Mercurial > repos > abims-sbr > blastalign

--- a/BlastAlign.xml	Wed Sep 27 10:02:43 2017 -0400
+++ b/BlastAlign.xml	Wed Jan 17 08:55:00 2018 -0500
@@ -34,9 +34,9 @@
         #end if
         &&
         ln -s '$input.element_identifier'".fasta.phy" out.phy &&
-        ln -s '$input.element_identifier'".fasta.nxs" out.nxs &&
+        ln -s '$input.element_identifier'".fasta.nxs" out.nxs
         #if $fasta_out.value == True
-            python $__tool_directory__/scripts/S01_phylip2fasta.py out.phy out.fasta
+            && python $__tool_directory__/scripts/S01_phylip2fasta.py out.phy out.fasta
         #end if

     ]]></command>
@@ -55,9 +55,9 @@
     </inputs>

     <outputs>
-        <data format="phy" name="phy" from_work_dir="out.phy" label="Alignment of ${input.name} in phylip" />
-        <data format="nxs" name="nxs" from_work_dir="out.nxs" label="Alignment of ${input.name} in nexus" />
-        <data format="fasta" name="fasta" from_work_dir="out.fasta" label="Alignment of ${input.name} in fasta">
+        <data format="phylip" name="phy" from_work_dir="out.phy" label="Alignment of ${input.name} in phylip" hidden="True"/>
+        <data format="nexus" name="nxs" from_work_dir="out.nxs" label="Alignment of ${input.name} in nexus" hidden="True"/>
+        <data format="fasta" name="fasta" from_work_dir="out.fasta" label="Alignment of ${input.name} in fasta" hidden="True">
             <filter>fasta_out == True</filter>
         </data>
     </outputs>
@@ -91,88 +91,94 @@
             <output name="nxs" value="outputs/locus1_sp3.nxs" />
             <output name="fasta" value="outputs/locus1_sp3.fasta" />
         </test>
+        <test>
+            <param name="input" ftype="fasta" value="inputs/locus3_sp2.fasta" />
+            <section name="advanced_option">
+                <param name="m" value="95" />
+                <param name="r" value="" />
+                <param name="x" value="" />
+                <param name="n" value="False" />
+                <param name="s" value="0" />
+            </section>
+            <param name="fasta_out" value="False" />
+            <output name="phy" value="outputs/locus3_sp2.phy" />
+            <output name="nxs" value="outputs/locus3_sp2.nxs" />
+        </test>
+        <test>
+            <param name="input" ftype="fasta" value="inputs/locus8_sp2.fasta" />
+            <section name="advanced_option">
+                <param name="m" value="95" />
+                <param name="r" value="" />
+                <param name="x" value="" />
+                <param name="n" value="False" />
+                <param name="s" value="0" />
+            </section>
+            <param name="fasta_out" value="True" />
+            <output name="phy" value="outputs/locus8_sp2.phy" />
+            <output name="nxs" value="outputs/locus8_sp2.nxs" />
+            <output name="fasta" value="outputs/locus8_sp2.fasta" />
+        </test>

         <!--locus10_sp2.fasta    locus1_sp3.fasta  locus2_sp2.fasta  locus3_sp2.fasta  locus4_sp2.fasta  locus5_sp2.fasta  locus6_sp2.fasta  locus7_sp2.fasta  locus8_sp2.fasta  locus9_sp2.fasta-->
     </tests>

     <help>
+    <![CDATA[
+
+. class:: infomark
+
+**Authors**  BlastAlign has been written by Robert Belshaw and Aris Katzourakis. The scripts of this tool have been written by Eric Fontanillas.

 .. class:: infomark

-**Authors**  The script in perl was written by **Robert Belshaw** and **Aris Katzourakis**.
-
-@HELP_AUTHORS@
+**Galaxy integration** Julie Baffard and ABiMS Team.

-============
-What it does
-============
-
-| This tool takes **nucleic sequences in fasta format** or **'dataset collection list' containing fasta files** and returns a multiple alignement (in Nexus and Phylip formats) using BLAST+
-|
+Contact support.abims@sb-roscoff.fr for any questions or concerns about the Galaxy implementation of this tool.

