Mercurial > repos > swebb > pycrac
changeset 0:ae088f9b2f2e draft default tip
Uploaded
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/features_FDR_data.txt Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,7203 @@ +# generated by pyCalculateFDRs version 0.0.3, Wed May 22 10:09:41 2013 +# /usr/local/bin/pyCalculateFDRs.py -f shaun_count_output_reads.gtf --file_type gtf -o shaun -c /usr/local/pyCRAC/db/Saccharomyces_cerevisiae.EF2.59.1.0_chr_lengths.txt --gtf /usr/local/pyCRAC/db/Saccharomyces_cerevisiae.EF2.59.1.2.gtf + +####### chromosome chrI ####### + +# NTG1 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.182316543313 30 1.68 + +# INT_0_184 +height FDR actual_density mean_random_density +3 0.0113868673874 35 0.04 +2 0.264863105125 46 6.01 + +# ERV46 +height FDR actual_density mean_random_density +4 0.0 36 0.0 +3 0.122808471346 37 0.88 + +# CUT001 +height FDR actual_density mean_random_density +3 0.0348889361139 43 0.15 +2 0.301664202197 52 8.55 + +# CYS3 +height FDR actual_density mean_random_density +5 0.0 17 0.0 +4 0.0139279243323 43 0.06 +3 0.116305322732 52 3.01 + +# SUT004 +height FDR actual_density mean_random_density +>=4 0.0 63 0.0 +3 0.0679160994932 42 0.38 + +# SUT002 +height FDR actual_density mean_random_density +3 0.0226398198746 22 0.05 +2 0.265342339795 43 7.51 + +# SUT003 +height FDR actual_density mean_random_density +>=6 0.0 49 0.0 +5 0.0343457360634 32 0.11 +4 0.11724466749 50 2.27 + +# CDC19 +height FDR actual_density mean_random_density +7 0.0 26 0.0 +6 0.0790482502107 29 0.23 + +# tA(UGC)A +height FDR actual_density mean_random_density +>=8 0.0 51 0.0 +7 0.0920839700914 28 0.56 + +# SSA1 +height FDR actual_density mean_random_density +>=7 0.0 185 0.0 +6 0.0387753200592 70 0.59 +5 0.0948290446858 114 5.41 + +# INT_0_149 +height FDR actual_density mean_random_density +>=4 0.0 42 0.0 +3 0.23436614329 8 0.31 + +# FLC2 +height FDR actual_density mean_random_density +>=3 0.0 70 0.0 +2 0.286335235488 41 5.34 + +# INT_0_140 +height FDR actual_density mean_random_density +>=5 0.0 73 0.0 +4 0.107480137327 45 1.53 + +# INT_0_64 +height FDR actual_density mean_random_density +5 0.0 22 0.0 +4 0.069663299537 41 0.55 + +# ADE1 +height FDR actual_density mean_random_density +4 0.0367239718174 19 0.07 +3 0.0949150893078 63 1.5 + +# INT_0_179 +height FDR actual_density mean_random_density +>=7 0.0 2767 0.0 +6 0.0302341071194 61 0.26 +5 0.0619693164885 62 0.83 + +# FRT2 +height FDR actual_density mean_random_density +3 0.0 41 0.0 +2 0.216971628216 45 2.84 + +# INT_0_176 +height FDR actual_density mean_random_density +2 0.0 18 0.0 +1 0.0649102603092 24 41.85 + +# CLN3 +height FDR actual_density mean_random_density +4 0.0 20 0.0 +3 0.168743581693 24 0.89 + +# BDH2 +height FDR actual_density mean_random_density +>=5 0.0 93 0.0 +4 0.0329057357062 79 0.26 +3 0.120059603375 80 5.2 + +# BDH1 +height FDR actual_density mean_random_density +4 0.0 21 0.0 +3 0.013590183455 22 0.03 +2 0.503285311101 22 8.18 + +# INT_0_114 +height FDR actual_density mean_random_density +>=3 0.0 240 0.0 +2 0.0988740516164 124 7.28 + +# VPS8 +height FDR actual_density mean_random_density +4 0.0 24 0.0 +3 0.0181882602733 66 0.16 +2 0.142283989512 85 7.49 + +# INT_0_56 +height FDR actual_density mean_random_density +2 0.0 22 0.0 +1 0.0879502465589 24 45.8 + +# EFB1 +height FDR actual_density mean_random_density +6 0.0 36 0.0 +5 0.0323690363788 37 0.12 +4 0.130030555284 45 1.26 + +####### chromosome chrII ####### + +# PRP5 +height FDR actual_density mean_random_density +>=4 0.0 44 0.0 +3 0.0677834147291 50 0.34 + +# INT_0_627 +height FDR actual_density mean_random_density +2 0.0199261513824 20 0.04 +1 0.105252369159 21 40.75 + +# MAL31 +height FDR actual_density mean_random_density +>=4 0.0 184 0.0 +3 0.0297454199504 59 0.3 +2 0.414011638206 59 26.52 + +# REB1 +height FDR actual_density mean_random_density +2 0.0 25 0.0 +1 0.132844240035 55 78.88 + +# PGI1 +height FDR actual_density mean_random_density +>=7 0.0 555 0.0 +6 0.00449352212229 89 0.04 +5 0.0448703739411 94 1.39 +4 0.135411645522 97 9.19 + +# INT_0_698 +height FDR actual_density mean_random_density +>=4 0.0 77 0.0 +3 0.0789176781332 43 0.34 + +# UBC4 +height FDR actual_density mean_random_density +5 0.0 25 0.0 +4 0.0166403977204 30 0.05 +3 0.111765751294 32 0.71 + +# INT_0_401 +height FDR actual_density mean_random_density +3 0.0 34 0.0 +2 0.170678849996 43 2.37 + +# INT_0_409 +height FDR actual_density mean_random_density +2 0.0 32 0.0 +1 0.0768514430464 34 65.69 + +# INT_0_275 +height FDR actual_density mean_random_density +>=7 0.0 1537 0.0 +6 0.0028081732734 50 0.02 +5 0.0800954873229 52 1.4 + +# RPS9B +height FDR actual_density mean_random_density +6 0.0 4 0.0 +5 0.0837707255389 25 0.21 + +# PRS4 +height FDR actual_density mean_random_density +>=5 0.0 185 0.0 +4 0.0679157973693 42 0.38 + +# RAD16 +height FDR actual_density mean_random_density +4 0.0 42 0.0 +3 0.0046362766947 43 0.02 +2 0.289731364571 84 18.82 + +# PRX1 +height FDR actual_density mean_random_density +4 0.0 26 0.0 +3 0.141898514552 31 0.62 + +# INT_0_475 +height FDR actual_density mean_random_density +>=4 0.0 84 0.0 +3 0.0891562985559 46 0.66 + +# INT_0_341 +height FDR actual_density mean_random_density +>=6 0.0 170 0.0 +5 0.00311725967123 32 0.01 +4 0.056849541838 34 0.29 + +# INT_0_611 +height FDR actual_density mean_random_density +2 0.0 40 0.0 +1 0.201328630459 42 80.13 + +# SUT445 +height FDR actual_density mean_random_density +>=3 0.0 117 0.0 +2 0.242905311103 48 6.34 + +# SNR161 +height FDR actual_density mean_random_density +>=10 0.0 33 0.0 +9 0.0144004416481 21 0.03 +8 0.0955885074259 22 0.56 + +# tE(UUC)B +height FDR actual_density mean_random_density +11 0.0 7 0.0 +10 0.0543300653595 17 0.1 + +# INT_0_489 +height FDR actual_density mean_random_density +3 0.0 4 0.0 +2 0.382983725646 19 2.81 + +# MCM7 +height FDR actual_density mean_random_density +>=4 0.0 59 0.0 +3 0.0166083219359 42 0.07 +2 0.299960740884 43 6.2 + +# MOH1 +height FDR actual_density mean_random_density +3 0.0325492948293 43 0.14 +2 0.302945652365 47 7.33 + +# TPS1 +height FDR actual_density mean_random_density +>=5 0.0 40 0.0 +4 0.0039859993552 25 0.01 +3 0.0735375267175 73 1.85 + +# TEF2 +height FDR actual_density mean_random_density +>=5 0.0 88 0.0 +4 0.0500261200856 48 0.49 + +# SNR56 +height FDR actual_density mean_random_density +>=11 0.0 84 0.0 +10 0.0390451728962 19 0.09 +9 0.113938544779 19 0.67 + +# INT_0_431 +height FDR actual_density mean_random_density +>=10 0.0 3175 0.0 +9 0.00158297753928 63 0.01 +8 0.0294480162733 64 0.39 +7 0.0639046850486 64 1.83 + +# TOS1 +height FDR actual_density mean_random_density +>=6 0.0 272 0.0 +5 0.0236166573664 38 0.09 +4 0.109568565626 41 1.01 + +# PAF1 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.183633957109 23 1.27 + +# tL(UAA)B2 +height FDR actual_density mean_random_density +5 0.0 16 0.0 +4 0.206853633893 17 1.23 + +# INT_0_503 +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.138600854129 28 0.78 + +# INT_0_501 +height FDR actual_density mean_random_density +>=5 0.0 147 0.0 +4 0.00592314915512 69 0.07 +3 0.130816863052 83 7.26 + +# OM14 +height FDR actual_density mean_random_density +3 0.0465655743895 15 0.07 +2 0.237943482442 51 6.5 + +# CUT015 +height FDR actual_density mean_random_density +>=7 0.0 34 0.0 +6 0.0247175191549 68 0.25 +5 0.0872754200693 74 1.99 + +# CUT017 +height FDR actual_density mean_random_density +>=5 0.0 290 0.0 +4 0.0472790329162 70 0.81 +3 0.151803294695 76 8.16 + +# TIP1 +height FDR actual_density mean_random_density +>=6 0.0 104 0.0 +5 0.00227427169494 44 0.01 +4 0.0990555725131 45 1.88 + +# RPS8A +height FDR actual_density mean_random_density +3 0.0353012372269 37 0.21 +2 0.280964304656 54 9.48 + +# INT_0_469 +height FDR actual_density mean_random_density +3 0.0 11 0.0 +2 0.111401178311 60 3.46 + +# SCO1 +height FDR actual_density mean_random_density +>=4 0.0 61 0.0 +3 0.0678142140041 33 0.51 + +# TLC1 +height FDR actual_density mean_random_density +>=4 0.0 61 0.0 +3 0.0787059420548 27 0.55 + +# SUT451 +height FDR actual_density mean_random_density +3 0.0261088657672 23 0.06 +2 0.292942968537 24 3.5 + +# SUT452 +height FDR actual_density mean_random_density +2 0.0 21 0.0 +1 0.067158704782 22 42.86 + +# PRE7 +height FDR actual_density mean_random_density +3 0.0 18 0.0 +2 0.331434114225 29 5.97 + +# UBX7 +height FDR actual_density mean_random_density +4 0.0 30 0.0 +3 0.119225198719 36 1.26 + +# INT_0_429 +height FDR actual_density mean_random_density +4 0.0 16 0.0 +3 0.00907532534483 22 0.02 +2 0.298081169663 23 4.05 + +# INT_0_398 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.202373338085 24 1.66 + +# SSE2 +height FDR actual_density mean_random_density +>=4 0.0 36 0.0 +3 0.121115387386 19 0.4 + +# CHK1 