Mercurial > repos > willmclaren > ensembl_vep
diff variant_effect_predictor/Bio/Tools/Run/StandAloneBlast.pm @ 0:21066c0abaf5 draft
Uploaded
author | willmclaren |
---|---|
date | Fri, 03 Aug 2012 10:04:48 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/variant_effect_predictor/Bio/Tools/Run/StandAloneBlast.pm Fri Aug 03 10:04:48 2012 -0400 @@ -0,0 +1,905 @@ +# $Id: StandAloneBlast.pm,v 1.23.2.3 2003/03/29 20:18:51 jason Exp $ +# +# BioPerl module for Bio::Tools::StandAloneBlast +# +# Cared for by Peter Schattner +# +# Copyright Peter Schattner +# +# You may distribute this module under the same terms as perl itself + +# POD documentation - main docs before the code + +=head1 NAME + +Bio::Tools::Run::StandAloneBlast - Object for the local execution of the +NCBI Blast program suite (blastall, blastpgp, bl2seq) + +=head1 SYNOPSIS + +Local-blast "factory object" creation and blast-parameter initialization: + + @params = ('database' => 'swissprot','outfile' => 'blast1.out', + '_READMETHOD' => 'Blast'); + + $factory = Bio::Tools::Run::StandAloneBlast->new(@params); + +Blast a sequence against a database: + + $str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta' ); + $input = $str->next_seq(); + $input2 = $str->next_seq(); + $blast_report = $factory->blastall($input); + +Run an iterated Blast (psiblast) of a sequence against a database: + + $factory->j(3); # 'j' is blast parameter for # of iterations + $factory->outfile('psiblast1.out'); + $factory = Bio::Tools::Run::StandAloneBlast->new(@params); + $blast_report = $factory->blastpgp($input); + +Use blast to align 2 sequences against each other: + + $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out'); + $factory->bl2seq($input, $input2); + +Various additional options and input formats are available. See the +DESCRIPTION section for details. + +=head1 DESCRIPTION + +This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast: - a +Bioperl object for running the NCBI standAlone BLAST package. Blast, +itself, is a large & complex program - for more information regarding +BLAST, please see the BLAST documentation which accompanies the BLAST +distribution. BLAST is available from ftp://ncbi.nlm.nih.gov/blast/. + +(A source of confusion in documenting a BLAST interface is that the +term "program" is used in - at least - three different ways in the +BLAST documentation. In this DESCRIPTION, "program" will refer to the +BLAST routine set by BLAST's C<-p> parameter that can be set to blastn, +blastp, tblastx etc. We will use the term Blast "executable" to refer +to the various different executable files that may be called - ie +blastall, blastpgp or bl2seq. In addition, there are several BLAST +capabilities (which are also referred to as "programs") and are +implemented by using specific combinations of BLAST executables, +programs and parameters. They will be referred by their specific +names - eg PSIBLAST and PHIBLAST. ) + +StandAloneBlast has been tested so far only under Linux. I expect +that it should also work under other Unix systems. However, since the +module is implemented using (unix) system calls, modification may be +necessary before StandAloneBlast would work under non-Unix +operating systems (eg Windows, MacOS). Before running +StandAloneBlast it is necessary: to install BLAST on your system, +to edit set the environmental variable $BLASTDIR or your $PATH +variable to point to the BLAST directory, and to ensure that users +have execute privileges for the BLAST program. If the databases +which will be searched by BLAST are located in the data subdirectory +of the blast program directory (the default installation location), +StandAloneBlast will find them; however, if the database files are +located in any other location, environmental variable $BLASTDATADIR +will need to be set to point to that directory. + +The use of the StandAloneBlast module is as follows: Initially, a +local blast "factory object" is created. The constructor may be passed +an optional array of (non-default) parameters to be used by the +factory, eg: + + @params = ('program' => 'blastn', 'database' => 'ecoli.nt'); + $factory = Bio::Tools::Run::StandAloneBlast->new(@params); + +Any parameters not explicitly set will remain as the defaults of the +BLAST executable. Note each BLAST executable has somewhat different +parameters and options. See the BLAST Documentation for a description +or run the BLAST executable from the command line followed solely with +a "-" to see a list of options and default values for that executable; +eg E<gt>blastall -. + +BLAST parameters can be changed and/or examined at any time after the +factory has been created. The program checks that any +parameter/switch being set/read is valid. Except where specifically +noted, StandAloneBlast uses the same single-letter, case-sensitive +parameter names as the actual blast program. Currently no checks are +included to verify that parameters are of the proper type (eg string +or numeric) or that their values are within the proper range. + +As an example, to change the value of the Blast parameter 'e' ('e' is +the parameter for expectation-value cutoff) + + $expectvalue = 0.01; + $factory->e($expectvalue); + +Note that for improved script readibility one can modify the name of +the BLAST parameters as desired as long as the initial letter (and +case) of the parameter are preserved, eg +$factory-E<gt>expectvalue($expectvalue); Unfortunately, some of the BLAST +parameters are not the single letter one might expect (eg "iteration +round" in blastpgp is 'j'). Again one can check by using (eg) + + > blastpgp - . + +Once the factory has been created and the appropriate parameters set, + one can call one of the supported blast executables. The input + sequence(s) to these executables may be fasta file(s) as described in + the BLAST documentation. + + $inputfilename = 't/testquery.fa'; + $blast_report = $factory->blastall($inputfilename); + +In addition, sequence input may be in the form of either a Bio::Seq + object or or an array of Bio::Seq objects, eg + + $input = Bio::Seq->new(-id=>"test query",-seq=>"ACTACCCTTTAAATCAGTGGGGG"); + $blast_report = $factory->blastall($input); + +For blastall and non-psiblast blastpgp runs, report object is either a +BPlite.pm or Bio::SearchIO object, selected by the user with the +parameter _READMETHOD. (The leading underscore is needed to +distinguish this option from options which are passed to the BLAST +executable.) The default parser is Bio::SearchIO::blast. For +(multiple iteration) psiblast and bl2seq runs the report is +automatically parsed by the BPpsilite.pm and BPbl2seq.pm parsers +respectively, since neither Blast.pm nor BPlite can parse these +reports. In any case, the "raw" blast report is also available. The +filename is set by the in the 'outfile' parameter and has the default +value of "blastreport.out". + +For psiblast execution in BLAST's "jumpstart" mode, the program must +be passed (in addition to the query sequence itself) an alignment +containing the query sequence (in the form of a SimpleAlign object) as +well as a "mask" specifying at what residues position-specific scoring +matrices (PSSMs) are to used and at what residues default scoring +matrices (eg BLOSUM) are to be used. See psiblast documentation for +more details. The mask itself is a string of 0's and 1's which is the +same length as each sequence in the alignment and has a "1" at +locations where (PSSMs) are to be used and a "0" at all other +locations. So for example: + + $str = Bio::AlignIO->new(-file=> "cysprot.msf", '-format' => 'msf' ); + $aln = $str->next_aln(); + $len = $aln->length_aln(); + $mask = '1' x $len; # simple case where PSSM's to be used at all residues + $report = $factory->blastpgp("cysprot1.fa", $aln, $mask); + +For bl2seq execution, StandAloneBlast.pm can be combined with +AlignIO.pm to directly produce a SimpleAlign object from the alignment +of the two sequences produced by bl2seq as in: + + #Get 2 sequences + $str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta', ); + my $seq3 = $str->next_seq(); + my $seq4 = $str->next_seq(); + + # Run bl2seq on them + $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out'); + my $bl2seq_report = $factory->bl2seq($seq3, $seq4); + + # Use AlignIO.pm to create a SimpleAlign object from the bl2seq report + $str = Bio::AlignIO->new(-file=> 'bl2seq.out','-format' => 'bl2seq'); + $aln = $str->next_aln(); + +For more examples of syntax and use of Blast.pm, the user is +encouraged to run the scripts standaloneblast.pl in the bioperl +/examples directory and StandAloneBlast.t in the bioperl /t directory. + +Note: There is a