 --------

-==========
-Parameters
-==========
+**Description**
+
+BlastAlign takes a set of nucleic sequences in a file in fasta format and returns a multiple alignment (in Nexus and Phylip formats) using BLAST+. This Galaxy implementation works with dataset collections, which allows multiple parallels runs of BlastAlign at once on many files.
+
+--------
+
+**Parameters**

 The choice of several parameters for the blast is possible.

-**-m [maximum proportion of gaps allowed in any one sequence in the final alignement]**
-    | integer (between 0 and 100)
-    | By default : 95%, i.e. only removes sequences with extremely short matches.
-    | We find 50 the most useful.
-    |
-
-**-r [name of reference sequence]**
-    | text
-    | Default is searching for best candidate.
-    | If entered, the sequence will be extracted, written to a separate file, and blasted against the original input file.
-    |
+**-m : Proportion of gaps allowed in any one sequence in the final alignement**
+    integer (between 0 and 100).
+    By default : 95%, i.e. only removes sequences with extremely short matches.
+    We find 50 the most useful.

-**-x [name of comma-separated sequences to be excluded from this analysis]**
-    | text
-    |
+**-r : Name of reference sequence**
+    text.
+    Default is searching for best candidate.
+    If entered, the sequence will be extracted, written to a separate file, and blasted against the original input file.
+
+ **-x : Name of sequences to be excluded from the analysis**
+    text.
+    names must be comma-separated.

-**-n**
-    | If it's checked : retain original names in output files.
-    | If isn't checked : to output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the tool.
-    |
+ **-n**
+    If checked : retain original names in output files.
+    If not checked : output the 15 character name abbreviations (stripped of potentially problematic characters) that is used in the tool.
+    Default : checked.

-**-s [number of sequences to be used in initial search for reference sequence]**
-    | integer (between 0 and total number of sequences)
-    | Default is finding the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large.
+**-s : Number of sequences to be used in initial search for reference sequence**
+    integer (between 0 and total number of sequences).
+    Default : 0
+    Default is finding the reference sequence by blasting all sequences against all sequences, only randomly subsampling when it thinks the blast output file might be too large.

 --------

-=======
-Outputs
+<<<<<<< HEAD
+**Outputs**
+
+    - 'Alignment_{input.name}_phylip' :
+        the aligned sequences in Phylip format.
 =======
-
-This tool, produces the following files :
-
-**Alignment**
-    | is the output with important informations.
-    | when the alignment failed with BlastAlign, the name of the file is writting down this output.
-    |
-
-**Alignement_file_failed**
-    | is the output containing the files failed during the run of BlastAlign.
-    |
-
-**Alignment_{inputfile}_phylip**
-    | is the output with the aligned sequences in Phylip format.
-    |
-
-**Alignment_{inputfile}_nexus**
-    | is the output with the aligned sequences in Nexus format.
-    |
-
-**Alignment_{input_file}_fasta**
-    | is the output with the aligned sequences in Fasta format.
-
---------
-
 ===============
 Working Example
 ===============
@@ -215,67 +221,16 @@
 |
 |
 | BlastAlign finished: it has produced a multiple alignment of 2 sequences and length 720 by aligning to sequence Pf2101/11000920 (proportion of gaps in each sequence is less than 0.95)
-|
-
-**Alignment_{inputfile}_phylip**
-
-| 2 720 S
-| Pf2101/1100 ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagat
-
-gacaagaaactgcaaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaag
-tttaacaaacttgaagaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtaga
-tttgtccagacctggcttgtttgacattgcttgttggattttgcaacaatatcatgattaga
-
-| Pp171/11000 ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagag
-| tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaact
-| ggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt----------------------------------------------
-| -------------
-|
-
-
-**Alignment_{inputfile}_nexus**
-
-| #NEXUS
-
-[Aligned to seq Pf2101/1100  by BlastAlign. We have excluded sequences with more than 0.95 gaps]
-
-BEGIN DATA;
-
-| dimensions ntax=2 nchar=720;
-| format gap=- datatype=DNA;
-| matrix
+|
+>>>>>>> blastalign bug fix but with no file renaming

-Pf2101/1100 ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagat
-gacaagaaactgcaaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaag
-tttaacaaacttgaagaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtaga
-tttgtccagacctggcttgtttgacattgcttgttggattttgcaacaatatcatgattaga
-
-| Pp171/11000 ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagag
-| tacattaaaaaaactagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaac
-| tggctacatccgtgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt--------------------------------------------
-| -------------
-| ;
-| end;
-|
-
-
-**Alignment_{inputfile}_fasta**
+    - 'Alignment_{input.name}_nexus' :
+       the aligned sequences in Nexus format.