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.0663983213694 18 0.12 + +# NPL4 +height FDR actual_density mean_random_density +3 0.0 12 0.0 +2 0.155907670839 23 1.14 + +# INT_0_453 +height FDR actual_density mean_random_density +4 0.0 12 0.0 +3 0.0213551344515 14 0.03 +2 0.224987221385 43 7.31 + +# INT_0_452 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.193374684213 20 1.25 + +# SUT009 +height FDR actual_density mean_random_density +3 0.0 32 0.0 +2 0.287847701724 33 5.17 + +# INT_0_324 +height FDR actual_density mean_random_density +3 0.0 5 0.0 +2 0.154260865787 34 1.96 + +# tD(GUC)B +height FDR actual_density mean_random_density +>=12 0.0 16 0.0 +11 0.0719980041956 14 0.22 + +# LSR1 +height FDR actual_density mean_random_density +>=10 0.0 235 0.0 +9 0.00889137349842 68 0.11 +8 0.0260334358723 108 0.68 +7 0.0586220142743 135 3.71 + +# FAT1 +height FDR actual_density mean_random_density +3 0.0 15 0.0 +2 0.171283194993 17 0.64 + +# CUT449 +height FDR actual_density mean_random_density +4 0.0 13 0.0 +3 0.107388580917 13 0.14 + +# INT_0_365 +height FDR actual_density mean_random_density +>=6 0.0 123 0.0 +5 0.0591168666067 33 0.37 + +# INT_0_539 +height FDR actual_density mean_random_density +>=3 0.0 37 0.0 +2 0.0722122572674 30 0.44 + +# TAT1 +height FDR actual_density mean_random_density +5 0.0 21 0.0 +4 0.0129926037756 23 0.03 +3 0.136979497598 29 0.99 + +# ECM15 +height FDR actual_density mean_random_density +>=5 0.0 81 0.0 +4 0.0526139768774 44 0.58 + +# COR1 +height FDR actual_density mean_random_density +>=6 0.0 223 0.0 +5 0.011598473064 43 0.05 +4 0.0975704800249 45 1.16 + +# tR(UCU)B +height FDR actual_density mean_random_density +>=15 0.0 54 0.0 +14 0.00599175616599 17 0.01 +13 0.0309487815529 23 0.11 +12 0.0751793328814 25 0.5 + +# AGP2 +height FDR actual_density mean_random_density +>=4 0.0 65 0.0 +3 0.0708662997434 44 0.43 + +# DSF2 +height FDR actual_density mean_random_density +4 0.0 39 0.0 +3 0.0142396490285 42 0.06 +2 0.218964176309 48 3.28 + +# INT_0_562 +height FDR actual_density mean_random_density +3 0.0 38 0.0 +2 0.130247707096 40 1.45 + +# SCT1 +height FDR actual_density mean_random_density +>=5 0.0 179 0.0 +4 0.0436672124263 55 0.42 +3 0.165921834703 58 5.32 + +# INT_0_238 +height FDR actual_density mean_random_density +>=5 0.0 82 0.0 +4 0.0464221747717 53 0.55 +3 0.218477140456 58 11.34 + +# FES1 +height FDR actual_density mean_random_density +>=8 0.0 56 0.0 +7 0.00475749066771 42 0.02 +6 0.0174012061878 88 0.24 +5 0.0365771949575 104 0.81 +4 0.101631555214 112 7.63 + +# PET9 +height FDR actual_density mean_random_density +4 0.0 18 0.0 +3 0.0681647756611 21 0.2 + +# INT_0_567 +height FDR actual_density mean_random_density +2 0.0 21 0.0 +1 0.117279218221 25 45.62 + +# INT_0_445 +height FDR actual_density mean_random_density +>=6 0.0 136 0.0 +5 0.0143977443849 59 0.11 +4 0.0446088938739 74 0.93 +3 0.110577274908 111 11.8 + +# BAP2 +height FDR actual_density mean_random_density +5 0.0 15 0.0 +4 0.0257155197429 31 0.08 +3 0.138480042155 33 1.48 + +####### chromosome chrIII ####### + +# INT_0_869 +height FDR actual_density mean_random_density +3 0.00937068147608 32 0.03 +2 0.262576861063 34 3.9 + +# INT_0_864 +height FDR actual_density mean_random_density +3 0.0 43 0.0 +2 0.286332732087 45 5.69 + +# tE(UUC)C +height FDR actual_density mean_random_density +>=12 0.0 18 0.0 +11 0.00599175616599 17 0.01 +10 0.0483161820481 19 0.12 +9 0.0964158910111 24 0.46 + +# tQ(UUG)C +height FDR actual_density mean_random_density +>=12 0.0 36 0.0 +11 0.011983512332 17 0.02 +10 0.0642761497543 18 0.26 + +# tK(CUU)C +height FDR actual_density mean_random_density +15 0.0 12 0.0 +14 0.0056646942853 18 0.01 +13 0.0186386258801 22 0.04 +12 0.0497485389593 25 0.23 +11 0.11442979298 25 0.57 + +# INT_0_752 +height FDR actual_density mean_random_density +>=4 0.0 92 0.0 +3 0.0337095155734 68 0.23 +2 0.167249209254 78 7.64 + +# HSP30 +height FDR actual_density mean_random_density +>=5 0.0 82 0.0 +4 0.00999106053252 50 0.05 +3 0.139135459071 51 2.3 + +# SUP61 +height FDR actual_density mean_random_density +>=14 0.0 118 0.0 +13 0.0197729769462 37 0.11 +12 0.0436502164757 39 0.28 +11 0.081380329747 40 0.82 + +# INT_0_826 +height FDR actual_density mean_random_density +3 0.0 1 0.0 +2 9.59773295527 1 3.79 + +# PGK1 +height FDR actual_density mean_random_density +>=12 0.0 999 0.0 +11 0.0025501770226 118 0.03 +10 0.0068318267551 140 0.15 +9 0.0164710821138 163 0.73 +8 0.0351250732162 177 3.23 +7 0.0817745222395 182 12.74 + +# SUT458 +height FDR actual_density mean_random_density +3 0.0 27 0.0 +2 0.13316203043 32 1.19 + +# INT_0_770 +height FDR actual_density mean_random_density +4 0.0 1 0.0 +3 2.89622173575 1 0.68 + +# SNR33 +height FDR actual_density mean_random_density +>=17 0.0 199 0.0 +16 0.00274380004417 37 0.01 +15 0.021384262409 38 0.08 +14 0.0295753350444 43 0.2 +13 0.0625361587931 45 0.76 + +# CDC39 +height FDR actual_density mean_random_density +>=3 0.0 47 0.0 +2 0.161593132913 64 4.2 + +# SNR189 +height FDR actual_density mean_random_density +>=17 0.0 295 0.0 +16 0.00667594186642 34 0.03 +15 0.0334091929422 34 0.21 +14 0.0848530460604 35 0.94 + +# GLK1 +height FDR actual_density mean_random_density +>=6 0.0 231 0.0 +5 0.038442547086 57 0.41 +4 0.113866770823 65 3.89 + +# YCR015C +height FDR actual_density mean_random_density +>=7 0.0 715 0.0 +6 0.00800478319731 91 0.09 +5 0.0590315985305 94 2.15 + +# INT_0_853 +height FDR actual_density mean_random_density +>=17 0.0 53 0.0 +16 0.0375501241296 8 0.03 +15 0.135573601455 8 0.16 + +# APA1 +height FDR actual_density mean_random_density +>=4 0.0 49 0.0 +3 0.180654675196 37 1.47 + +# AGP1 +height FDR actual_density mean_random_density +4 0.0 28 0.0 +3 0.0237363877949 42 0.1 +2 0.209722485928 54 5.33 + +# SRD1 +height FDR actual_density mean_random_density +5 0.0 24 0.0 +4 0.0266381514964 48 0.18 +3 0.15080847089 54 4.67 + +# INT_0_844 +height FDR actual_density mean_random_density +>=9 0.0 3 0.0 +8 0.88889711598 1 0.15 + +# INT_0_904 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.0500499041936 52 0.38 + +# CWH43 +height FDR actual_density mean_random_density +>=3 0.0 52 0.0 +2 0.401877406202 21 4.64 + +# PTC6 +height FDR actual_density mean_random_density +2 0.0 21 0.0 +1 0.184884477348 22 42.13 + +####### chromosome chrIV ####### + +# INT_0_1792 +height FDR actual_density mean_random_density +3 0.0484321430492 53 0.36 +2 0.168849794758 87 10.36 + +# INT_0_1428 +height FDR actual_density mean_random_density +>=3 0.0 78 0.0 +2 0.166274605976 32 1.67 + +# EFT2 +height FDR actual_density mean_random_density +>=4 0.0 97 0.0 +3 0.106121247123 55 1.44 + +# RPO21 +height FDR actual_density mean_random_density +3 0.0 55 0.0 +2 0.136821114164 83 5.77 + +# HSP42 +height FDR actual_density mean_random_density +>=6 0.0 347 0.0 +5 0.0556882040128 63 0.64 + +# INT_0_1214 +height FDR actual_density mean_random_density +>=4 0.0 4 0.0 +3 0.350909575427 3 0.15 + +# INT_0_1216 +height FDR actual_density mean_random_density +3 0.0142311808033 21 0.03 +2 0.219156212181 22 1.47 + +# PKH3 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.163591708103 26 1.3 + +# ARP2 +height FDR actual_density mean_random_density +2 0.00996380194767 20 0.02 +1 0.185051678075 25 44.12 + +# tQ(UUG)D2 +height FDR actual_density mean_random_density +>=12 0.0 46 0.0 +11 0.0169997906184 18 0.03 +10 0.059128262958 18 0.19 + +# tQ(UUG)D3 +height FDR actual_density mean_random_density +>=15 0.0 52 0.0 +14 0.00369241544998 28 0.01 +13 0.0452909777983 29 0.2 +12 0.091721090651 29 0.69 + +# INT_0_1132 +height FDR actual_density mean_random_density +3 0.035182634415 17 0.06 +2 0.223204282622 37 3.75 + +# PSA1 +height FDR actual_density mean_random_density +>=5 0.0 88 0.0 +4 0.024911146054 67 0.25 +3 0.141773056322 70 4.95 + +# SUT063 +height FDR actual_density mean_random_density +3 0.0472390919711 38 0.18 +2 0.248132695608 45 4.48 + +# INT_0_1504 +height FDR actual_density mean_random_density +>=3 0.0 89 0.0 +2 0.183232757058 55 3.82 + +# RRI1 +height FDR actual_density mean_random_density +>=3 0.0 88 0.0 +2 0.271972592233 56 9.72 + +# CHL4 +height FDR actual_density mean_random_density +3 0.0 28 0.0 +2 0.144513517227 29 1.28 + +# YDR278C +height FDR actual_density mean_random_density +>=25 0.0 1723 0.0 +24 0.00312439288824 65 0.02 +23 0.00923401958262 66 0.06 +22 0.0184680391652 66 0.12 +21 0.0224577488524 66 0.18 +20 0.0345971303997 66 0.35 +19 0.0455639876515 66 0.59 +18 0.0689160642203 66 1.71 + +# CCT4 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.0280578703704 25 0.1 +2 0.198378334337 102 15.62 + +# VPS64 +height FDR actual_density mean_random_density +>=3 0.0 97 0.0 +2 0.2296476858 35 5.03 + +# INT_0_1181 +height FDR actual_density mean_random_density +>=3 0.0 71 0.0 +2 0.101275545251 30 0.8 + +# STP4 +height