# HG changeset patch # User yhoogstrate # Date 1438500459 14400 # Node ID 3125baf6e70525b82766ed218228ef2161e240d3 planemo upload for repository https://github.com/ErasmusMC-Bioinformatics/segmentation_fold_galaxy_wrapper commit b37cb65736e2a6e76b94a9fa12a5887046437e36 diff -r 000000000000 -r 3125baf6e705 README.rst --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/README.rst Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,31 @@ +Segmentation-fold wrapper for Galaxy +==================================== + +https://github.com/yhoogstrate/segmentation-fold + +Segmentation-fold: An algorithm for predicting RNA 2D structures including K-turns + +Development +----------- + +* Repository-Maintainer: Youri Hoogstrate +* Repository-Developers: Youri Hoogstrate + +* Repository-Development: https://github.com/ErasmusMC-Bioinformatics/galaxy-tools + +The tool wrapper has been written by Youri Hoogstrate as MSc research +assignment at Technical University of Delft and University of Leiden. + +License +------- + +**segmentation-fold** and **wrapper**: + +GPL (>=3) + +References +---------- +Segmentaton-fold was formerly known as yh-kt-fold and the corresponding +thesis can be found at the following url: + +https://yh-kt-fold.googlecode.com/files/Report.pdf diff -r 000000000000 -r 3125baf6e705 segmentation-fold.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/segmentation-fold.xml Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,210 @@ + + RNA-Folding including predefined segments including K-turns + + + segmentation-fold + + + + + segmentation-fold -V | head -n 2 | tail -n 1 | sed -e 's/^[[:space:]]*//' -e 's/[[:space:]]*$//' + + $output_dbn + ]]> + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + @mastersthesis{mastersthesis, + author = {Youri Hoogstrate}, + title = {An algorithm for predicting RNA 2D structures including K-turns}, + school = {University of Technology Delft, Leiden University}, + year = 2012, + address = {}, + month = 11, + note = {Research assignment for Master Computer-science}, + url = { https://yh-kt-fold.googlecode.com/files/Report.pdf } + } + + + diff -r 000000000000 -r 3125baf6e705 test-data/test_01.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_01.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 34bp, dE: -32.2572 kcal/mole +CCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGG +((((((((((((.......)))...))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_01.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_01.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-7 +CCAUGGGGAGCCGCACGGAGGCGAAGAACCAUGG diff -r 000000000000 -r 3125baf6e705 test-data/test_02.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_02.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 34bp, dE: -34.4572 kcal/mole +CCAGGGGGAGCCGGUAGCGGGCGUGGAUCCCUGG +((((((((((((..(...))))...))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_02.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_02.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-7 +CCAGGGGGAGCCGGUAGCGGGCGUGGAUCCCUGG diff -r 000000000000 -r 3125baf6e705 test-data/test_03.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_03.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 35bp, dE: -31.2572 kcal/mole +CGUCGGUAAGGUGAUAUGAACCGUUAUAACCGGCG +((((((((((((..(...)))))....)))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_03.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_03.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-7 +CGUCGGUAAGGUGAUAUGAACCGUUAUAACCGGCG diff -r 000000000000 -r 3125baf6e705 test-data/test_04.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_04.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 34bp, dE: -30.4872 kcal/mole +CCCCGACGAGCUGGAGAUACCCUUUGACUCGGGG +((((((((((..((.....)))...))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_04.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_04.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-7 +CCCCGACGAGCUGGAGAUACCCUUUGACUCGGGG diff -r 000000000000 -r 3125baf6e705 test-data/test_05.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_05.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 47bp, dE: -42.9072 kcal/mole +CCCAUCAGCUAGUUGGUGGGGUAAUGGCCCACCAAGGCGACGACGGG +((((.(((((..(((((.((((....))))))))))))...)))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_05.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_05.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 16S rRNA containing Kt-11 +CCCAUCAGCUAGUUGGUGGGGUAAUGGCCCACCAAGGCGACGACGGG diff -r 000000000000 -r 3125baf6e705 test-data/test_06.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_06.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 47bp, dE: -41.3572 kcal/mole +GGGAUUAGCUAGUAGGUGGGGUAACGGCUCACCUAGGCGACGAUCCC +((((.(((((..((((((.(((....))))))))))))...)))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_06.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_06.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 16S rRNA containing Kt-11 +GGGAUUAGCUAGUAGGUGGGGUAACGGCUCACCUAGGCGACGAUCCC diff -r 000000000000 -r 3125baf6e705 test-data/test_07.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_07.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 31bp, dE: -28.7072 kcal/mole +AACCGAAGCCCUCACGGGCAAUGUGGUGUCA +.((((.(((((....))))...))))).... diff -r 000000000000 -r 3125baf6e705 test-data/test_07.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_07.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-15 +AACCGAAGCCCUCACGGGCAAUGUGGUGUCA diff -r 000000000000 -r 3125baf6e705 test-data/test_08.