTGCGGAACCTGTTTATGTCACACCACTGGCATCTTCCTGGCCGTCGCAGCCTTCGTTCTGACGGCACTCGGTATTGTCTGCGTCACGCGATCAGCTGACCCGAGCCTTTGGT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus2_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac6_1/1_1.000_160 +CAGCCTACCACTGAGAAGAGATACTTCAACATGTCTTACTGGGGTAGAAGTGGTGGTCGTACAGCGGGTGGTAATGCAGGACGTGGTCGTGGCGGCGGCAGCGGCAGTGGCAGTAGTCAAAGTGGTGGTGGCAGCTTTCTACAGGAACGTATCAAAGAGA +>Am2_1/1_1.000_160 +CAGCCTACCACTGAGAAGAGATACTTCAACATGTCTTACTGGGGTAGAAGTGGTGGTCGTACAGCGGGTGGTAATGCAGGACGTGGTCGTGGCGGCGGCAGCGGCAGTGGCAGTAGTCAAAGTGGTGGTGGCAGCTTTCTACAGGAACGTATCAAAGAGA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus3_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac23_1/1_1.000_366 +ACTGAGGCTCGAACACAACAAAAAGGTGATGAGCAGTCAGCACTTAATAGAATATTACAGCAAGTAGCCAGTAATGTAGTTGATGTAGCAGCATTAGATAATCAAGGAGTAGACCAAGTTGAATACACAGATAGAGCTAGACAATACAGCCATAACCTGTCATCGTGGTGTGCTAGCACCCAGAAAGTACGAGGACCTCAACGTCTACCTGTTGGCGTAGCCACTCCACACACAGTCCTGTCTGGACAACCTATCACCTTAGCTGATATTGAACTGATAACTCATGCTGCCCAACAAGCGGCACGGTCACTACAAGAGGTCAAAGTTCGCCACAAAGAAGACTTGGTTGTACCTTTTGGCGTGCCA +>Ap46_1/1_1.000_217 +CCACAACCAAGTGGCGGGTATAACAGCACCGAGGCTCGAACACAGCAAAAAGGTGATGAGCAGTCAGCTCTTAATAGAATATTACAGCAAGTAGCCAGTAATGTAGTTGATGTAGCAGCATTAGATAATCAAGGAGTAGATCAAGTTGAGTACACAGATAGAGCTAGACAGTACAGCCATAACCTGTCATCATGGTGTGCTACCACCCAGAAAGTAC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus4_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac8_1/1_1.000_160 +ATCAAAGAAGAGCAACATCGAGCTACTGGCACTGGCAATGGAATCCTAATTATAGCAGAAACAAGCACTGGTTGCCTGTTGTCTGGGTCAGCAATTGGTAGTAGAGGTGTTCCTGCTGAAGAAGTTGGGGTCAAAGCAGGACAGATGCTTTTGGATAACT +>Pf8_1/1_1.000_160 +ATCAAAGAAGAGCAACATCGAGCTACTGGCACTGGCAATGGAATCCTAATTATAGCAGAAACAAGCACTGGTTGCCTGTTGTCTGGGTCAGCAATTGGTAGTAGAGGTGTTCCTGCTGAAGAAGTTGGGGTCAAAGCAGGACAGATGCTTTTGGATAACT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus5_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Am8_1/1_1.000_160 +GTATTAATAAAAGGACAAGACTATTATTTAATACCAAGAAATCTGGCCTTAATAAGCATGGTTGCTTATATCATAAGCATGGTAAATCACATTGTGTTTTCCATGTGTTTACCCATCAGATGTAAAAATATTCTGCATGAAATAAAGAGCTTCTATGGTT +>Pf9_1/1_1.000_160 +GTATTAATAAAAGGACAAGACTATTATTTAATACCAAGAAATCTGGCCTTAATAAGCATGGTTGCTTATATCATAAGCATGGTAAATCACATTGTGTTTTCCATGTGTTTACCCATCAGATGTAAAAATATTCTGCATGAAATAGGTAATTTCCCGATTA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus6_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap3_1/1_1.000_160 +GCCATGCAGTACACTGGACTTCTGTTATTCTGTTTGTTTGCCTTGACGGCAGCCAAACCCGCGGAAGACCTTCAAATGCTCATCCGAGCCCTGCTCCATGAAATAGAAGAGGAAGGTGAACTCCAAGAGCGAGGCATTGGCGCCGTGAAGTATGGTGGAA +>Pf6_1/1_1.000_160 +GCCATGCAGTACACTGGACTTCTGTTATTCTGTTTGTTTGCCTTGACGGCAGCCAAACCCGCGGAAGACCTTCAAATGCTCATCCGAGCCCTGCTCCATGAAATAGAAGAGGAAGGTGAACTCCAAGAGCGAGGCATTGGCGCCGTGAAGTATGGTGGAA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus7_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap1_1/1_1.000_160 +GGTCGCCTTATAAAAACCAATCCGAAACAGTTTTCCTTTGAAACGTGCCAAAAACCAAAAACATACTTCAAATCTTCCAGTGTCTGTTATAAAGGGGTGAGCGTAGAGAGGGCACTTGTGAGATTGGTGTCTGGGTTAAAGATTTTGCCAAAAAGCGATT +>Pf4_1/1_1.000_160 +GGTCGCCTTATAAAAACCAATCCGAAACAGTTTTCCTTTGAAACGTGCCAAAAACCAAAAACATACTTCAAATCTTCCAGTGTCTGTTATAAAGGGGTGAGCGTAGAGAGGGCACTTGTGAGATTGGTGTCTGGGTTAAAGATTTTGCCAAAAAGCGATT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus8_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap130_1/1_1.000_300 +CCAGTTCTAGGGTCTCAGTTTGGCTGTGTGTGTGTGTTAGGGTGTACCTCTGGGTGTTTGTGTATTTACATTCTGCTTCAGAGGACCGTGTGTATGCAGGTTAAGGTCGGCATCCGAGTGTTTATGCACACGGGCTTAGGTCTGTGTATGCATGATGTTTGTAGGAGAAGGCGAATGCGACATGTTGGCCAATGTGTTGAGGGTAAAGCTGCCCTCTGGGATAAAGCTGTCCATTATACTGTGTTATTGTTTGTTTTTTTAGATGTATTCTTTGATTCTTGTTATCACTTAGTTGTAGCG +>Pf172_1/1_1.000_246 +CACACACTGACAATAATATATACACACACGCACCCTCATATATTCACACACGCGTACACACATACACACACACGCGTACACGCGTTCACAGATACATATAGGCGTACATACATACATTCGTACACAAACGTATGCATACATACGCAAACAAACGTAAATACACACATGCGCAAATACACACCCACAGACAATCACACAGACAAATACACAGCTTTGACATTCAACCTTTCCTGTCCTGTTTTACGA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/inputs/locus9_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap4_1/1_1.000_160 +CGGCCGCGGCGCGTCGTTCTCAGCCAAGCTGACTTCGACTTGAGCCGTCCATTCGCTTATTTACACGACGACTGCTCGACCCTTTACGACTTAGTCACACTTCCGTTTAACCAGGCCCTGCTACCCTCCAATCTCGTCCAATCGGTCTCTACGCATCCGA +>Pf10_1/1_1.000_160 +CGGCCGCGGCGCGTCGTTCTCAGCCAAGCTGACTTCGACTTGAGCCGTCCATTCGCTTATTTACACGACGACTGCTCGACCCTTTACGACTTAGTCACACTTCCGTTTAACCAGGCCCTGCTACCCTCCAATCTCGTCCAATCGGTCTCTACGCATCCGA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus10_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap21/11000160 +atactcaggcacacagcatttgtcgtactaggcgagagagagagaggaacgactaattgcaaccacgattacgttacatttgtttacaaaccaaacgtactggcgtcgaagataattaagaggaagctgactgaatgcgattggcgttggtctacgggtt +>Pf51/11000160 +atactcaggcacacagcatttgtcgtactaggcgagagagagagaggaacgactaattgcaaccacgattacgttacatttgtttacaaaccaaacgtactggcgtcgaagataattaagaggaagctgactgaatgcgattggcgttggtctacgggtt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus10_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Pf51/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ap21/11000160 atactcaggcacacagcatttgtcgtactaggcgagagagagagaggaacgactaattgcaaccacgattacgttacatttgtttacaaaccaaacgtactggcgtcgaagataattaagaggaagctgactgaatgcgattggcgttggtctacgggtt +Pf51/11000160 atactcaggcacacagcatttgtcgtactaggcgagagagagagaggaacgactaattgcaaccacgattacgttacatttgtttacaaaccaaacgtactggcgtcgaagataattaagaggaagctgactgaatgcgattggcgttggtctacgggtt +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus10_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ap21/11000160 atactcaggcacacagcatttgtcgtactaggcgagagagagagaggaacgactaattgcaaccacgattacgttacatttgtttacaaaccaaacgtactggcgtcgaagataattaagaggaagctgactgaatgcgattggcgttggtctacgggtt +Pf51/11000160 atactcaggcacacagcatttgtcgtactaggcgagagagagagaggaacgactaattgcaaccacgattacgttacatttgtttacaaaccaaacgtactggcgtcgaagataattaagaggaagctgactgaatgcgattggcgttggtctacgggtt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus1_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac71/11000160 +gcacctagaattacccgaagttgcttggcaatagcgacacctaacggtcgccatgatatttgcaggaagaaggcatgtggtaccattgggaaccgtcaagcgtttcctcagccctgtggcagctgcccgtctgcgcccgtgtttgaccttgagcaccaag +>Am31/11000160 +gcacctagaattacccgaagttgcttggcaatagcgacacctaacggtcgccatgatatttgcaggaagaaggcatgtggtaccattgggaaccgtcaagcgtttcctcagccctgtggcagctgcccgtctgcgcccgtgtttgaccttgagcaccaag
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus1_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Am31/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ac71/11000160 gcacctagaattacccgaagttgcttggcaatagcgacacctaacggtcgccatgatatttgcaggaagaaggcatgtggtaccattgggaaccgtcaagcgtttcctcagccctgtggcagctgcccgtctgcgcccgtgtttgaccttgagcaccaag +Am31/11000160 gcacctagaattacccgaagttgcttggcaatagcgacacctaacggtcgccatgatatttgcaggaagaaggcatgtggtaccattgggaaccgtcaagcgtttcctcagccctgtggcagctgcccgtctgcgcccgtgtttgaccttgagcaccaag +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus1_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ac71/11000160 gcacctagaattacccgaagttgcttggcaatagcgacacctaacggtcgccatgatatttgcaggaagaaggcatgtggtaccattgggaaccgtcaagcgtttcctcagccctgtggcagctgcccgtctgcgcccgtgtttgaccttgagcaccaag +Am31/11000160 gcacctagaattacccgaagttgcttggcaatagcgacacctaacggtcgccatgatatttgcaggaagaaggcatgtggtaccattgggaaccgtcaagcgtttcctcagccctgtggcagctgcccgtctgcgcccgtgtttgaccttgagcaccaag