FDR actual_density mean_random_density +3 0.01810347658 11 0.02 +2 0.214106058538 36 4.13 + +# PDR15 +height FDR actual_density mean_random_density +3 0.0 31 0.0 +2 0.0890310865659 54 1.65 + +# INT_0_1432 +height FDR actual_density mean_random_density +>=3 0.0 60 0.0 +2 0.167290858427 32 1.64 + +# SUT053 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.231464312293 23 2.27 + +# CUT504 +height FDR actual_density mean_random_density +2 0.0498971551066 18 0.09 +1 0.267652653096 19 35.67 + +# SWR1 +height FDR actual_density mean_random_density +>=4 0.0 118 0.0 +3 0.0507533666751 73 0.71 + +# AHA1 +height FDR actual_density mean_random_density +>=5 0.0 94 0.0 +4 0.0589948686471 41 0.51 + +# YDR524C-B +height FDR actual_density mean_random_density +>=6 0.0 42 0.0 +5 0.0334986578759 36 0.12 +4 0.137951911069 41 1.67 + +# REF2 +height FDR actual_density mean_random_density +3 0.0 39 0.0 +2 0.156743733512 58 4.58 + +# INT_0_1725 +height FDR actual_density mean_random_density +>=12 0.0 272 0.0 +11 0.00725467118073 31 0.03 +10 0.050477061903 31 0.2 + +# INT_0_1544 +height FDR actual_density mean_random_density +>=5 0.0 51 0.0 +4 0.0375300938378 36 0.19 +3 0.164626354434 37 2.05 + +# SIT4 +height FDR actual_density mean_random_density +>=6 0.0 281 0.0 +5 0.0137766481595 74 0.12 +4 0.0780097150386 77 2.37 + +# YDR445C +height FDR actual_density mean_random_density +>=8 0.0 144 0.0 +7 0.0243169859976 33 0.08 +6 0.0427036327437 40 0.17 +5 0.0910057622893 62 2.18 + +# CUT071 +height FDR actual_density mean_random_density +>=5 0.0 110 0.0 +4 0.0142360487876 35 0.07 +3 0.216525450444 35 3.13 + +# CUT076 +height FDR actual_density mean_random_density +>=5 0.0 70 0.0 +4 0.101546119488 30 0.47 + +# TFP1 +height FDR actual_density mean_random_density +>=4 0.0 26 0.0 +3 0.0810247559281 80 1.8 + +# YDR249C +height FDR actual_density mean_random_density +3 0.0 41 0.0 +2 0.299156956669 46 7.85 + +# HSP78 +height FDR actual_density mean_random_density +>=5 0.0 164 0.0 +4 0.00554346221788 72 0.04 +3 0.131573051314 86 5.35 + +# HOM2 +height FDR actual_density mean_random_density +>=4 0.0 152 0.0 +3 0.113968595548 47 1.74 + +# CUT481 +height FDR actual_density mean_random_density +4 0.0 18 0.0 +3 0.125545105501 19 0.66 + +# APA2 +height FDR actual_density mean_random_density +3 0.0453192942793 22 0.1 +2 0.392909561066 26 6.7 + +# HXT3 +height FDR actual_density mean_random_density +5 0.0 45 0.0 +4 0.00338323378025 59 0.02 +3 0.113214967207 88 4.07 + +# INT_0_1700 +height FDR actual_density mean_random_density +>=3 0.0 34 0.0 +2 0.136797364266 36 1.47 + +# HXT6 +height FDR actual_density mean_random_density +5 0.00311473239503 32 0.01 +4 0.0431771399905 62 0.62 +3 0.0937746549746 157 12.37 + +# IVY1 +height FDR actual_density mean_random_density +3 0.0498880772714 42 0.21 +2 0.26213625548 44 5.57 + +# NUM1 +height FDR actual_density mean_random_density +5 0.0 52 0.0 +4 0.028643841882 71 0.29 +3 0.0362100577662 209 2.37 +2 0.130620719705 286 48.91 + +# RPN4 +height FDR actual_density mean_random_density +>=6 0.0 192 0.0 +5 0.0160368347956 56 0.09 +4 0.078193518113 65 1.21 + +# SUP2 +height FDR actual_density mean_random_density +>=15 0.0 210 0.0 +14 0.0133151756574 23 0.03 +13 0.04418172936 23 0.14 +12 0.112814298191 26 0.68 + +# MDH3 +height FDR actual_density mean_random_density +3 0.0 29 0.0 +2 0.238145180751 41 4.36 + +# MSN5 +height FDR actual_density mean_random_density +3 0.0 35 0.0 +2 0.184800800229 76 7.26 + +# UFD2 +height FDR actual_density mean_random_density +3 0.0 41 0.0 +2 0.168317943022 54 2.91 + +# TMA17 +height FDR actual_density mean_random_density +>=7 0.0 301 0.0 +6 0.0307553402134 58 0.3 +5 0.104176978883 59 2.3 + +# BSC2 +height FDR actual_density mean_random_density +3 0.0 50 0.0 +2 0.255593155027 52 5.54 + +# MED2 +height FDR actual_density mean_random_density +4 0.0 42 0.0 +3 0.0742551379461 43 0.32 + +# SLC1 +height FDR actual_density mean_random_density +>=5 0.0 190 0.0 +4 0.0530572280163 87 1.53 + +# NKP1 +height FDR actual_density mean_random_density +3 0.0443674718908 27 0.12 +2 0.293896077517 28 4.37 + +# INT_0_1086 +height FDR actual_density mean_random_density +3 0.0 16 0.0 +2 0.443929868745 19 2.9 + +# INT_0_1088 +height FDR actual_density mean_random_density +>=3 0.0 80 0.0 +2 0.24136549706 56 11.27 + +# GGC1 +height FDR actual_density mean_random_density +>=4 0.0 55 0.0 +3 0.0626268085858 36 0.32 + +# TPS2 +height FDR actual_density mean_random_density +>=3 0.0 52 0.0 +2 0.214916024121 50 7.91 + +# LDB17 +height FDR actual_density mean_random_density +2 0.0422921869743 33 0.14 +1 0.204754477665 35 66.49 + +# SUT065 +height FDR actual_density mean_random_density +4 0.0 18 0.0 +3 0.00414974766783 24 0.01 +2 0.318068580126 25 5.19 + +# INT_0_1014 +height FDR actual_density mean_random_density +>=11 0.0 1177 0.0 +10 0.0108801850048 46 0.05 +9 0.030463805669 49 0.27 +8 0.0624176865777 50 0.88 + +# YDR307W +height FDR actual_density mean_random_density +2 0.0 17 0.0 +1 0.110390652627 39 55.47 + +# CUT510 +height FDR actual_density mean_random_density +6 0.0 4 0.0 +5 0.0291773596017 44 0.23 +4 0.113179274034 78 5.3 + +# YDL129W +height FDR actual_density mean_random_density +>=3 0.0 120 0.0 +2 0.383320179864 44 12.23 + +# INT_0_1654 +height FDR actual_density mean_random_density +3 0.0 5 0.0 +2 2.3717321886 5 6.07 + +# TRP1 +height FDR actual_density mean_random_density +>=5 0.0 187 0.0 +4 0.0655718716338 44 0.48 + +# DBP10 +height FDR actual_density mean_random_density +>=3 0.0 95 0.0 +2 0.208199488169 53 5.37 + +# INT_0_1304 +height FDR actual_density mean_random_density +>=4 0.0 69 0.0 +3 0.087902680033 23 0.57 + +# INT_0_1308 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.165628109577 22 1.11 + +# tF(GAA)D +height FDR actual_density mean_random_density +6 0.031160626573 27 0.14 +5 0.160441219732 33 1.97 + +# INT_0_1872 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.276350928698 22 2.46 + +# COP1 +height FDR actual_density mean_random_density +3 0.0 29 0.0 +2 0.136697801742 42 1.17 + +# INT_0_1374 +height FDR actual_density mean_random_density +3 0.0 46 0.0 +2 0.148587538496 65 6.33 + +# INT_0_1379 +height FDR actual_density mean_random_density +>=9 0.0 20 0.0 +8 0.0451573622758 7 0.04 +7 0.375065530323 7 0.97 + +# SNR84 +height FDR actual_density mean_random_density +>=15 0.0 1836 0.0 +14 0.0157116705458 56 0.15 +13 0.0512494353252 57 0.64 + +# SUT492 +height FDR actual_density mean_random_density +3 0.00849498696599 47 0.04 +2 0.218855108744 55 4.61 + +# tA(AGC)D +height FDR actual_density mean_random_density +6 0.0 12 0.0 +5 0.058218201468 17 0.19 + +# SNR13 +height FDR actual_density mean_random_density +>=10 0.0 45 0.0 +9 0.128773771417 13 0.34 + +# TPI1 +height FDR actual_density mean_random_density +>=9 0.0 221 0.0 +8 0.00191587270724 74 0.02 +7 0.0286129450692 82 0.57 +6 0.0713227871039 94 2.71 + +# IZH1 +height FDR actual_density mean_random_density +3 0.0466007140531 38 0.25 +2 0.348530190169 43 8.45 + +# YDL206W +height FDR actual_density mean_random_density +>=4 0.0 255 0.0 +3 0.0900778365768 41 0.67 + +# INT_0_1289 +height FDR actual_density mean_random_density +>=5 0.0 2051 0.0 +4 0.0592828870382 54 0.76 + +# BDF2 +height FDR actual_density mean_random_density +>=7 0.0 111 0.0 +6 0.00786964274164 38 0.03 +5 0.0221311069195 47 0.16 +4 0.0597437320889 113 2.29 + +# ALT2 +height FDR actual_density mean_random_density +>=8 0.0 1722 0.0 +7 0.0271758504194 48 0.28 +6 0.115593851516 50 2.36 + +# INT_0_1934 +height FDR actual_density mean_random_density +>=27 0.0 58 0.0 +26 0.0716260867775 7 0.05 + +# INT_0_1623 +height FDR actual_density mean_random_density +2 0.0 38 0.0 +1 0.0910574853349 40 77.66 + +# INT_0_1236 +height FDR actual_density mean_random_density +2 0.00948153083505 21 0.02 +1 0.0989534704761 23 43.71 + +# INT_0_1231 +height FDR actual_density mean_random_density +>=4 0.0 78 0.0 +3 0.0914753141071 43 0.96 + +# CUT058 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0541100361732 24 0.18 + +# TRS31 +height FDR actual_density mean_random_density +>=9 0.0 718 0.0 +8 0.00582157538673 86 0.05 +7 0.0218951609902 102 0.54 +6 0.0592691422844 106 2.74 + +# YDR444W +height FDR actual_density mean_random_density +3 0.0471745885141 19 0.09 +2 0.126424210259 100 6.55 + +# FAP7 +height FDR actual_density mean_random_density +3 0.0 46 0.0 +2 0.261898929131 47 6.48 + +# SOK1 +height FDR actual_density mean_random_density +>=4 0.0 96 0.0 +3 0.0090626114945 55 0.05 +2 0.237461167319 64 9.01 + +# INT_0_1245 +height FDR actual_density mean_random_density +>=5 0.0 112 0.0 +4 0.0185433558248 43 0.08 +3 0.104471375014 51 1.21 + +# ARG82 +height FDR actual_density mean_random_density +>=10 0.0 1781 0.0 +9 0.0163031906026 54 0.17 +8 0.0955572348292 55 1.51 + +# UTP6 +height FDR actual_density