# HG changeset patch # User yhoogstrate # Date 1470212248 14400 # Node ID 44330a54b8eb1ef3b709481f1fd5057de03c9f7e # Parent 1c6654ab24926f96acaed9b4d28094d2589a24db planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit b97b90c692604239ed6e9423655c6c5d05798b32-dirty diff -r 1c6654ab2492 -r 44330a54b8eb macros.xml --- a/macros.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/macros.xml Wed Aug 03 04:17:28 2016 -0400 @@ -1,5 +1,5 @@ - smf-v1.6-5_utils-v2.0.1 + smf-v1.6-5_utils-v2.1.0 @@ -17,7 +17,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils ]]> C/D-box_snoRNA +GCUCUGACCGAAAGGCGUGAUGAGC diff -r 1c6654ab2492 -r 44330a54b8eb test-data/test_23.fixed.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_23.fixed.fa Wed Aug 03 04:17:28 2016 -0400 @@ -0,0 +1,2 @@ +>Artificial_double_C/D_K-turn_construct +GGGAGUCUUGUGAUGAGAAGUACUGGAUCUGAAGUAGCCCUUUUUGGGCUACUUGUGAUGAAACACUCAUGGUCUGAAGACUCCC diff -r 1c6654ab2492 -r 44330a54b8eb tool_dependencies.xml --- a/tool_dependencies.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/tool_dependencies.xml Wed Aug 03 04:17:28 2016 -0400 @@ -1,7 +1,7 @@ - + @@ -18,7 +18,7 @@ - - + + diff -r 1c6654ab2492 -r 44330a54b8eb utils_add-read-counts.xml --- a/utils_add-read-counts.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/utils_add-read-counts.xml Wed Aug 03 04:17:28 2016 -0400 @@ -10,7 +10,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils diff -r 1c6654ab2492 -r 44330a54b8eb utils_estimate-energy.xml --- a/utils_estimate-energy.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/utils_estimate-energy.xml Wed Aug 03 04:17:28 2016 -0400 @@ -10,7 +10,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils segmentation-fold diff -r 1c6654ab2492 -r 44330a54b8eb utils_extract-boxed-sequences.xml --- a/utils_extract-boxed-sequences.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/utils_extract-boxed-sequences.xml Wed Aug 03 04:17:28 2016 -0400 @@ -10,7 +10,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils diff -r 1c6654ab2492 -r 44330a54b8eb utils_filter-annotated-entries.xml --- a/utils_filter-annotated-entries.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/utils_filter-annotated-entries.xml Wed Aug 03 04:17:28 2016 -0400 @@ -10,7 +10,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils diff -r 1c6654ab2492 -r 44330a54b8eb utils_filter-by-energy.xml --- a/utils_filter-by-energy.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/utils_filter-by-energy.xml Wed Aug 03 04:17:28 2016 -0400 @@ -10,7 +10,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils diff -r 1c6654ab2492 -r 44330a54b8eb utils_find-boxes.xml --- a/utils_find-boxes.xml Thu Jul 28 09:29:52 2016 -0400 +++ b/utils_find-boxes.xml Wed Aug 03 04:17:28 2016 -0400 @@ -10,7 +10,7 @@ numpy pysam htseq - segmentation-fold-utils + segmentation-fold-utils diff -r 1c6654ab2492 -r 44330a54b8eb utils_fix-fasta-headers.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/utils_fix-fasta-headers.xml Wed Aug 03 04:17:28 2016 -0400 @@ -0,0 +1,59 @@ + + Replaces all spaces with underscores in the ">.."-sequence headers of a FASTA file + + + macros.xml + + + + python + numpy + pysam + htseq + segmentation-fold-utils + + + + + @VERSION_COMMAND_UTILS@ + + + + + + + + + + + + + + + + + + + + + + + + + .."-sequence headers of a FASTA file for compatibility with pysam indexing. + ]]> + + +