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus1_sp3.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,6 @@ +>Ac51/11000160 +gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +>Am11/11000160 +gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +>Pf71/11000160 +gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus1_sp3.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,11 @@ +#NEXUS +[Aligned to seq Pf71/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=3 nchar=160; +format gap=- datatype=DNA; +matrix +Ac51/11000160 gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +Am11/11000160 gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +Pf71/11000160 gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus1_sp3.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +3 160 +Ac51/11000160 gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +Am11/11000160 gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt +Pf71/11000160 gcaccgggatgcggatttgctgacgatatggcaaaagcattgtcagcgtgcggaacctgtttatgtcacaccactggcatcttcctggccgtcgcagccttcgttctgacggcactcggtattgtctgcgtcacgcgatcagctgacccgagcctttggt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus2_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac61/11000160 +cagcctaccactgagaagagatacttcaacatgtcttactggggtagaagtggtggtcgtacagcgggtggtaatgcaggacgtggtcgtggcggcggcagcggcagtggcagtagtcaaagtggtggtggcagctttctacaggaacgtatcaaagaga +>Am21/11000160 +cagcctaccactgagaagagatacttcaacatgtcttactggggtagaagtggtggtcgtacagcgggtggtaatgcaggacgtggtcgtggcggcggcagcggcagtggcagtagtcaaagtggtggtggcagctttctacaggaacgtatcaaagaga
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus2_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Am21/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ac61/11000160 cagcctaccactgagaagagatacttcaacatgtcttactggggtagaagtggtggtcgtacagcgggtggtaatgcaggacgtggtcgtggcggcggcagcggcagtggcagtagtcaaagtggtggtggcagctttctacaggaacgtatcaaagaga +Am21/11000160 cagcctaccactgagaagagatacttcaacatgtcttactggggtagaagtggtggtcgtacagcgggtggtaatgcaggacgtggtcgtggcggcggcagcggcagtggcagtagtcaaagtggtggtggcagctttctacaggaacgtatcaaagaga +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus2_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ac61/11000160 cagcctaccactgagaagagatacttcaacatgtcttactggggtagaagtggtggtcgtacagcgggtggtaatgcaggacgtggtcgtggcggcggcagcggcagtggcagtagtcaaagtggtggtggcagctttctacaggaacgtatcaaagaga +Am21/11000160 cagcctaccactgagaagagatacttcaacatgtcttactggggtagaagtggtggtcgtacagcgggtggtaatgcaggacgtggtcgtggcggcggcagcggcagtggcagtagtcaaagtggtggtggcagctttctacaggaacgtatcaaagaga
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus3_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac231/11000366 +actgaggctcgaacacaacaaaaaggtgatgagcagtcagcacttaatagaatattacagcaagtagccagtaatgtagttgatgtagcagcattagataatcaaggagtagaccaagttgaatacacagatagagctagacaatacagccataacctgtcatcgtggtgtgctagcacccagaaagtacgaggacctcaacgtctacctgttggcgtagccactccacacacagtcctg +>Ap461/11000217 +---gaggctcgaacacagcaaaaaggtgatgagcagtcagctcttaatagaatattacagcaagtagccagtaatgtagttgatgtagcagcattagataatcaaggagtagatcaagttgagtacacagatagagctagacagtacagccataacctgtcatcatggtgtgctaccacccagaaagtac--------------------------------------------------