mean_random_density +>=6 0.0 515 0.0 +5 0.0158765790586 44 0.07 +4 0.132964958552 45 1.97 + +# LCD1 +height FDR actual_density mean_random_density +3 0.0 38 0.0 +2 0.0964287798569 50 1.16 + +# SDH4 +height FDR actual_density mean_random_density +3 0.0271981190987 49 0.21 +2 0.222396790632 67 9.78 + +# SUT076 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.129061770973 40 1.4 + +# INT_0_1413 +height FDR actual_density mean_random_density +3 0.0 50 0.0 +2 0.351476088468 51 11.72 + +# INT_0_1410 +height FDR actual_density mean_random_density +>=4 0.0 173 0.0 +3 0.0935737179662 26 0.78 + +# VBA4 +height FDR actual_density mean_random_density +>=3 0.0 76 0.0 +2 0.236120816923 46 4.52 + +# INT_0_1070 +height FDR actual_density mean_random_density +2 0.0400360144058 21 0.12 +1 0.0748654734925 30 50.72 + +# GPD1 +height FDR actual_density mean_random_density +3 0.0 8 0.0 +2 0.20568683348 21 1.2 + +# INT_0_1660 +height FDR actual_density mean_random_density +4 0.0 39 0.0 +3 0.0403397475622 47 0.19 +2 0.307485996909 49 8.09 + +# DAD1 +height FDR actual_density mean_random_density +3 0.0368383104464 19 0.07 +2 0.424667563739 21 5.7 + +# INT_0_1466 +height FDR actual_density mean_random_density +>=5 0.0 601 0.0 +4 0.0255733970909 70 0.23 +3 0.0811956969767 74 2.55 + +# INT_0_1465 +height FDR actual_density mean_random_density +>=9 0.0 19 0.0 +8 0.0747522629112 4 0.03 + +# NRG1 +height FDR actual_density mean_random_density +4 0.0 26 0.0 +3 0.223349235042 33 2.7 + +# SNF11 +height FDR actual_density mean_random_density +3 0.00356216960345 28 0.01 +2 0.286343708524 43 5.09 + +# CUT098 +height FDR actual_density mean_random_density +3 0.0 52 0.0 +2 0.349760797414 54 13.85 + +# tD(GUC)D +height FDR actual_density mean_random_density +9 0.0379005934075 11 0.05 +8 0.0768159487724 31 0.58 + +# CUT092 +height FDR actual_density mean_random_density +4 0.0 1 0.0 +3 0.095593500314 19 0.38 + +# YDR157W +height FDR actual_density mean_random_density +>=4 0.0 152 0.0 +3 0.150002118399 47 2.12 + +# HXT7 +height FDR actual_density mean_random_density +>=6 0.0 77 0.0 +5 0.022680338936 67 0.21 +4 0.0534261453201 116 2.74 + +# ATP22 +height FDR actual_density mean_random_density +3 0.0 45 0.0 +2 0.232967711051 55 5.2 + +# INT_0_973 +height FDR actual_density mean_random_density +>=6 0.0 492 0.0 +5 0.0432660197668 53 0.23 +4 0.0664082499805 56 0.42 + +# INT_0_1368 +height FDR actual_density mean_random_density +>=4 0.0 44 0.0 +3 0.492073549976 9 1.97 + +# CFT1 +height FDR actual_density mean_random_density +3 0.0 35 0.0 +2 0.0839929692328 51 0.43 + +# RPL41B +height FDR actual_density mean_random_density +5 0.0 16 0.0 +4 0.0605129363766 23 0.19 + +# PFA5 +height FDR actual_density mean_random_density +4 0.0211568145286 33 0.07 +3 0.0716200583129 46 0.33 + +# INT_0_1518 +height FDR actual_density mean_random_density +>=5 0.0 212 0.0 +4 0.0543067797533 50 0.37 + +# INT_0_1291 +height FDR actual_density mean_random_density +>=6 0.0 373 0.0 +5 0.0030239630033 33 0.01 +4 0.136275592485 34 1.98 + +# tS(AGA)D1 +height FDR actual_density mean_random_density +6 0.0489278191023 23 0.11 +5 0.11192733175 46 1.73 + +# tK(CUU)D1 +height FDR actual_density mean_random_density +>=15 0.0 105 0.0 +14 0.0228375506798 23 0.06 +13 0.0728356841627 23 0.4 + +# YRA1 +height FDR actual_density mean_random_density +>=3 0.0 69 0.0 +2 0.282274233839 56 9.07 + +# YDR341C +height FDR actual_density mean_random_density +3 0.00905523642838 22 0.02 +2 0.380045513324 28 7.05 + +# tK(CUU)D2 +height FDR actual_density mean_random_density +>=12 0.0 39 0.0 +11 0.0408262510463 24 0.18 +10 0.115183957836 27 0.97 + +# INT_0_1030 +height FDR actual_density mean_random_density +5 0.0 24 0.0 +4 0.055269394754 50 0.51 + +# NPC2 +height FDR actual_density mean_random_density +3 0.0 32 0.0 +2 0.236962554794 50 5.38 + +# CUT539 +height FDR actual_density mean_random_density +3 0.00527969443971 19 0.01 +2 0.325356095968 20 3.86 + +# YDR095C +height FDR actual_density mean_random_density +>=6 0.0 127 0.0 +5 0.0524801573099 42 0.37 + +# CUT065 +height FDR actual_density mean_random_density +>=5 0.0 164 0.0 +4 0.082520193204 38 0.48 + +# INT_0_939 +height FDR actual_density mean_random_density +3 0.0 47 0.0 +2 0.130505435055 48 1.35 + +# SUT468 +height FDR actual_density mean_random_density +4 0.00312038546472 32 0.01 +3 0.105081116034 33 0.71 + +# RPB7 +height FDR actual_density mean_random_density +3 0.0 26 0.0 +2 0.23111552868 27 2.26 + +# ARP10 +height FDR actual_density mean_random_density +4 0.0 20 0.0 +3 0.0616844651503 42 0.38 + +# TRP4 +height FDR actual_density mean_random_density +3 0.0 47 0.0 +2 0.246839402817 49 5.64 + +# tE(CUC)D +height FDR actual_density mean_random_density +>=47 0.0 527 0.0 +46 0.00451176687185 47 0.02 +45 0.0157911840515 47 0.07 +44 0.031775430646 47 0.15 +43 0.042647659847 48 0.22 +42 0.0597438262976 49 0.44 + +# tR(UCU)D +height FDR actual_density mean_random_density +>=12 0.0 40 0.0 +11 0.0292772019078 16 0.07 +10 0.0826727237099 16 0.23 + +# INT_0_1556 +height FDR actual_density mean_random_density +>=4 0.0 161 0.0 +3 0.0413652842848 63 0.56 +2 0.135855874815 154 18.98 + +# INT_0_1554 +height FDR actual_density mean_random_density +6 0.0 2 0.0 +5 0.791135796094 3 0.44 + +# INT_0_1393 +height FDR actual_density mean_random_density +>=6 0.0 58 0.0 +5 0.449199640598 7 0.62 + +# LCB2 +height FDR actual_density mean_random_density +3 0.0 46 0.0 +2 0.200558220507 55 3.64 + +# GRX2 +height FDR actual_density mean_random_density +3 0.0499928175482 26 0.13 +2 0.332348038247 31 6.47 + +# INT_0_1077 +height FDR actual_density mean_random_density +3 0.0 78 0.0 +2 0.155949262431 93 8.29 + +# GRX6 +height FDR actual_density mean_random_density +6 0.0 17 0.0 +5 0.00829166036647 60 0.09 +4 0.0721721418252 74 1.76 + +# INT_0_1176 +height FDR actual_density mean_random_density +>=3 0.0 44 0.0 +2 0.130929581043 24 0.75 + +# YDR133C +height FDR actual_density mean_random_density +>=6 0.0 63 0.0 +5 0.027922214122 51 0.21 +4 0.154089815636 54 3.91 + +# tL(UAA)D +height FDR actual_density mean_random_density +6 0.0 12 0.0 +5 0.0214232944153 19 0.04 +4 0.160303674056 20 1.3 + +# CUT499 +height FDR actual_density mean_random_density +>=5 0.0 32 0.0 +4 0.0564667632927 23 0.18 + +# HTA1 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.232673543484 21 1.35 + +# FDC1 +height FDR actual_density mean_random_density +>=4 0.0 68 0.0 +3 0.0660948160834 50 0.36 + +# YDL124W +height FDR actual_density mean_random_density +>=5 0.0 30 0.0 +4 0.0925784948248 55 1.37 + +####### chromosome chrIX ####### + +# RPN2 +height FDR actual_density mean_random_density +3 0.0135781251385 22 0.03 +2 0.190329381434 32 2.11 + +# INT_0_2012 +height FDR actual_density mean_random_density +3 0.0 4 0.0 +2 0.310081796063 20 2.45 + +# tE(UUC)I +height FDR actual_density mean_random_density +>=10 0.0 31 0.0 +9 0.0186462362302 22 0.04 +8 0.114385334771 25 0.67 + +# CUT667 +height FDR actual_density mean_random_density +>=7 0.0 90 0.0 +6 0.0047677090053 21 0.01 +5 0.0385225712647 21 0.14 +4 0.184280441485 22 1.69 + +# tK(CUU)I +height FDR actual_density mean_random_density +>=10 0.0 36 0.0 +9 0.0246198907879 26 0.08 +8 0.0602660123652 28 0.45 + +# INT_0_2243 +height FDR actual_density mean_random_density +4 0.0 51 0.0 +3 0.0383403808188 52 0.2 +2 0.261225202461 55 7.08 + +# INT_0_2123 +height FDR actual_density mean_random_density +3 0.0 16 0.0 +2 0.268289907003 21 2.31 + +# INT_0_2087 +height FDR actual_density mean_random_density +3 0.0 30 0.0 +2 0.171012590122 31 1.21 + +# SQT1 +height FDR actual_density mean_random_density +4 0.0 44 0.0 +3 0.0191746963712 52 0.1 +2 0.261606270867 54 7.48 + +# YIL169C +height FDR actual_density mean_random_density +2 0.0110621094083 18 0.02 +1 0.101967972724 19 36.76 + +# INT_0_2039 +height FDR actual_density mean_random_density +>=3 0.0 72 0.0 +2 0.159698600706 28 1.2 + +# TAO3 +height FDR actual_density mean_random_density +3 0.0 24 0.0 +2 0.0250265478964 32 0.14 +1 0.0511453453362 54 109.6 + +# INT_0_1991 +height FDR actual_density mean_random_density +>=3 0.0 90 0.0 +2 0.320600419106 25 4.61 + +# INT_0_2234 +height FDR actual_density mean_random_density +3 0.0 47 0.0 +2 0.239696579199 49 5.57 + +# SYG1 +height FDR actual_density mean_random_density +3 0.0462276741347 39 0.2 +2 0.146550399713 120 11.39 + +# CUT669 +height FDR actual_density mean_random_density +4 0.0 14 0.0 +3 0.0137390787479 27 0.06 +2 0.331795210335 35 10.6 + +# CUT192 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.199802459172 31 1.69 + +# SUT193 +height FDR actual_density mean_random_density +3 0.0 25 0.0 +2 0.172082116568 36 1.89 + +# INT_0_2220 +height FDR actual_density mean_random_density +>=4 0.0 74 0.0 +3 0.0412995156628 41 0.17 +2 0.229849057073 50 5.97 + +# RSM25 +height FDR