similar (but older) perl object interface offered by +nhgri. The nhgri module only supports blastall and does not support +blastpgp, psiblast, phiblast, bl2seq etc. This module can be found at +http://genome.nhgri.nih.gov/blastall/. + +=head1 DEVELOPERS NOTES + +B<STILL TO BE WRITTEN> + +Note: This module is still under development. If you would like that a +specific BLAST feature be added to this perl interface, let me know. + +=head1 FEEDBACK + +=head2 Mailing Lists + +User feedback is an integral part of the evolution of this and other +Bioperl modules. Send your comments and suggestions preferably to one +of the Bioperl mailing lists. Your participation is much appreciated. + + bioperl-l@bioperl.org - General discussion + http://bio.perl.org/MailList.html - About the mailing lists + +=head2 Reporting Bugs + +Report bugs to the Bioperl bug tracking system to help us keep track +the bugs and their resolution. Bug reports can be submitted via email +or the web: + + bioperl-bugs@bio.perl.org + http://bio.perl.org/bioperl-bugs/ + +=head1 AUTHOR - Peter Schattner + +Email schattner@alum.mit.edu + +=head1 APPENDIX + +The rest of the documentation details each of the object +methods. Internal methods are usually preceded with a _ + +=cut + +package Bio::Tools::Run::StandAloneBlast; + +use vars qw($AUTOLOAD @ISA $PROGRAMDIR $DATADIR + @BLASTALL_PARAMS @BLASTPGP_PARAMS + @BL2SEQ_PARAMS @OTHER_PARAMS %OK_FIELD + ); +use strict; +use Bio::Root::Root; +use Bio::Root::IO; +use Bio::Seq; +use Bio::SeqIO; +use Bio::Tools::BPbl2seq; +use Bio::Tools::BPpsilite; +use Bio::SearchIO; +use Bio::Tools::Run::WrapperBase; +use Bio::Factory::ApplicationFactoryI; + +BEGIN { + + @BLASTALL_PARAMS = qw( p d i e m o F G E X I q r v b f g Q + D a O J M W z K L Y S T l U y Z); + @BLASTPGP_PARAMS = qw(d i A f e m o y P F G E X N g S H a I h c + j J Z O M v b C R W z K L Y p k T Q B l U); + @BL2SEQ_PARAMS = qw(i j p g o d a G E X W M q r F e S T m); + + +# Non BLAST parameters start with underscore to differentiate them +# from BLAST parameters + @OTHER_PARAMS = qw(_READMETHOD); + +# _READMETHOD = 'BPlite' (default) or 'Blast' +# my @other_switches = qw(QUIET); + + +# Authorize attribute fields + foreach my $attr (@BLASTALL_PARAMS, @BLASTPGP_PARAMS, + @BL2SEQ_PARAMS, @OTHER_PARAMS ) + { $OK_FIELD{$attr}++; } + +# You will need to enable Blast to find the Blast program. This can be done +# in (at least) two different ways: +# 1. define an environmental variable blastDIR: +# export BLASTDIR=/home/peter/blast or +# 2. include a definition of an environmental variable BLASTDIR in every script that will +# use StandAloneBlast.pm. +# BEGIN {$ENV{BLASTDIR} = '/home/peter/blast/'; } + $PROGRAMDIR = $ENV{'BLASTDIR'} || ''; + +# If local BLAST databases are not stored in the standard +# /data directory, the variable BLASTDATADIR will need to be set explicitly + $DATADIR = $ENV{'BLASTDATADIR'} || $ENV{'BLASTDB'} || ''; +} + +@ISA = qw(Bio::Root::Root + Bio::Tools::Run::WrapperBase + Bio::Factory::ApplicationFactoryI); + +=head1 BLAST parameters + +Essentially all BLAST parameter can be set via StandAloneBlast.pm. +Some of the most commonly used parameters are listed below. All +parameters have defaults and are optional (I think.) For a complete +listing of settable parameters, run the relevant executable BLAST +program with the option "-" as in blastall - + +=head2 Blastall + + -p Program Name [String] + Input should be one of "blastp", "blastn", "blastx", + "tblastn", or "tblastx". + -d Database [String] default = nr + The database specified must first be formatted with formatdb. + Multiple database names (bracketed by quotations) will be accepted. + An example would be -d "nr est" + -i Query File [File In] Set by StandAloneBlast.pm from script. + default = stdin. The query should be in FASTA format. If multiple FASTA entries are in the input + file, all queries will be searched. + -e Expectation value (E) [Real] default = 10.0 + -o BLAST report Output File [File Out] Optional, + default = ./blastreport.out ; set by StandAloneBlast.pm + -S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer] + default = 3 + +=head2 Blastpgp (including Psiblast) + + -j is the maximum number of rounds (default 1; i.e., regular BLAST) + -h is the e-value threshold for including sequences in the + score matrix model (default 0.001) + -c is the "constant" used in the pseudocount formula specified in the paper (default 10) + -B Multiple alignment file for PSI-BLAST "jump start mode" Optional + -Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional + +=head2 Bl2seq + + -i First sequence [File In] + -j Second sequence [File In] + -p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String] + default = blastp + -o alignment output file [File Out] default = stdout + -e Expectation value (E) [Real] default = 10.0 + -S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer] + default = 3 + +=cut + +sub new { + my ($caller, @args) = @_; + # chained new + my $self = $caller->SUPER::new(@args); + + # to facilitiate tempfile cleanup + my ($tfh,$tempfile) = $self->io->tempfile(); + close($tfh); # we don't want the filehandle, just a temporary name + $self->outfile($tempfile); + $self->_READMETHOD('Blast'); + while (@args) { + my $attr = shift @args; + my $value = shift @args; + next if( $attr eq '-verbose'); + # the workaround to deal with initializing + $attr = 'p' if $attr =~ /^\s*program\s*$/; + $self->$attr($value); + } + return $self; +} + +sub AUTOLOAD { + my $self = shift; + my $attr = $AUTOLOAD; + $attr =~ s/.*:://; + my $attr_letter = substr($attr, 0, 1) ; + + # actual key is first letter of $attr unless first attribute + # letter is underscore (as in _READMETHOD), the $attr is a BLAST + # parameter and should be truncated to its first letter only + $attr = ($attr_letter eq '_') ? $attr : $attr_letter; + $self->throw("Unallowed parameter: $attr !") unless $OK_FIELD{$attr}; +# $self->throw("Unallowed parameter: $attr !") unless $ok_field{$attr_letter}; + $self->{$attr_letter} = shift if @_; + return $self->{$attr_letter}; +} + +=head1 Methods + +=head2 executable + + Title : executable + Usage : my $exe = $blastfactory->executable('blastall'); + Function: Finds the full path to the 'codeml' executable + Returns : string representing the full path to the exe + Args : [optional] name of executable to set path to + [optional] boolean flag whether or not warn when exe is not found + + +=cut + +sub executable { + my ($self, $exename, $exe,$warn) = @_; + $exename = 'blastall' unless defined $exename; + + if( defined $exe && -x $exe ) { + $self->{'_pathtoexe'}->{$exename} = $exe; + } + unless( defined $self->{'_pathtoexe'}->{$exename} ) { + my $f = $self->program_path($exename); + $exe = $self->{'_pathtoexe'}->{$exename} = $f if(-e $f && -x $f ); + + # This is how I meant to split up these conditionals --jason + # if exe is null we will execute this (handle the case where + # PROGRAMDIR pointed to something invalid) + unless( $exe ) { # we didn't find it in that last conditional + if( ($exe = $self->io->exists_exe($exename)) && -x $exe ) { + $self->{'_pathtoexe'}->{$exename} = $exe; + } else { + $self->warn("Cannot find executable for $exename") if $warn; + $self->{'_pathtoexe'}->{$exename} = undef; + } + } + } + return $self->{'_pathtoexe'}->{$exename}; +} + + +=head2 program_path + + Title : program_path + Usage : my $path = $factory->program_path(); + Function: Builds path for executable + Returns : string representing the full path to the exe + Args : none + +=cut + +sub program_path { + my ($self,$program_name) = @_; + my @path; + push @path, $self->program_dir if $self->program_dir; + push @path, $program_name .($^O =~ /mswin/i ?'.exe':''); + + return Bio::Root::IO->catfile(@path); +} + +=head2 program_dir + + Title : program_dir + Usage : my $dir = $factory->program_dir(); + Function: Abstract get method for dir of program. To be implemented + by wrapper. + Returns : string representing program directory + Args : none + +=cut + +sub program_dir { + $PROGRAMDIR; +} + +sub program { + my $self = shift; + if( wantarray ) { + return ($self->executable, $self->p()); + } else { + return $self->executable(@_); + } +} + +=head2 blastall + + Title : blastall + Usage : $blast_report = $factory->blastall('t/testquery.fa'); + or + $input = Bio::Seq->new(-id=>"test query", + -seq=>"ACTACCCTTTAAATCAGTGGGGG"); + $blast_report = $factory->blastall($input); + or + $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects + $blast_report = $factory->blastall(\@seq_array); + Returns : Reference to a Blast object or BPlite object + containing the blast report. + Args : Name of a file