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus3_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Ac231/11000366 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=240; +format gap=- datatype=DNA; +matrix +Ac231/11000366 actgaggctcgaacacaacaaaaaggtgatgagcagtcagcacttaatagaatattacagcaagtagccagtaatgtagttgatgtagcagcattagataatcaaggagtagaccaagttgaatacacagatagagctagacaatacagccataacctgtcatcgtggtgtgctagcacccagaaagtacgaggacctcaacgtctacctgttggcgtagccactccacacacagtcctg +Ap461/11000217 ---gaggctcgaacacagcaaaaaggtgatgagcagtcagctcttaatagaatattacagcaagtagccagtaatgtagttgatgtagcagcattagataatcaaggagtagatcaagttgagtacacagatagagctagacagtacagccataacctgtcatcatggtgtgctaccacccagaaagtac-------------------------------------------------- +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus3_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 240 +Ac231/11000366 actgaggctcgaacacaacaaaaaggtgatgagcagtcagcacttaatagaatattacagcaagtagccagtaatgtagttgatgtagcagcattagataatcaaggagtagaccaagttgaatacacagatagagctagacaatacagccataacctgtcatcgtggtgtgctagcacccagaaagtacgaggacctcaacgtctacctgttggcgtagccactccacacacagtcctg +Ap461/11000217 ---gaggctcgaacacagcaaaaaggtgatgagcagtcagctcttaatagaatattacagcaagtagccagtaatgtagttgatgtagcagcattagataatcaaggagtagatcaagttgagtacacagatagagctagacagtacagccataacctgtcatcatggtgtgctaccacccagaaagtac--------------------------------------------------
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus4_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ac81/11000160 +atcaaagaagagcaacatcgagctactggcactggcaatggaatcctaattatagcagaaacaagcactggttgcctgttgtctgggtcagcaattggtagtagaggtgttcctgctgaagaagttggggtcaaagcaggacagatgcttttggataact +>Pf81/11000160 +atcaaagaagagcaacatcgagctactggcactggcaatggaatcctaattatagcagaaacaagcactggttgcctgttgtctgggtcagcaattggtagtagaggtgttcctgctgaagaagttggggtcaaagcaggacagatgcttttggataact
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus4_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Pf81/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ac81/11000160 atcaaagaagagcaacatcgagctactggcactggcaatggaatcctaattatagcagaaacaagcactggttgcctgttgtctgggtcagcaattggtagtagaggtgttcctgctgaagaagttggggtcaaagcaggacagatgcttttggataact +Pf81/11000160 atcaaagaagagcaacatcgagctactggcactggcaatggaatcctaattatagcagaaacaagcactggttgcctgttgtctgggtcagcaattggtagtagaggtgttcctgctgaagaagttggggtcaaagcaggacagatgcttttggataact +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus4_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ac81/11000160 atcaaagaagagcaacatcgagctactggcactggcaatggaatcctaattatagcagaaacaagcactggttgcctgttgtctgggtcagcaattggtagtagaggtgttcctgctgaagaagttggggtcaaagcaggacagatgcttttggataact +Pf81/11000160 atcaaagaagagcaacatcgagctactggcactggcaatggaatcctaattatagcagaaacaagcactggttgcctgttgtctgggtcagcaattggtagtagaggtgttcctgctgaagaagttggggtcaaagcaggacagatgcttttggataact
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus5_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Pf91/11000160 +gtattaataaaaggacaagactattatttaataccaagaaatctggccttaataagcatggttgcttatatcataagcatggtaaatcacattgtgttttccatgtgtttacccatcagatgtaaaaatattctgcatgaaataggtaatttcccgatta +>Am81/11000160 +gtattaataaaaggacaagactattatttaataccaagaaatctggccttaataagcatggttgcttatatcataagcatggtaaatcacattgtgttttccatgtgtttacccatcagatgtaaaaatattctgcatgaaata----------------
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus5_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Pf91/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Pf91/11000160 gtattaataaaaggacaagactattatttaataccaagaaatctggccttaataagcatggttgcttatatcataagcatggtaaatcacattgtgttttccatgtgtttacccatcagatgtaaaaatattctgcatgaaataggtaatttcccgatta +Am81/11000160 gtattaataaaaggacaagactattatttaataccaagaaatctggccttaataagcatggttgcttatatcataagcatggtaaatcacattgtgttttccatgtgtttacccatcagatgtaaaaatattctgcatgaaata---------------- +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus5_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Pf91/11000160 gtattaataaaaggacaagactattatttaataccaagaaatctggccttaataagcatggttgcttatatcataagcatggtaaatcacattgtgttttccatgtgtttacccatcagatgtaaaaatattctgcatgaaataggtaatttcccgatta +Am81/11000160 gtattaataaaaggacaagactattatttaataccaagaaatctggccttaataagcatggttgcttatatcataagcatggtaaatcacattgtgttttccatgtgtttacccatcagatgtaaaaatattctgcatgaaata----------------