actual_density mean_random_density +4 0.0 24 0.0 +3 0.0995493185996 52 1.66 + +# INT_0_2053 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.0758494037985 21 0.16 + +# SUT188 +height FDR actual_density mean_random_density +3 0.0263697257906 46 0.17 +2 0.192568555203 72 7.98 + +# INT_0_2112 +height FDR actual_density mean_random_density +3 0.0 28 0.0 +2 0.237410580754 29 2.48 + +# TID3 +height FDR actual_density mean_random_density +3 0.0 37 0.0 +2 0.1824521033 53 3.33 + +# GUT2 +height FDR actual_density mean_random_density +>=5 0.0 139 0.0 +4 0.0209762540045 95 0.32 +3 0.0857043636147 111 4.65 + +# tE(CUC)I +height FDR actual_density mean_random_density +>=44 0.0 617 0.0 +43 0.00250790659629 42 0.01 +42 0.00556981080763 43 0.03 +41 0.0139125279752 43 0.1 +40 0.0328260455915 44 0.26 +39 0.0457219807274 44 0.52 +38 0.077764170732 45 1.09 + +# SUP17 +height FDR actual_density mean_random_density +>=36 0.0 892 0.0 +35 0.00243587549185 43 0.01 +34 0.011037995599 43 0.06 +33 0.0277470442213 44 0.2 +32 0.0550299480428 44 0.46 + +# KGD1 +height FDR actual_density mean_random_density +3 0.0 31 0.0 +2 0.123126903738 53 1.79 + +# INT_0_2164 +height FDR actual_density mean_random_density +2 0.0 17 0.0 +1 0.12843817612 21 37.58 + +# DJP1 +height FDR actual_density mean_random_density +4 0.0389409013691 41 0.16 +3 0.0794222701173 46 0.5 + +# INT_0_2070 +height FDR actual_density mean_random_density +>=4 0.0 163 0.0 +3 0.059134053046 39 0.44 + +# QDR2 +height FDR actual_density mean_random_density +>=6 0.0 561 0.0 +5 0.0386749100357 75 0.71 +4 0.0849524295508 122 8.18 + +# YIR035C +height FDR actual_density mean_random_density +4 0.0 31 0.0 +3 0.0238082408284 42 0.1 +2 0.291524490559 53 10.67 + +# tD(GUC)I2 +height FDR actual_density mean_random_density +>=12 0.0 20 0.0 +11 0.0234686276387 29 0.1 +10 0.0654226099691 29 0.36 + +# tD(GUC)I1 +height FDR actual_density mean_random_density +10 0.0250135748166 4 0.01 +9 0.0878734030613 17 0.21 + +# PFK26 +height FDR actual_density mean_random_density +2 0.0 18 0.0 +1 0.0794026954775 27 44.75 + +# INT_0_1972 +height FDR actual_density mean_random_density +>=5 0.0 49 0.0 +4 0.0796399680799 40 0.32 + +# INT_0_1992 +height FDR actual_density mean_random_density +3 0.0103011567934 29 0.03 +2 0.194216157741 65 7.99 + +# INT_0_2060 +height FDR actual_density mean_random_density +>=3 0.0 24 0.0 +2 0.146335934586 43 2.56 + +# ARC15 +height FDR actual_density mean_random_density +>=4 0.0 50 0.0 +3 0.0681340158265 42 0.87 + +# INT_0_2149 +height FDR actual_density mean_random_density +4 0.0 43 0.0 +3 0.108437321517 44 1.18 + +# INT_0_1964 +height FDR actual_density mean_random_density +>=3 0.0 79 0.0 +2 0.114448219252 85 4.87 + +# RHR2 +height FDR actual_density mean_random_density +>=8 0.0 35 0.0 +7 0.0199534544349 25 0.05 +6 0.0210702234995 89 0.25 +5 0.0574051318915 99 2.05 + +# SSM4 +height FDR actual_density mean_random_density +3 0.0 34 0.0 +2 0.0808640266395 48 0.85 + +# SEC28 +height FDR actual_density mean_random_density +>=4 0.0 55 0.0 +3 0.064551437559 63 0.52 + +####### chromosome chrV ####### + +# RPN3 +height FDR actual_density mean_random_density +>=4 0.0 36 0.0 +3 0.0166243004224 42 0.07 +2 0.259633759411 55 10.24 + +# PUP3 +height FDR actual_density mean_random_density +>=5 0.0 70 0.0 +4 0.090719523903 25 0.39 + +# SNR14 +height FDR actual_density mean_random_density +>=9 0.0 93 0.0 +8 0.0155574990324 26 0.04 +7 0.0693548059337 26 0.33 + +# SUP19 +height FDR actual_density mean_random_density +>=43 0.0 1239 0.0 +42 0.00778286866473 43 0.04 +41 0.0122398790454 44 0.06 +40 0.0193809800408 44 0.13 +39 0.0427091946274 44 0.31 +38 0.0636846052945 45 0.59 + +# ARB1 +height FDR actual_density mean_random_density +4 0.0 32 0.0 +3 0.0924658421657 39 0.78 + +# tK(CUU)E1 +height FDR actual_density mean_random_density +>=14 0.0 53 0.0 +13 0.0383455361386 23 0.11 +12 0.0610798817145 25 0.36 + +# tQ(UUG)E1 +height FDR actual_density mean_random_density +12 0.0 12 0.0 +11 0.0659644391852 12 0.11 + +# PAB1 +height FDR actual_density mean_random_density +>=3 0.0 117 0.0 +2 0.305362166489 55 12.89 + +# ALD5 +height FDR actual_density mean_random_density +>=8 0.0 1225 0.0 +7 0.00350678688611 90 0.04 +6 0.0337865382728 94 1.09 +5 0.122643560964 95 7.59 + +# YER130C +height FDR actual_density mean_random_density +4 0.0 12 0.0 +3 0.0598172957841 55 0.76 + +# PDA1 +height FDR actual_density mean_random_density +>=5 0.0 140 0.0 +4 0.0332793221085 48 0.16 +3 0.080705493641 103 4.37 + +# CUT567 +height FDR actual_density mean_random_density +>=8 0.0 65 0.0 +7 0.0289879305571 29 0.14 +6 0.128922269208 30 1.2 + +# GCD11 +height FDR actual_density mean_random_density +>=3 0.0 78 0.0 +2 0.229084501858 51 5.31 + +# UBC8 +height FDR actual_density mean_random_density +>=4 0.0 151 0.0 +3 0.107726512732 56 1.97 + +# INT_0_2296 +height FDR actual_density mean_random_density +>=7 0.0 26 0.0 +6 0.0539867201854 19 0.12 + +# INT_0_2321 +height FDR actual_density mean_random_density +>=4 0.0 58 0.0 +3 0.0383022746262 39 0.15 +2 0.138650947379 79 6.59 + +# CUT542 +height FDR actual_density mean_random_density +>=5 0.0 45 0.0 +4 0.143551100253 16 0.59 + +# INT_0_2480 +height FDR actual_density mean_random_density +>=6 0.0 16 0.0 +5 1.50947116042 2 0.65 + +# INT_0_2482 +height FDR actual_density mean_random_density +>=4 0.0 70 0.0 +3 0.0353406296918 31 0.11 +2 0.297426765687 31 4.86 + +# INT_0_2585 +height FDR actual_density mean_random_density +>=5 0.0 2 0.0 +4 0.796037512111 1 0.08 + +# INT_0_2580 +height FDR actual_density mean_random_density +>=14 0.0 314 0.0 +13 0.00558452616574 36 0.02 +12 0.0134008796998 39 0.07 +11 0.0506749166065 42 0.52 + +# INT_0_2424 +height FDR actual_density mean_random_density +>=4 0.0 221 0.0 +3 0.100254017361 40 0.93 + +# tR(ACG)E +height FDR actual_density mean_random_density +16 0.0333032342049 3 0.01 +15 0.0502973170608 8 0.04 + +# SNR80 +height FDR actual_density mean_random_density +>=11 0.0 74 0.0 +10 0.014448024373 28 0.04 +9 0.0404692191297 29 0.16 +8 0.0771227226187 29 0.56 + +# HIS1 +height FDR actual_density mean_random_density +>=7 0.0 390 0.0 +6 0.0314099924806 42 0.23 +5 0.0514185687634 56 0.81 + +# SER3 +height FDR actual_density mean_random_density +>=6 0.0 342 0.0 +5 0.0152418595713 81 0.15 +4 0.0633540005996 84 1.93 + +# INT_0_2627 +height FDR actual_density mean_random_density +7 0.0 1 0.0 +6 1.50665881016 1 0.18 + +# INT_0_2626 +height FDR actual_density mean_random_density +>=3 0.0 59 0.0 +2 0.170120926807 51 4.18 + +# SUT510 +height FDR actual_density mean_random_density +4 0.0199508809554 35 0.07 +3 0.0957525384007 49 1.03 + +# CUT110 +height FDR actual_density mean_random_density +4 0.0 21 0.0 +3 0.106348897257 24 0.46 + +# RPR1 +height FDR actual_density mean_random_density +9 0.0 7 0.0 +8 0.0427236195461 7 0.03 +7 0.112171201803 30 0.87 + +# INT_0_2456 +height FDR actual_density mean_random_density +>=3 0.0 70 0.0 +2 0.113002119807 39 1.13 + +# INT_0_2346 +height FDR actual_density mean_random_density +2 0.0435557361388 16 0.07 +1 0.0873740238931 30 45.55 + +# YER088W-B +height FDR actual_density mean_random_density +>=7 0.0 555 0.0 +6 0.0213790744245 42 0.09 +5 0.0825891812566 46 0.86 + +# YEL045C +height FDR actual_density mean_random_density +>=8 0.0 834 0.0 +7 0.0359397461226 51 0.33 +6 0.0825420277061 56 1.43 + +# SCR1 +height FDR actual_density mean_random_density +>=16 0.0 474 0.0 +15 0.00524539425954 77 0.04 +14 0.0122285062745 78 0.13 +13 0.0205203234779 83 0.29 +12 0.0351671394414 85 0.66 +11 0.0606913363354 86 1.74 + +# SNR52 +height FDR actual_density mean_random_density +14 0.0 11 0.0 +13 0.0297813364808 24 0.07 +12 0.0473347085875 31 0.24 +11 0.0728809247719 38 0.61 + +# SUT503 +height FDR actual_density mean_random_density +>=14 0.0 281 0.0 +13 0.00347883805239 29 0.01 +12 0.0174975491121 30 0.07 +11 0.0585354585516 40 0.47 + +# INT_0_2297 +height FDR actual_density mean_random_density +12 0.0 2 0.0 +11 0.67892858858 2 0.29 + +# SNR4 +height FDR actual_density mean_random_density +>=13 0.0 188 0.0 +12 0.0799440223492 14 0.15 + +# CUT108 +height FDR actual_density mean_random_density +>=9 0.0 217 0.0 +8 0.0182645937181 33 0.06 +7 0.0423547736376 35 0.27 +6 0.113412769469 53 1.82 + +# CUT106 +height FDR actual_density mean_random_density +3 0.0 8 0.0 +2 0.275220152085 21 2.64 + +# GDI1 +height FDR actual_density mean_random_density +3 0.0332003001169 18 0.06 +2 0.240715896919 20 2.17 + +# SLX8 +height FDR actual_density mean_random_density +>=4 0.0 119 0.0 +3 0.0497953425504 51 0.34 +2 0.347450131101 54 17.07 + +# CUT551 +height FDR actual_density mean_random_density +5 0.0 20 0.0 +4 0.0272148646388 22 0.06 +3 0.185055463576 24 1.68 + +# SIT1 +height FDR actual_density mean_random_density +4 0.0 13 0.0 +3 0.026207712145 19 0.05 +2 0.181518408129 