-| &gt;Pf2101/11000920
-
-ccggtggccattttctgcacctcgtgggttattgagctgaaagtggttcagctcactgtctgttaacagccgtgtcggtctgagggtatcacagttaatataatgaatcaagagaagttgaagcagctccaggcccaagtccgcatcggaggaaagggcacagcaagaagaaagaagaaggtgattcacagaacagcaacaacagatgacaagaaactg
-caaagtacactgaagaaattggcagtaaataatattccgggtatagaagaggttaacatgataaaggatgacgggcaagtaatacattttaccaatccgaaggtgcaggcttctcttcagtcaaacacatttgccattaatggccaagccgaaacgaaacaaatcactgacttgctacccggtatattaaatcagctgggggctgaaagtttaacaaacttgaa
-gaagctggctaaatctgtgactgctggagttgattctgataacaagcaggatgcagcagatattgatgaagatgatgatgatgtcccagaactggttgaaaactttgacgaagcatcgaagaatgaggggacgtaattcttctcccactttatgccatggtagcatcaatcgttttgctgatgatggcgtgtttatacctaccacccagtgtagatttgtccagacctggc
-ttgtttgacattgcttgttggattttgcaacaatatcatgattaga
+    - 'Alignment_{input_file}_fasta' :
+        the aligned sequences in Fasta format if the option "fasta format" is checked.

-| &gt;Pp171/11000930
-
-ccggtggccattttctgcacctcgtgggt-------------------------------------------------------------------aatacaatgaaccaagaaaaattaaaacaactccaagcccaggtgcgcattggaggcaagggtacagcaagaagaaagaagaaggtcattcatagaacagcaacaacagatgataaaaaactgcagagtacattaaaaaa
-actagcagtaaataatattccaggtatagaagaggttaatatgataaaagatgatggacaggtaatacattttaccaatccaaaagtacaggcttctctacagtcaaacacatttgctattaatgggcaagctgagacaaaacaaatcaccgaattgttgcctggtatattaaatcagctgggagcagaaagtttaacaaatctgaagaaactggctacatccg
-tgactggtggagttgattctgataacaagccagaaacagcagaaattgatgaagacgatgatgatgttccagatttggttgaaaactttgacgaggcatccaagaatgaaggaacgtaatt-----------------------------------------------------------------acccagtgtagatttgt---------------------------------------------------------
-
-
----------------------------------------------------
+---------

 Changelog
 ---------
@@ -284,16 +239,16 @@

  - NEW: BlastAlign will now be launched on one file at once. Although, it will manage a Dataset Collection to deal with numerous files.

-
 **Version 1.0 - 13/04/2017**

  - TEST: Add funtional test with planemo
-
  - IMPROVEMENT: Use conda dependencies for blastalign, blast-legacy, perl, python

+    ]]>

     </help>

     <expand macro="citations" />

 </tool>
+
--- a/scripts/S01_phylip2fasta.py	Wed Sep 27 10:02:43 2017 -0400
+++ b/scripts/S01_phylip2fasta.py	Wed Jan 17 08:55:00 2018 -0500
@@ -6,14 +6,19 @@
 ## DESCRIPTION: formatting a fasta format into phylip format for using with PAML

 import string, os, sys
-
+"""
 if len(sys.argv) == 1:
     print "put arguments!!"
-    print "USAGE: $T4S02_phylip2fasta.py INPUT OUTPUT"
-
+    print "USAGE: S01_phylip2fasta.py INPUT OUTPUT"
+"""

 ## INPUT
-f1 = sys.argv[1]
+if os.path.isfile(sys.argv[1]) :
+    f1 = sys.argv[1]
+else:
+    print "No existing phylip file ; exiting ..."
+    exit()
+
 F1 = open("%s" %f1, 'r')

 ## OUTPUT