annotate test-data/no_taxon_input.fasta @ 0:d45f1e32173d draft default tip

planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/metaphlan/
author thanhlv
date Mon, 13 Feb 2023 11:07:13 +0000
parents
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
d45f1e32173d planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/metaphlan/
thanhlv
parents:
diff changeset
1 > seq1
d45f1e32173d planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/metaphlan/
thanhlv
parents:
diff changeset
2 ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA
d45f1e32173d planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/metaphlan/
thanhlv
parents:
diff changeset
3 > seq2
d45f1e32173d planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/metaphlan/
thanhlv
parents:
diff changeset
4 ATTAGGGATTTTAGGGGGGGAGATTTAGAGAGAGAGAGAGAGAAGAAGAGAAGAAGAAGAAGAAAAAGGGGGAAGAGAGA