75 8.66 + +# INT_0_2596 +height FDR actual_density mean_random_density +>=3 0.0 52 0.0 +2 0.116890697183 55 2.11 + +# HYP2 +height FDR actual_density mean_random_density +>=8 0.0 409 0.0 +7 0.0218819769828 55 0.12 +6 0.0594731684416 56 0.64 + +# YER158W-A +height FDR actual_density mean_random_density +5 0.0 8 0.0 +4 0.0249877715496 28 0.07 +3 0.131315724079 32 1.22 + +# PRB1 +height FDR actual_density mean_random_density +>=7 0.0 222 0.0 +5 0.0291911777204 89 0.27 +6 0.0313954085334 54 0.17 +4 0.069739037226 96 2.61 + +# RNR1 +height FDR actual_density mean_random_density +4 0.0 27 0.0 +3 0.0498146415221 38 0.19 +2 0.21097955883 53 5.02 + +# SRG1 +height FDR actual_density mean_random_density +>=7 0.0 154 0.0 +6 0.013676903428 44 0.06 +5 0.0823592942905 47 1.14 + +# tH(GUG)E2 +height FDR actual_density mean_random_density +11 0.0250135748166 4 0.01 +10 0.0880336229691 8 0.07 + +# INT_0_2607 +height FDR actual_density mean_random_density +3 0.0 46 0.0 +2 0.128058477932 54 2.02 + +# GLY1 +height FDR actual_density mean_random_density +>=8 0.0 834 0.0 +7 0.0138221143906 51 0.08 +6 0.0430391430174 56 0.42 +5 0.134280390239 57 4.35 + +# INT_0_2675 +height FDR actual_density mean_random_density +4 0.0 39 0.0 +3 0.070688500955 55 0.55 + +# INT_0_2603 +height FDR actual_density mean_random_density +>=4 0.0 76 0.0 +3 0.0603892067438 35 0.32 + +# tK(CUU)E2 +height FDR actual_density mean_random_density +>=15 0.0 48 0.0 +14 0.0410298532452 22 0.14 +13 0.0684200901286 25 0.31 + +# INT_0_2620 +height FDR actual_density mean_random_density +3 0.0 1 0.0 +2 4.13562605752 1 0.83 + +# INT_0_2430 +height FDR actual_density mean_random_density +>=4 0.0 36 0.0 +3 0.0894782930672 20 0.25 + +# AVT6 +height FDR actual_density mean_random_density +>=3 0.0 39 0.0 +2 0.191488019417 49 6.57 + +# INT_0_2577 +height FDR actual_density mean_random_density +3 0.00452661961574 22 0.01 +2 0.241538701183 25 2.82 + +# INT_0_2584 +height FDR actual_density mean_random_density +>=5 0.0 86 0.0 +4 0.080599456474 39 0.66 + +# RAD23 +height FDR actual_density mean_random_density +>=5 0.0 162 0.0 +4 0.0107834305932 37 0.04 +3 0.201467441805 40 3.1 + +# INT_0_2345 +height FDR actual_density mean_random_density +>=7 0.0 76 0.0 +6 0.0100320098947 40 0.04 +5 0.0391573201279 41 0.16 +4 0.0947683193283 45 1.1 + +# INT_0_2554 +height FDR actual_density mean_random_density +>=6 0.0 145 0.0 +5 0.00909999702914 33 0.05 +4 0.175179916626 34 2.56 + +# MCM3 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.201288815821 23 1.52 + +# CUT571 +height FDR actual_density mean_random_density +>=6 0.0 27 0.0 +5 0.0208402635143 24 0.05 +4 0.136045950923 34 2.1 + +# SUT093 +height FDR actual_density mean_random_density +>=5 0.0 103 0.0 +4 0.0042797334943 96 0.05 +3 0.076830589125 102 2.52 + +# tE(UUC)E3 +height FDR actual_density mean_random_density +8 0.0 13 0.0 +7 0.110236836589 17 0.27 + +# BRR2 +height FDR actual_density mean_random_density +>=3 0.0 81 0.0 +2 0.235399564827 50 4.61 + +####### chromosome chrVI ####### + +# SUP6 +height FDR actual_density mean_random_density +>=19 0.0 314 0.0 +18 0.00887678377162 23 0.02 +17 0.012276927897 25 0.03 +16 0.0510550931761 25 0.33 + +# RIM15 +height FDR actual_density mean_random_density +>=4 0.0 79 0.0 +3 0.027381355079 40 0.11 +2 0.168101920856 77 8.47 + +# HXK1 +height FDR actual_density mean_random_density +5 0.0 20 0.0 +4 0.0606238529987 44 0.4 + +# MDJ1 +height FDR actual_density mean_random_density +>=6 0.0 130 0.0 +5 0.0346300825847 67 0.37 +4 0.108349680977 90 4.5 + +# INT_0_2792 +height FDR actual_density mean_random_density +2 0.0 1 0.0 +1 4.09184677611 1 89.59 + +# VTC2 +height FDR actual_density mean_random_density +3 0.0 32 0.0 +2 0.150889881243 56 3.81 + +# INT_0_2835 +height FDR actual_density mean_random_density +>=3 0.0 156 0.0 +2 0.386842083493 29 8.57 + +# INT_0_2830 +height FDR actual_density mean_random_density +2 0.0157203748398 19 0.03 +1 0.105994058011 20 38.72 + +# tK(CUU)F +height FDR actual_density mean_random_density +11 0.0 13 0.0 +10 0.0243846215184 21 0.05 +9 0.071125535693 22 0.27 + +# INT_0_2762 +height FDR actual_density mean_random_density +3 0.0 15 0.0 +2 0.160964132396 34 1.34 + +# CUT124 +height FDR actual_density mean_random_density +>=6 0.0 58 0.0 +5 0.0487813762641 34 0.3 +4 0.0895981082274 60 2.28 + +# CUT121 +height FDR actual_density mean_random_density +4 0.0 15 0.0 +3 0.014946598049 20 0.03 +2 0.148946363405 47 4.41 + +# ACT1 +height FDR actual_density mean_random_density +>=4 0.0 76 0.0 +3 0.0880087637934 31 0.53 + +# GAT1 +height FDR actual_density mean_random_density +2 0.0390226487264 29 0.16 +1 0.205429318147 31 58.18 + +# GSY1 +height FDR actual_density mean_random_density +>=5 0.0 225 0.0 +4 0.0489933961354 70 0.81 +3 0.167500215606 75 9.08 + +# HAC1 +height FDR actual_density mean_random_density +>=6 0.0 111 0.0 +5 0.041713329208 84 0.58 +4 0.138308033116 91 8.12 + +# RSC8 +height FDR actual_density mean_random_density +3 0.00787190504859 38 0.03 +2 0.214300138815 41 2.88 + +# YFL052W +height FDR actual_density mean_random_density +3 0.0 26 0.0 +2 0.25021033023 30 3.43 + +# YFL032W +height FDR actual_density mean_random_density +7 0.0 33 0.0 +6 0.0361062263645 78 0.73 +5 0.10710332085 84 4.69 + +# INT_0_2771 +height FDR actual_density mean_random_density +3 0.0 1 0.0 +2 5.74932235837 1 1.44 + +# CUT578 +height FDR actual_density mean_random_density +3 0.0378011767594 29 0.11 +2 0.210683196123 53 6.15 + +# SUP11 +height FDR actual_density mean_random_density +>=16 0.0 174 0.0 +15 0.0231751485961 22 0.05 +14 0.0501137212505 22 0.14 + +# INT_0_2689 +height FDR actual_density mean_random_density +>=3 0.0 142 0.0 +2 0.271795677249 51 8.5 + +# CMK1 +height FDR actual_density mean_random_density +5 0.0 8 0.0 +4 0.020620489289 29 0.06 +3 0.0503205647122 39 0.29 + +# AGP3 +height FDR actual_density mean_random_density +>=3 0.0 95 0.0 +2 0.265645673241 49 6.95 + +# YFL002W-A +height FDR actual_density mean_random_density +3 0.0 14 0.0 +2 0.0919171175492 36 0.58 + +# YFL002W-B +height FDR actual_density mean_random_density +3 0.0 14 0.0 +2 0.189637106969 36 2.36 + +# INT_0_2813 +height FDR actual_density mean_random_density +>=5 0.0 149 0.0 +4 0.0202056738882 74 0.15 +3 0.0654758588692 106 3.02 + +# IRC7 +height FDR actual_density mean_random_density +>=4 0.0 44 0.0 +3 0.0575910742043 48 0.52 + +# INT_0_2806 +height FDR actual_density mean_random_density +>=5 0.0 5 0.0 +4 0.516700335565 4 0.33 + +# INT_0_2786 +height FDR actual_density mean_random_density +3 0.0 13 0.0 +2 0.14973273257 26 0.98 + +####### chromosome chrVII ####### + +# CUT634 +height FDR actual_density mean_random_density +4 0.0 25 0.0 +3 0.114085612442 32 0.84 + +# SUT544 +height FDR actual_density mean_random_density +>=9 0.0 182 0.0 +8 0.00290173634868 69 0.02 +7 0.00560478370016 91 0.08 +6 0.034204298163 99 0.73 +5 0.0814541233263 114 4.56 + +# TDH3 +height FDR actual_density mean_random_density +>=9 0.0 61 0.0 +8 0.0133819922117 34 0.07 +7 0.0417040461414 68 0.59 +6 0.0881277943896 91 2.98 + +# SUT543 +height FDR actual_density mean_random_density +3 0.00855867522699 35 0.03 +2 0.358407338455 36 7.9 + +# CUT632 +height FDR actual_density mean_random_density +>=7 0.0 130 0.0 +6 0.0148564966528 27 0.04 +5 0.0814538032109 27 0.4 + +# PDR1 +height FDR actual_density mean_random_density +3 0.0 47 0.0 +2 0.150800897063 53 1.9 + +# GSC2 +height FDR actual_density mean_random_density +3 0.0 48 0.0 +2 0.144235479304 52 1.78 + +# PCT1 +height FDR actual_density mean_random_density +4 0.0257297960734 31 0.08 +3 0.102009468983 67 2.42 + +# SOE1 +height FDR actual_density mean_random_density +9 0.0 12 0.0 +8 0.0546511162344 17 0.16 + +# ERG1 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.241357350112 30 3.25 + +# YGR126W +height FDR actual_density mean_random_density +5 0.0 41 0.0 +4 0.00426040917333 47 0.02 +3 0.101479004577 50 1.47 + +# PMR1 +height FDR actual_density mean_random_density +>=4 0.0 79 0.0 +3 0.0243939947414 44 0.15 +2 0.22799010428 71 16.83 + +# SNR82 +height FDR actual_density mean_random_density +>=8 0.0 151 0.0 +7 0.0292127156774 38 0.11 +6 0.0798884388174 38 0.8 + +# tK(CUU)G2 +height FDR actual_density mean_random_density +>=13 0.0 31 0.0 +12 0.00856553457863 24 0.02 +11 0.0350405250902 25 0.16 +10 0.113348776425 27 0.86 + +# tK(CUU)G1 +height FDR actual_density mean_random_density +>=11 0.0 34 0.0 +10 0.0299793710252 24 0.07 +9 0.0509272918862 26 0.18 + +# SOL4 +height FDR actual_density mean_random_density +4 0.0 15 0.0 +3 0.0159642928758 25 0.04 +2 0.367972914613 29 6.84 + +# INT_0_3519 +height FDR actual_density mean_random_density +>=3 0.0 65 0.0 +2 0.161543956546 39 1.49 + +# CUT598 +height FDR actual_density mean_random_density +4 0.0 25 0.0 +3 0.0515220811732 31 0.16 + +# RPL26B +height