or Bio::Seq object or an array of + Bio::Seq object containing the query sequence(s). + Throws an exception if argument is not either a string + (eg a filename) or a reference to a Bio::Seq object + (or to an array of Seq objects). If argument is string, + throws exception if file corresponding to string name can + not be found. + +=cut + +sub blastall { + my ($self,$input1) = @_; + $self->io->_io_cleanup(); + my $executable = 'blastall'; + my $input2; +# Create input file pointer + my $infilename1 = $self->_setinput($executable, $input1); + if (! $infilename1) {$self->throw(" $input1 ($infilename1) not Bio::Seq object or array of Bio::Seq objects or file name!");} + + $self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastall) + + my $blast_report = &_generic_local_blast($self, $executable, + $input1, $input2); +} + +=head2 blastpgp + + Title : blastpgp + Usage : $blast_report = $factory-> blastpgp('t/testquery.fa'); + or + $input = Bio::Seq->new(-id=>"test query", + -seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); + $blast_report = $factory->blastpgp ($input); + or + $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects + $blast_report = $factory-> blastpgp(\@seq_array); + Returns : Reference to a Blast object or BPlite object containing + the blast report. + Args : Name of a file or Bio::Seq object. In psiblast jumpstart + mode two additional arguments are required: a SimpleAlign + object one of whose elements is the query and a "mask" to + determine how BLAST should select scoring matrices see + DESCRIPTION above for more details. + + Throws an exception if argument is not either a string + (eg a filename) or a reference to a Bio::Seq object + (or to an array of Seq objects). If argument is string, + throws exception if file corresponding to string name can + not be found. + Returns : Reference to either a BPlite.pm, Blast.pm or BPpsilite.pm + object containing the blast report. + +=cut + +sub blastpgp { + my $self = shift; + my $executable = 'blastpgp'; + my $input1 = shift; + my $input2 = shift; + my $mask = shift; # used by blastpgp's -B option to specify which residues are position aligned + + my ($infilename1, $infilename2 ) = $self->_setinput($executable, + $input1, $input2, + $mask); + if (!$infilename1) {$self->throw(" $input1 not Bio::Seq object or array of Bio::Seq objects or file name!");} + $self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastpgp) + if ($input2) { + unless ($infilename2) {$self->throw("$input2 not SimpleAlign Object in pre-aligned psiblast\n");} + $self->B($infilename2); # set file name of partial alignment to inputfilename2 (-B param of blastpgp) + } + my $blast_report = &_generic_local_blast($self, $executable, $input1, $input2); +} + +=head2 bl2seq + + Title : bl2seq + Usage : $factory-> blastpgp('t/seq1.fa', 't/seq2.fa'); + or + $input1 = Bio::Seq->new(-id=>"test query1", + -seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); + $input2 = Bio::Seq->new(-id=>"test query2", + -seq=>"ACTADDEMMMMMMMDEEQQQVVGG"); + $blast_report = $factory->bl2seq ($input1, $input2); + Returns : Reference to a BPbl2seq object containing the blast report. + Args : Names of 2 files or 2 Bio::Seq objects containing the + sequences to be aligned by bl2seq. + + Throws an exception if argument is not either a pair of + strings (eg filenames) or references to Bio::Seq objects. + If arguments are strings, throws exception if files + corresponding to string names can not be found. + +=cut + +sub bl2seq { + my $self = shift; + my $executable = 'bl2seq'; + my $input1 = shift; + my $input2 = shift; + +# Create input file pointer + my ($infilename1, $infilename2 ) = $self->_setinput($executable, + $input1, $input2); + if (!$infilename1){$self->throw(" $input1 not Seq Object or file name!");} + if (!