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus6_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap31/11000160 +gccatgcagtacactggacttctgttattctgtttgtttgccttgacggcagccaaacccgcggaagaccttcaaatgctcatccgagccctgctccatgaaatagaagaggaaggtgaactccaagagcgaggcattggcgccgtgaagtatggtggaa +>Pf61/11000160 +gccatgcagtacactggacttctgttattctgtttgtttgccttgacggcagccaaacccgcggaagaccttcaaatgctcatccgagccctgctccatgaaatagaagaggaaggtgaactccaagagcgaggcattggcgccgtgaagtatggtggaa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus6_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Pf61/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ap31/11000160 gccatgcagtacactggacttctgttattctgtttgtttgccttgacggcagccaaacccgcggaagaccttcaaatgctcatccgagccctgctccatgaaatagaagaggaaggtgaactccaagagcgaggcattggcgccgtgaagtatggtggaa +Pf61/11000160 gccatgcagtacactggacttctgttattctgtttgtttgccttgacggcagccaaacccgcggaagaccttcaaatgctcatccgagccctgctccatgaaatagaagaggaaggtgaactccaagagcgaggcattggcgccgtgaagtatggtggaa +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus6_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ap31/11000160 gccatgcagtacactggacttctgttattctgtttgtttgccttgacggcagccaaacccgcggaagaccttcaaatgctcatccgagccctgctccatgaaatagaagaggaaggtgaactccaagagcgaggcattggcgccgtgaagtatggtggaa +Pf61/11000160 gccatgcagtacactggacttctgttattctgtttgtttgccttgacggcagccaaacccgcggaagaccttcaaatgctcatccgagccctgctccatgaaatagaagaggaaggtgaactccaagagcgaggcattggcgccgtgaagtatggtggaa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus7_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap11/11000160 +ggtcgccttataaaaaccaatccgaaacagttttcctttgaaacgtgccaaaaaccaaaaacatacttcaaatcttccagtgtctgttataaaggggtgagcgtagagagggcacttgtgagattggtgtctgggttaaagattttgccaaaaagcgatt +>Pf41/11000160 +ggtcgccttataaaaaccaatccgaaacagttttcctttgaaacgtgccaaaaaccaaaaacatacttcaaatcttccagtgtctgttataaaggggtgagcgtagagagggcacttgtgagattggtgtctgggttaaagattttgccaaaaagcgatt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus7_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Pf41/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ap11/11000160 ggtcgccttataaaaaccaatccgaaacagttttcctttgaaacgtgccaaaaaccaaaaacatacttcaaatcttccagtgtctgttataaaggggtgagcgtagagagggcacttgtgagattggtgtctgggttaaagattttgccaaaaagcgatt +Pf41/11000160 ggtcgccttataaaaaccaatccgaaacagttttcctttgaaacgtgccaaaaaccaaaaacatacttcaaatcttccagtgtctgttataaaggggtgagcgtagagagggcacttgtgagattggtgtctgggttaaagattttgccaaaaagcgatt +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus7_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ap11/11000160 ggtcgccttataaaaaccaatccgaaacagttttcctttgaaacgtgccaaaaaccaaaaacatacttcaaatcttccagtgtctgttataaaggggtgagcgtagagagggcacttgtgagattggtgtctgggttaaagattttgccaaaaagcgatt +Pf41/11000160 ggtcgccttataaaaaccaatccgaaacagttttcctttgaaacgtgccaaaaaccaaaaacatacttcaaatcttccagtgtctgttataaaggggtgagcgtagagagggcacttgtgagattggtgtctgggttaaagattttgccaaaaagcgatt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus9_sp2.fasta Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,4 @@ +>Ap41/11000160 +cggccgcggcgcgtcgttctcagccaagctgacttcgacttgagccgtccattcgcttatttacacgacgactgctcgaccctttacgacttagtcacacttccgtttaaccaggccctgctaccctccaatctcgtccaatcggtctctacgcatccga +>Pf101/11000160 +cggccgcggcgcgtcgttctcagccaagctgacttcgacttgagccgtccattcgcttatttacacgacgactgctcgaccctttacgacttagtcacacttccgtttaaccaggccctgctaccctccaatctcgtccaatcggtctctacgcatccga