FDR actual_density mean_random_density +>=6 0.0 276 0.0 +5 0.0196075007833 51 0.1 +4 0.0805956753454 52 0.77 + +# MUQ1 +height FDR actual_density mean_random_density +>=6 0.0 84 0.0 +5 0.00487094330795 41 0.02 +4 0.0332513576877 61 0.3 +3 0.171391880492 64 7.09 + +# TPO2 +height FDR actual_density mean_random_density +>=4 0.0 72 0.0 +3 0.115926468986 39 0.89 + +# USE1 +height FDR actual_density mean_random_density +>=5 0.0 269 0.0 +4 0.0332177942953 42 0.14 +3 0.133665033558 42 2.28 + +# NAB2 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0845398932106 33 0.56 + +# INT_0_3585 +height FDR actual_density mean_random_density +>=3 0.0 15 0.0 +2 0.091490988739 79 3.01 + +# INT_0_3581 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.159200365425 22 0.66 + +# tE(UUC)G2 +height FDR actual_density mean_random_density +10 0.0 15 0.0 +9 0.0225582572305 17 0.06 +8 0.173681493814 17 0.94 + +# INT_0_2945 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.156330920011 58 4.13 + +# INT_0_3111 +height FDR actual_density mean_random_density +4 0.0 1 0.0 +3 9.27868393134 1 4.97 + +# INT_0_3086 +height FDR actual_density mean_random_density +4 0.0 15 0.0 +3 0.0346796235348 23 0.08 +2 0.3175278977 24 4.64 + +# INT_0_3087 +height FDR actual_density mean_random_density +3 0.00416780741966 24 0.01 +2 0.250369366055 47 10.5 + +# INT_0_3536 +height FDR actual_density mean_random_density +>=3 0.0 33 0.0 +2 0.0892066621543 52 1.82 + +# MRH4 +height FDR actual_density mean_random_density +>=4 0.0 78 0.0 +3 0.0591832876624 32 0.19 + +# TFG2 +height FDR actual_density mean_random_density +>=6 0.0 290 0.0 +5 0.0433610008223 62 0.47 +4 0.134316545698 63 2.51 + +# INT_0_3530 +height FDR actual_density mean_random_density +>=3 0.0 39 0.0 +2 0.104460200818 50 1.6 + +# CPD1 +height FDR actual_density mean_random_density +>=4 0.0 164 0.0 +3 0.102553094905 50 1.67 + +# INT_0_3549 +height FDR actual_density mean_random_density +>=3 0.0 37 0.0 +2 0.0792430856303 21 0.29 + +# VOA1 +height FDR actual_density mean_random_density +>=9 0.0 933 0.0 +8 0.0121510272868 52 0.08 +7 0.0434925607572 58 0.74 +6 0.129656760115 59 4.18 + +# ATG1 +height FDR actual_density mean_random_density +3 0.0 40 0.0 +2 0.15621350084 42 1.71 + +# INT_0_2885 +height FDR actual_density mean_random_density +2 0.0 19 0.0 +1 0.0613004257504 39 57.71 + +# INT_0_3332 +height FDR actual_density mean_random_density +3 0.0 10 0.0 +2 1.2410848607 12 9.05 + +# INT_0_3230 +height FDR actual_density mean_random_density +>=5 0.0 44 0.0 +4 0.0224153605363 40 0.15 +3 0.145589023679 54 3.67 + +# PAC10 +height FDR actual_density mean_random_density +>=4 0.0 110 0.0 +3 0.0671876466794 47 0.57 + +# FMP48 +height FDR actual_density mean_random_density +>=5 0.0 168 0.0 +4 0.0673909362968 50 0.55 + +# INT_0_3206 +height FDR actual_density mean_random_density +3 0.0 26 0.0 +2 0.265875662735 27 3.31 + +# PRP18 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0881580524638 46 0.52 + +# INT_0_2992 +height FDR actual_density mean_random_density +>=4 0.0 213 0.0 +3 0.0821722738268 55 1.31 + +# MAD1 +height FDR actual_density mean_random_density +>=4 0.0 36 0.0 +3 0.312584832687 17 0.93 + +# INT_0_3056 +height FDR actual_density mean_random_density +>=4 0.0 40 0.0 +3 0.119556204781 29 0.63 + +# YGL085W +height FDR actual_density mean_random_density +4 0.0 46 0.0 +3 0.0900127341124 54 0.83 + +# PDX1 +height FDR actual_density mean_random_density +5 0.0 29 0.0 +4 0.0289506071337 31 0.09 +3 0.117587292508 31 0.75 + +# ERG4 +height FDR actual_density mean_random_density +3 0.044962020734 56 0.42 +2 0.417763590811 58 22.38 + +# RSM27 +height FDR actual_density mean_random_density +3 0.0193885185733 23 0.06 +2 0.467892413943 24 8.14 + +# YGL088W +height FDR actual_density mean_random_density +>=24 0.0 3039 0.0 +23 0.00120265767403 84 0.01 +22 0.00696243422296 86 0.09 +21 0.0192907925391 86 0.52 +20 0.0459457070014 86 1.67 +19 0.0829851234332 87 3.95 + +# YGR038C-B +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.172245218323 55 3.17 + +# TOS3 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.110000503925 18 0.35 + +# INT_0_3477 +height FDR actual_density mean_random_density +3 0.0263549523802 40 0.15 +2 0.1859193131 49 5.44 + +# ECL1 +height FDR actual_density mean_random_density +>=6 0.0 164 0.0 +5 0.0295614975105 44 0.13 +4 0.059114268001 45 0.57 + +# YGR035C +height FDR actual_density mean_random_density +>=7 0.0 11 0.0 +6 0.0206078424874 34 0.07 +5 0.0357984235057 42 0.15 +4 0.115659899512 52 1.93 + +# PBP1 +height FDR actual_density mean_random_density +>=4 0.0 98 0.0 +3 0.0359246212168 43 0.26 +2 0.300167391584 68 20.75 + +# TNA1 +height FDR actual_density mean_random_density +4 0.0 41 0.0 +3 0.0656639767681 45 0.62 + +# RAD54 +height FDR actual_density mean_random_density +4 0.0 25 0.0 +3 0.0640569684044 42 0.27 + +# CUT164 +height FDR actual_density mean_random_density +4 0.04260402818 23 0.13 +3 0.173288310721 24 0.95 + +# INT_0_3484 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.361627009763 26 5.97 + +# tK(CUU)G3 +height FDR actual_density mean_random_density +>=15 0.0 93 0.0 +14 0.0164677441992 25 0.04 +13 0.0284809155647 26 0.09 +12 0.0538985049859 27 0.27 + +# SNR7-L +height FDR actual_density mean_random_density +6 0.0250616018155 16 0.04 +5 0.0975074782522 29 0.51 + +# INT_0_3253 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.0420748189741 57 0.33 +1 0.0526890820912 66 139.66 + +# ENO1 +height FDR actual_density mean_random_density +>=10 0.0 296 0.0 +9 0.0146032567136 96 0.14 +8 0.0297532640467 99 0.54 +7 0.0633814138009 109 1.88 + +# INT_0_3395 +height FDR actual_density mean_random_density +4 0.0 18 0.0 +3 0.0966373425336 21 0.41 + +# INT_0_3420 +height FDR actual_density mean_random_density +>=4 0.0 84 0.0 +3 0.110879829121 20 0.48 + +# SNR10 +height FDR actual_density mean_random_density +>=37 0.0 2176 0.0 +36 0.0116863756744 53 0.07 +35 0.0200273973045 53 0.16 +34 0.034024079523 54 0.36 +33 0.0557726845886 55 0.8 + +# CUT631 +height FDR actual_density mean_random_density +>=4 0.0 38 0.0 +3 0.116622583974 20 0.56 + +# HXK2 +height FDR actual_density mean_random_density +4 0.00481888726142 83 0.04 +3 0.0890707250956 87 2.26 + +# RPL1B +height FDR actual_density mean_random_density +4 0.0 44 0.0 +3 0.105548367843 48 1.45 + +# INT_0_2958 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.407721165878 21 4.58 + +# MTC3 +height FDR actual_density mean_random_density +3 0.00869222531306 23 0.02 +2 0.220977947086 24 2.08 + +# INT_0_2950 +height FDR actual_density mean_random_density +>=4 0.0 113 0.0 +3 0.0519616290064 63 0.74 + +# FLC3 +height FDR actual_density mean_random_density +>=4 0.0 56 0.0 +3 0.020383941974 44 0.09 +2 0.228833250188 72 8.74 + +# INT_0_3435 +height FDR actual_density mean_random_density +3 0.0 2 0.0 +2 1.59448242224 3 1.84 + +# MET13 +height FDR actual_density mean_random_density +3 0.0421850532334 52 0.22 +2 0.18069919537 83 8.4 + +# INT_0_3533 +height FDR actual_density mean_random_density +>=3 0.0 86 0.0 +2 0.110261875582 81 4.54 + +# INT_0_3228 +height FDR actual_density mean_random_density +3 0.0 10 0.0 +2 0.167441809245 53 2.97 + +# RTS3 +height FDR actual_density mean_random_density +>=5 0.0 50 0.0 +4 0.0436907470672 21 0.11 +3 0.120339105689 26 0.61 + +# INT_0_3283 +height FDR actual_density mean_random_density +>=4 0.0 265 0.0 +3 0.0182963518055 49 0.09 +2 0.461672638791 56 22.0 + +# CUT619 +height FDR actual_density mean_random_density +3 0.0157589503206 19 0.03 +2 0.298989115424 44 6.74 + +# INT_0_3440 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.132279653369 43 2.1 + +# NUP145 +height FDR actual_density mean_random_density +3 0.0 40 0.0 +2 0.133961358922 44 1.16 + +# OLE1 +height FDR actual_density mean_random_density +>=5 0.0 298 0.0 +4 0.0781269570082 68 1.62 + +# CRM1 +height FDR actual_density mean_random_density +3 0.0233163282087 47 0.11 +2 0.228976655076 54 5.78 + +# INT_0_3107 +height FDR actual_density mean_random_density +>=4 0.0 180 0.0 +3 0.0911357239082 41 0.64 + +# INT_0_3263 +height FDR actual_density mean_random_density +>=9 0.0 69 0.0 +8 0.0319961501112 29 0.13 +7 0.109007499279 31 0.8 + +# XKS1 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.00604085388412 33 0.02 +2 0.227710901949 36 3.12 + +# SNR46 +height FDR actual_density mean_random_density +>=9 0.0 145 0.0 +8 0.0459137055838 28 0.18 +7 0.0766553842753 38 0.71 + +# tC(GCA)G +height FDR actual_density mean_random_density +6 0.0 16 0.0 +5 0.13368652241 16 0.46 + +# PYC1 +height FDR actual_density mean_random_density +4 0.0373419764832 32 0.12 +3 0.0402913641097 98 1.07 +2 0.151234262408 147 28.41 + +# INT_0_3362 +height FDR actual_density mean_random_density +>=3 0.0 130 0.0 +2 0.201705128546 43 4.17 + +# TYS1 