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_08.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 37bp, dE: -33.7572 kcal/mole +UUCCCGGAGUAGCGGUGAAAUGCGCAGAUACCGGGAG +((((((((((((((.(...))))...))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_08.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_08.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 16S rRNA containing Kt-23 +UUCCCGGAGUAGCGGUGAAAUGCGCAGAUACCGGGAG diff -r 000000000000 -r 3125baf6e705 test-data/test_09.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_09.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 37bp, dE: -30.8072 kcal/mole +UUCCAGGUGUAGCGGUGAAAUGCGUAGAGAUCUGGAG +((((((((((((((.(...))))...))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_09.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_09.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 16S rRNA containing Kt-23 +UUCCAGGUGUAGCGGUGAAAUGCGUAGAGAUCUGGAG diff -r 000000000000 -r 3125baf6e705 test-data/test_10.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_10.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 109bp, dE: -82.9072 kcal/mole +CUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUGUGUCCGCCUCCGAGAGGAGUCGGCACACCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGG +((((((((((((.(((((((((((.((((.(((....))))).)).))))).(((.(((((.((((....))))..)))))...))))))))))))....))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_10.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_10.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-38 +CUCCGCCGAGGUAGUCUGUGAGGUAGAGCGACCGAUUGGUGUGUCCGCCUCCGAGAGGAGUCGGCACACCUGUCAAACUCCAAACUUACAGACGCCGUUUGACGCGGGG diff -r 000000000000 -r 3125baf6e705 test-data/test_11.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_11.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 53bp, dE: -49.0072 kcal/mole +GGUGGUCUCGAGCCCUAGACAGCCGGUUUUUUCCGGCCGAGGUUUGAGGCGCC +(((.((((((((((...((.((((((......))))))))))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_11.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_11.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-42 +GGUGGUCUCGAGCCCUAGACAGCCGGUUUUUUCCGGCCGAGGUUUGAGGCGCC diff -r 000000000000 -r 3125baf6e705 test-data/test_12.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_12.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 53bp, dE: -51.5072 kcal/mole +GGAUGUGGCGCCGCGAAGACAGCCAGUUUUUUCUGGUCGAGUGGCGCCGCGCC +((.(((((((((((...((.((((((......))))))))))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_12.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_12.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-42 +GGAUGUGGCGCCGCGAAGACAGCCAGUUUUUUCUGGUCGAGUGGCGCCGCGCC diff -r 000000000000 -r 3125baf6e705 test-data/test_13.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_13.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 53bp, dE: -44.8072 kcal/mole +GGAUGUGUCGUCGCAUAGACAGCCAGUUUUUUCUGGUCGAGUGACGAUGCGCC +((.(((((((((((...((.((((((......))))))))))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_13.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_13.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-42 +GGAUGUGUCGUCGCAUAGACAGCCAGUUUUUUCUGGUCGAGUGACGAUGCGCC diff -r 000000000000 -r 3125baf6e705 test-data/test_14.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_14.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 53bp, dE: -39.2072 kcal/mole +CGAUGUGGGAAGGCCCAGACAGCCAGUUUUUUCUGGUCGAGUCGGCCUGCGCG +((.((..((..(((...((.((((((......)))))))))))..))..)))) diff -r 000000000000 -r 3125baf6e705 test-data/test_14.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_14.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-42 +CGAUGUGGGAAGGCCCAGACAGCCAGUUUUUUCUGGUCGAGUCGGCCUGCGCG diff -r 000000000000 -r 3125baf6e705 test-data/test_15.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_15.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 49bp, dE: -37.8572 kcal/mole +CUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUG +(.((((((((...(((((((((((....))))))))))))))))))).) diff -r 000000000000 -r 3125baf6e705 test-data/test_15.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_15.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-46 +CUCUAAUUGGAUGGAAGUAGGGGUGAAAACUCCUAUGGACCGAUUAGUG diff -r 000000000000 -r 3125baf6e705 test-data/test_16.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_16.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 50bp, dE: -44.4072 kcal/mole +UUCCCGAUGCCGAUGAAGGCCGACCCGCGAGGCGGCUGGAGGUAAGGGAA +(((((..((((...((((((((.((.....)))))))))))))).))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_16.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_16.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-46 +UUCCCGAUGCCGAUGAAGGCCGACCCGCGAGGCGGCUGGAGGUAAGGGAA diff -r 000000000000 -r 3125baf6e705 test-data/test_17.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_17.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 49bp, dE: -38.8072 kcal/mole +UUCAGUCCGCGGUGAAGCCAUACCGGAAGGAGUGGUGGAGCCGACUGAA +(((((((.((...((((((((.((....)).)))))))))).))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_17.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_17.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-46 +UUCAGUCCGCGGUGAAGCCAUACCGGAAGGAGUGGUGGAGCCGACUGAA diff -r 000000000000 -r 3125baf6e705 test-data/test_18.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_18.