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus9_sp2.nxs Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,10 @@ +#NEXUS +[Aligned to seq Pf101/11000160 by BlastAlign. We have excluded sequences with more than 95% gaps] +BEGIN DATA; +dimensions ntax=2 nchar=160; +format gap=- datatype=DNA; +matrix +Ap41/11000160 cggccgcggcgcgtcgttctcagccaagctgacttcgacttgagccgtccattcgcttatttacacgacgactgctcgaccctttacgacttagtcacacttccgtttaaccaggccctgctaccctccaatctcgtccaatcggtctctacgcatccga +Pf101/11000160 cggccgcggcgcgtcgttctcagccaagctgacttcgacttgagccgtccattcgcttatttacacgacgactgctcgaccctttacgacttagtcacacttccgtttaaccaggccctgctaccctccaatctcgtccaatcggtctctacgcatccga +; +end; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/outputs/locus9_sp2.phy Wed Sep 27 10:02:43 2017 -0400 @@ -0,0 +1,3 @@ +2 160 +Ap41/11000160 cggccgcggcgcgtcgttctcagccaagctgacttcgacttgagccgtccattcgcttatttacacgacgactgctcgaccctttacgacttagtcacacttccgtttaaccaggccctgctaccctccaatctcgtccaatcggtctctacgcatccga +Pf101/11000160 cggccgcggcgcgtcgttctcagccaagctgacttcgacttgagccgtccattcgcttatttacacgacgactgctcgaccctttacgacttagtcacacttccgtttaaccaggccctgctaccctccaatctcgtccaatcggtctctacgcatccga
--- a/test-data/test_05.out Thu Apr 13 09:47:31 2017 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,151 +0,0 @@ - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus1_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Am31/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus2_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Am21/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus3_sp2.fasta has 2 sequences and is 625 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1341) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 240 by aligning to sequence Ac231/11000366 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus4_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf81/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus5_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf91/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus6_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf61/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus7_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf41/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus8_sp2.fasta has 2 sequences and is 590 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1380) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus9_sp2.fasta has 2 sequences and is 361 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1765) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf101/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus10_sp2.fasta has 2 sequences and is 360 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 160 by aligning to sequence Pf51/11000160 (percentage of gaps in each sequence is less than 95%) - - -************************ BlastAlign ************************ - -This program takes nucleotide sequences in fasta format and returns a multiple alignment (in Nexus & Phylip formats) using BLASTN - - -Will exclude sequences where gaps make up more than 95% of the sequence in the final alignment - -Input file ./locus1_sp3.fasta has 3 sequences and is 540 bytes -(maximum number of sequences that will be used to search for the reference sequence is 1767) - - -BlastAlign finished: it has produced a multiple alignment of 3 sequences and length 160 by aligning to sequence Pf71/11000160 (percentage of gaps in each sequence is less than 95%) -