$infilename2){$self->throw("$input2 not Seq Object or file name!");} + + $self->i($infilename1); # set file name of first sequence to + # be aligned to inputfilename1 + # (-i param of bl2seq) + $self->j($infilename2); # set file name of first sequence to + # be aligned to inputfilename2 + # (-j param of bl2seq) + + my $blast_report = &_generic_local_blast($self, $executable); +} +################################################# + +=head2 _generic_local_blast + + Title : _generic_local_blast + Usage : internal function not called directly + Returns : Blast or BPlite object + Args : Reference to calling object and name of BLAST executable + +=cut + +sub _generic_local_blast { + my $self = shift; + my $executable = shift; + + # Create parameter string to pass to Blast program + my $param_string = $self->_setparams($executable); + + # run Blast + my $blast_report = &_runblast($self, $executable, $param_string); +} + + +=head2 _runblast + + Title : _runblast + Usage : Internal function, not to be called directly + Function: makes actual system call to Blast program + Example : + Returns : Report object in the appropriate format (BPlite, + BPpsilite, Blast, or BPbl2seq) + Args : Reference to calling object, name of BLAST executable, + and parameter string for executable + +=cut + +sub _runblast { + my ($self,$executable,$param_string) = @_; + my ($blast_obj,$exe); + if( ! ($exe = $self->executable($executable)) ) { + $self->warn("cannot find path to $executable"); + return undef; + } + my $commandstring = $exe. $param_string; + + # next line for debugging + $self->debug( "$commandstring \n"); + + my $status = system($commandstring); + + $self->throw("$executable call crashed: $? $commandstring\n") unless ($status==0) ; + my $outfile = $self->o() ; # get outputfilename + my $signif = $self->e() || 1e-5 ; + +# set significance cutoff to set expectation value or default value +# (may want to make this value vary for different executables) + +# If running bl2seq or psiblast (blastpgp with multiple iterations), +# the specific parsers for these programs must be used (ie BPbl2seq or +# BPpsilite). Otherwise either the Blast parser or the BPlite +# parsers can be selected. + + if ($executable =~ /bl2seq/i) { + if( $self->verbose > 0 ) { + open(OUT, $outfile) || $self->throw("cannot open $outfile"); + while(<OUT>) { $self->debug($_)} + close(OUT); + } +# Added program info so BPbl2seq can compute strand info + $blast_obj = Bio::Tools::BPbl2seq->new(-file => $outfile, + -REPORT_TYPE => $self->p ); +# $blast_obj = Bio::Tools::BPbl2seq->new(-file => $outfile); + } + elsif ($executable =~ /blastpgp/i && defined $self->j() && + $self->j() > 1) { + print "using psilite parser\n"; + $blast_obj = Bio::Tools::BPpsilite->new(-file => $outfile); + } + elsif ($self->_READMETHOD =~ /^Blast/i ) { + $blast_obj = Bio::SearchIO->new(-file=>$outfile, + -format => 'blast' ) ; + } + elsif ($self->_READMETHOD =~ /^BPlite/i ) { + $blast_obj = Bio::Tools::BPlite->new(-file=>$outfile); + } else { + $self->warn("Unrecognized readmethod ".$self->_READMETHOD. " or executable $executable\n"); + } + return $blast_obj; +} + +=head2 _setinput + + Title : _setinput + Usage : Internal function, not to be called directly + Function: Create input file(s) for Blast executable + Example : + Returns : name of file containing Blast data input + Args : Seq object reference or input file name + +=cut + +sub _setinput { + my ($self, $executable, $input1, $input2) = @_; + my ($seq, $temp, $infilename1, $infilename2,$fh ) ; +# If $input1 is not a reference it better be the name of a file with +# the sequence/ alignment data... + $self->io->_io_cleanup(); + + SWITCH: { + unless (ref $input1) { + $infilename1 = (-e $input1) ? $input1 : 0 ; + last SWITCH; + } +# $input may be an array of BioSeq objects... + if (ref($input1) =~ /ARRAY/i ) { + ($fh,$infilename1) = $self->io->tempfile(); + $temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta'); + foreach $seq (@$input1) { + unless ($seq->isa("Bio::PrimarySeqI")) {return 0;} + $temp->write_seq($seq); + } + close $fh; + $fh = undef; + last SWITCH; + } +# $input may be a single BioSeq object... + elsif ($input1->isa("Bio::PrimarySeqI")) { + ($fh,$infilename1) = $self->io->tempfile(); + +# just in case $input1 is taken from an alignment and has spaces (ie +# deletions) indicated within it, we have to remove them - otherwise +# the BLAST programs will be unhappy + + my $seq_string = $input1->seq(); + $seq_string =~ s/\W+//g; # get rid of spaces in sequence + $input1->seq($seq_string); + $temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta'); + $temp->write_seq($input1); + close $fh; + undef $fh; +# $temp->write_seq($input1); + last SWITCH; + } + $infilename1 = 0; # Set error flag if you get here + } # End SWITCH + unless ($input2) { return $infilename1; } + SWITCH2: { + unless (ref $input2) { + $infilename2 = (-e $input2) ? $input2 : 0 ; + last SWITCH2; + } + if ($input2->isa("Bio::PrimarySeqI") && $executable eq 'bl2seq' ) { + ($fh,$infilename2) = $self->io->tempfile(); + + $temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta'); + $temp->write_seq($input2); + close $fh; + undef $fh; + last SWITCH2; + } +# Option for using psiblast's pre-alignment "jumpstart" feature + elsif ($input2->isa("Bio::SimpleAlign") && + $executable eq 'blastpgp' ) { + # a bit of a lie since it won't be a fasta file + ($fh,$infilename2) = $self->io->tempfile(); + +# first we retrieve the "mask" that determines which residues should +# by scored according to their position and which should be scored +# using the non-position-specific matrices + + my @mask = split("", shift ); # get mask + +# then we have to convert all the residues in every sequence to upper +# case at the positions that we want psiblast to use position specific +# scoring + + foreach $seq ( $input2->each_seq() ) { + my @seqstringlist = split("",$seq->seq()); + for (my $i = 0; $i < scalar(@mask); $i++) { + unless ( $seqstringlist[$i] =~ /[a-zA-Z]/ ) {next} + $seqstringlist[$i] = $mask[$i] ? uc $seqstringlist[$i]: lc $seqstringlist[$i] ; + } + my $newseqstring = join("", @seqstringlist); + $seq->seq($newseqstring); + } + # Now we need to write out the alignment to a file + # in the "psi format" which psiblast is expecting + $input2->map_chars('\.','-'); + $temp = Bio::AlignIO->new(-fh=> $fh, '-format' => 'psi'); + $temp->write_aln($input2); + close $fh; + undef $fh; + last SWITCH2; + } + $infilename2 = 0; # Set error flag if you get here + } # End SWITCH2 + return ($infilename1, $infilename2); +} + +=head2 _setparams + + Title : _setparams + Usage : Internal function, not to be called directly + Function: Create parameter inputs for Blast program + Example : + Returns : parameter string to be passed to Blast + Args : Reference to calling object and name of BLAST executable + +=cut + +sub _setparams { + my ($self,$executable) = @_; + my ($attr, $value, @execparams); + + if ($executable eq 'blastall') {@execparams = @BLASTALL_PARAMS; } + if ($executable eq 'blastpgp') {@execparams = @BLASTPGP_PARAMS; } + if ($executable eq 'bl2seq') {@execparams = @BL2SEQ_PARAMS; } + + my $param_string = ""; + for $attr ( @execparams ) { + $value = $self->$attr(); + next unless (defined $value); +# Need to prepend datadirectory to database name + if ($attr eq 'd' && ($executable ne 'bl2seq')) { +# This is added so that you can specify a DB with a full path + if (! (-e $value.".nin" || -e $value.".pin")){ + $value = File::Spec->catdir($DATADIR,$value); + } + } +# put params in format expected by Blast + $attr = '-'. $attr ; + $param_string .= " $attr $value "; + } + +# if ($self->quiet()) { $param_string .= ' >/dev/null';} + + return $param_string; +} + + +=head1 Bio::Tools::Run::Wrapper methods + +=cut + +=head2 no_param_checks + + Title : no_param_checks + Usage : $obj->no_param_checks($newval) + Function: Boolean flag as to whether or not we should + trust the sanity checks for parameter values + Returns : value of no_param_checks + Args : newvalue (optional) + + +=cut + +=head2 save_tempfiles + + Title : save_tempfiles + Usage : $obj->save_tempfiles($newval) + Function: + Returns : value of save_tempfiles + Args : newvalue (optional) + + +=cut + +=head2 outfile_name + + Title : outfile_name + Usage : my $outfile = $tcoffee->outfile_name(); + Function: Get/Set the name of the output file for this run + (if you wanted to do something special) + Returns : string + Args : [optional] string to set value to + + +=cut + + +=head2 tempdir + + Title : tempdir + Usage : my $tmpdir = $self->tempdir(); + Function: Retrieve a temporary directory name (which is created) + Returns : string which is the name of the temporary directory + Args : none + + +=cut + +=head2 cleanup + + Title : cleanup + Usage : $tcoffee->cleanup(); + Function: Will cleanup the tempdir directory after a PAML run + Returns : none + Args : none + + +=cut + +=head2 io + + Title : io + Usage : $obj->io($newval) + Function: Gets a L<Bio::Root::IO> object + Returns : L<Bio::Root::IO> + Args : none + + +=cut + +sub DESTROY { + my $self= shift; + unless ( $self->save_tempfiles ) { + $self->cleanup(); + } + $self->SUPER::DESTROY(); +} + +1; +__END__