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 50bp, dE: -37.7072 kcal/mole +UUCUGUAAGCCUGCGAAGGUGUGCUGUGAGGCAUGCUGGAGGUAUCAGAA +(((((.(.(((...(((((((((((....)))))))))))))).)))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_18.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_18.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-46 +UUCUGUAAGCCUGCGAAGGUGUGCUGUGAGGCAUGCUGGAGGUAUCAGAA diff -r 000000000000 -r 3125baf6e705 test-data/test_19.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_19.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 30bp, dE: -29.8572 kcal/mole +UCCGUGGAAGCCGUAAUGGCAGGAAGCGGA +((((((((.((((...))))..)))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_19.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_19.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial 23S rRNA containing Kt-58 +UCCGUGGAAGCCGUAAUGGCAGGAAGCGGA diff -r 000000000000 -r 3125baf6e705 test-data/test_20.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_20.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 22bp, dE: -23.2072 kcal/mole +GCCAAUGAGGUUUAUCCGAGGC +(((...((((.....))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_20.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_20.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial U4 snRNA (small) +GCCAAUGAGGUUUAUCCGAGGC diff -r 000000000000 -r 3125baf6e705 test-data/test_21.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_21.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 34bp, dE: -30.6072 kcal/mole +ACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGU +(((((.(((...(((((....))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_21.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_21.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Partial U4 snRNA (large) +ACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGU diff -r 000000000000 -r 3125baf6e705 test-data/test_22.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_22.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 25bp, dE: -24.4072 kcal/mole +GCUCUGACCGAAAGGCGUGAUGAGC +(((((((((....))...))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_22.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_22.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>C/D-box snoRNA +GCUCUGACCGAAAGGCGUGAUGAGC diff -r 000000000000 -r 3125baf6e705 test-data/test_23.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_23.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 85bp, dE: -70.7144 kcal/mole +GGGAGUCUUGUGAUGAGAAGUACUGGAUCUGAAGUAGCCCUUUUUGGGCUACUUGUGAUGAAACACUCAUGGUCUGAAGACUCCC +((((((((...(((((((.((...(..(((((((((((((.....))))))))...)))))..)))))....))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_23.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_23.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>Artificial double C/D K-turn construct +GGGAGUCUUGUGAUGAGAAGUACUGGAUCUGAAGUAGCCCUUUUUGGGCUACUUGUGAUGAAACACUCAUGGUCUGAAGACUCCC diff -r 000000000000 -r 3125baf6e705 test-data/test_24.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_24.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 34bp, dE: -29.0072 kcal/mole +GGACGCAGAGAUGGUCUUUUUGACCGGAGUGUCC +((((((...(((((((.....))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_24.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_24.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>L30e pre-mRNA +GGACGCAGAGAUGGUCUUUUUGACCGGAGUGUCC diff -r 000000000000 -r 3125baf6e705 test-data/test_25.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_25.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 26bp, dE: -24.7072 kcal/mole +GGUGGAGGGACUGGCCCGAUGAAACC +(((((((((.....)))...)))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_25.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_25.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>SAM riboswitch operon +GGUGGAGGGACUGGCCCGAUGAAACC diff -r 000000000000 -r 3125baf6e705 test-data/test_26.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_26.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 55bp, dE: -43.9072 kcal/mole +GGGAGUAAAGAUUGAGACAAGUAGGACUUCGGUCCGAAUACACUCAUGAACUCCC +((((((...(((((((....(((((((....))))...))).))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_26.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_26.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>T box +GGGAGUAAAGAUUGAGACAAGUAGGACUUCGGUCCGAAUACACUCAUGAACUCCC diff -r 000000000000 -r 3125baf6e705 test-data/test_27.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_27.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 36bp, dE: -26.2072 kcal/mole +AACAAUGAUGAAUGGGUUUUUUACUCAUUUUGAGUU +(((...(((((((((((.....)))))))))))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_27.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_27.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>c-di-GMP-II aptamer +AACAAUGAUGAAUGGGUUUUUUACUCAUUUUGAGUU diff -r 000000000000 -r 3125baf6e705 test-data/test_28.dbn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_28.dbn Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,3 @@ +>Sequence length: 26bp, dE: -24.7072 kcal/mole +GGUGAAGGGACUGGCCCGACGAAACC +(((((((((.....)))...)))))) diff -r 000000000000 -r 3125baf6e705 test-data/test_28.fa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_28.fa Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,2 @@ +>G2nA SAM riboswitch +GGUGAAGGGACUGGCCCGACGAAACC diff -r 000000000000 -r 3125baf6e705 tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Sun Aug 02 03:27:39 2015 -0400 @@ -0,0 +1,6 @@ + + + + + +