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.339948685169 25 4.13 + +# INT_0_3405 +height FDR actual_density mean_random_density +>=3 0.0 40 0.0 +2 0.238471661044 29 3.02 + +# INT_0_3561 +height FDR actual_density mean_random_density +4 0.0 35 0.0 +3 0.0443247566549 36 0.16 +2 0.356065851088 37 6.95 + +# SNG1 +height FDR actual_density mean_random_density +3 0.0 33 0.0 +2 0.215419100566 43 3.08 + +# PAN2 +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.0693295911952 41 0.38 + +# YIP4 +height FDR actual_density mean_random_density +3 0.00966848851809 31 0.03 +2 0.333908960899 34 6.17 + +# YIP5 +height FDR actual_density mean_random_density +3 0.0418058093159 43 0.18 +2 0.264501892419 44 6.76 + +# CUT156 +height FDR actual_density mean_random_density +6 0.0 17 0.0 +5 0.0621179161242 18 0.13 + +# CUT150 +height FDR actual_density mean_random_density +>=7 0.0 46 0.0 +6 0.0159428860938 19 0.03 +5 0.0644573643411 24 0.36 + +# CUT159 +height FDR actual_density mean_random_density +>=6 0.0 56 0.0 +5 0.0354130336494 20 0.08 +4 0.114048385428 26 0.81 + +# INT_0_3312 +height FDR actual_density mean_random_density +>=5 0.0 74 0.0 +4 0.119135983712 26 0.75 + +# INT_0_3317 +height FDR actual_density mean_random_density +4 0.0 35 0.0 +3 0.0276534053871 36 0.1 +2 0.219766656178 37 2.94 + +# INT_0_3480 +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.214369612025 25 1.68 + +# SUT555 +height FDR actual_density mean_random_density +>=5 0.0 223 0.0 +4 0.0288280757594 45 0.22 +3 0.259991726711 46 8.29 + +# PNC1 +height FDR actual_density mean_random_density +>=8 0.0 121 0.0 +7 0.0312225555278 61 0.19 +6 0.0546495301105 65 0.61 + +# VID30 +height FDR actual_density mean_random_density +4 0.0 40 0.0 +3 0.0208070974293 45 0.13 +2 0.279384275096 53 7.28 + +# INT_0_3222 +height FDR actual_density mean_random_density +>=9 0.0 25 0.0 +8 0.0712606452903 7 0.05 + +# INT_0_3383 +height FDR actual_density mean_random_density +>=3 0.0 71 0.0 +2 0.120977922869 50 2.64 + +# INT_0_3386 +height FDR actual_density mean_random_density +4 0.0 3 0.0 +3 0.947752443184 3 0.48 + +# ADE5_7 +height FDR actual_density mean_random_density +>=5 0.0 71 0.0 +4 0.00249138555321 40 0.01 +3 0.0680145965998 67 1.31 + +# YGR149W +height FDR actual_density mean_random_density +2 0.0166015514702 18 0.03 +1 0.1404654402 19 36.51 + +# UBR1 +height FDR actual_density mean_random_density +>=3 0.0 93 0.0 +2 0.209376869062 39 2.79 + +# YGR237C +height FDR actual_density mean_random_density +3 0.0461090261158 30 0.18 +2 0.278651442093 44 6.24 + +# INT_0_3297 +height FDR actual_density mean_random_density +3 0.0157197619166 19 0.03 +2 0.291773731662 20 2.16 + +# INT_0_3296 +height FDR actual_density mean_random_density +>=4 0.0 36 0.0 +3 0.0367480484336 51 0.27 +2 0.1551030811 116 17.32 + +# INT_0_3416 +height FDR actual_density mean_random_density +3 0.0 41 0.0 +2 0.10128930106 101 5.67 + +# SER2 +height FDR actual_density mean_random_density +3 0.0213798677814 28 0.06 +2 0.244958421457 36 3.28 + +# INT_0_3594 +height FDR actual_density mean_random_density +>=3 0.0 42 0.0 +2 0.199399375767 55 4.1 + +# TAF1 +height FDR actual_density mean_random_density +3 0.0 31 0.0 +2 0.136422751647 35 1.39 + +# CHC1 +height FDR actual_density mean_random_density +>=3 0.0 177 0.0 +2 0.282524831332 55 9.64 + +# INT_0_3181 +height FDR actual_density mean_random_density +2 0.0 29 0.0 +1 0.127600909723 31 59.49 + +# MAL13 +height FDR actual_density mean_random_density +>=5 0.0 252 0.0 +4 0.0530147299968 77 1.15 + +# HUA1 +height FDR actual_density mean_random_density +3 0.0 6 0.0 +2 0.2638326003 35 5.16 + +# INT_0_3070 +height FDR actual_density mean_random_density +6 0.0 26 0.0 +5 0.0329017517136 26 0.12 +4 0.304177867852 26 2.74 + +# INT_0_3174 +height FDR actual_density mean_random_density +>=4 0.0 53 0.0 +3 0.0314315471775 19 0.06 +2 0.272111136797 20 1.98 + +# INT_0_3273 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.116187668817 55 2.3 + +# INT_0_3277 +height FDR actual_density mean_random_density +>=16 0.0 1181 0.0 +15 0.0146578162921 49 0.2 +14 0.0683923920751 50 1.09 + +# tR(UCU)G2 +height FDR actual_density mean_random_density +>=13 0.0 51 0.0 +12 0.00713136963823 33 0.03 +11 0.0568026298746 33 0.4 + +# tR(UCU)G3 +height FDR actual_density mean_random_density +6 0.0 1 0.0 +5 0.232540380888 13 0.99 + +# YGR210C +height FDR actual_density mean_random_density +>=6 0.0 255 0.0 +5 0.0181466638797 44 0.08 +4 0.171397679422 45 3.82 + +# YTA7 +height FDR actual_density mean_random_density +>=3 0.0 66 0.0 +2 0.178494020104 43 2.2 + +# YGR161C-D +height FDR actual_density mean_random_density +3 0.0 32 0.0 +2 0.182321007589 102 9.7 + +# INT_0_3415 +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.192422722577 30 2.34 + +# INT_0_3417 +height FDR actual_density mean_random_density +3 0.0 35 0.0 +2 0.248934040474 37 3.88 + +# TAM41 +height FDR actual_density mean_random_density +>=3 0.0 94 0.0 +2 0.349964136742 26 5.94 + +# RPL30 +height FDR actual_density mean_random_density +>=5 0.0 77 0.0 +4 0.0800479761021 48 0.62 + +# INT_0_2899 +height FDR actual_density mean_random_density +>=5 0.0 574 0.0 +4 0.0572277856578 52 0.43 + +####### chromosome chrVIII ####### + +# YHR218W +height FDR actual_density mean_random_density +3 0.0 6 0.0 +2 0.212986662535 26 1.45 + +# CUT637 +height FDR actual_density mean_random_density +3 0.0411886936348 33 0.19 +2 0.319137908065 46 8.2 + +# INT_0_3630 +height FDR actual_density mean_random_density +>=3 0.0 77 0.0 +2 0.2649285623 42 6.19 + +# SUT148 +height FDR actual_density mean_random_density +3 0.0 32 0.0 +2 0.268193032119 51 7.76 + +# INT_0_3636 +height FDR actual_density mean_random_density +>=5 0.0 214 0.0 +4 0.0286659414307 73 0.21 +3 0.0704370975543 107 3.19 + +# TRM5 +height FDR actual_density mean_random_density +>=8 0.0 316 0.0 +7 0.0818662818663 11 0.1 + +# tQ(UUG)H +height FDR actual_density mean_random_density +>=11 0.0 20 0.0 +10 0.0495594368313 16 0.14 +9 0.148347973422 17 0.49 + +# NVJ1 +height FDR actual_density mean_random_density +4 0.0 50 0.0 +3 0.057315671992 71 0.96 + +# YHR095W +height FDR actual_density mean_random_density +6 0.0 30 0.0 +5 0.0546858351274 33 0.18 + +# DSE2 +height FDR actual_density mean_random_density +>=3 0.0 59 0.0 +2 0.267522783402 47 6.67 + +# INT_0_3836 +height FDR actual_density mean_random_density +>=3 0.0 146 0.0 +2 0.211535228845 41 5.28 + +# YHR009C +height FDR actual_density mean_random_density +3 0.0223981810648 49 0.11 +2 0.260926954888 51 7.99 + +# SPC97 +height FDR actual_density mean_random_density +2 0.0 20 0.0 +1 0.0923723285437 22 41.77 + +# DCD1 +height FDR actual_density mean_random_density +3 0.0099663896477 20 0.02 +2 0.218934690811 22 1.58 + +# BZZ1 +height FDR actual_density mean_random_density +>=3 0.0 95 0.0 +2 0.279496620517 52 9.24 + +# OSH3 +height FDR actual_density mean_random_density +4 0.0 51 0.0 +3 0.0627542448456 51 0.35 + +# MSR1 +height FDR actual_density mean_random_density +3 0.0 31 0.0 +2 0.160924979322 52 2.37 + +# ARO9 +height FDR actual_density mean_random_density +3 0.0 29 0.0 +2 0.325730117577 30 4.39 + +# RIM101 +height FDR actual_density mean_random_density +3 0.0316075268291 41 0.13 +2 0.212015018382 43 4.04 + +# INT_0_3666 +height FDR actual_density mean_random_density +>=3 0.0 53 0.0 +2 0.176533830788 21 1.4 + +# UBA4 +height FDR actual_density mean_random_density +>=4 0.0 51 0.0 +3 0.140418745366 47 2.03 + +# PCL5 +height FDR actual_density mean_random_density +>=11 0.0 1309 0.0 +10 0.0182371024484 49 0.12 +9 0.0565569042228 50 0.48 + +# YSC84 +height FDR actual_density mean_random_density +>=5 0.0 313 0.0 +4 0.0615038694654 55 0.53 + +# INT_0_3704 +height FDR actual_density mean_random_density +>=4 0.0 35 0.0 +3 0.287388854668 6 0.22 + +# YHL030W-A +height FDR actual_density mean_random_density +>=7 0.0 279 0.0 +6 0.0287746204459 33 0.17 +5 0.10717455973 36 1.66 + +# INT_0_3883 +height FDR actual_density mean_random_density +4 0.0 27 0.0 +3 0.0856719819319 40 0.6 + +# SUT573 +height FDR actual_density mean_random_density +>=4 0.0 34 0.0 +3 0.0774938920929 18 0.14 + +# STP2 +height FDR actual_density mean_random_density +2 0.0 18 0.0 +1 0.123897680944 32 49.45 + +# RPN10 +height FDR actual_density mean_random_density +>=6 0.0 51 0.0 +5 0.0319204811194 47 0.15 +4 0.0523245914254 57 0.56 + +# INT_0_3658 +height FDR actual_density mean_random_density +>=3 0.0 124 0.0 +2 0.274899190183 49 6.08 + +# CDC23 +height FDR actual_density mean_random_density +4 0.0 47 0.0 +3 0.0498794368878 52 0.26 +2 0.221784367421 73 11.46 + +# INT_0_3653 +height FDR actual_density mean_random_density +2 0.0312913814994 35 0.11 +1 0.0807738076194 37 71.58 + +# INT_0_3994 +height FDR actual_density mean_random_density +>=14 0.0 3989 0.0 +13 0.00169411169262 59 0.01 +12 0.0203293403114 59 0.12 +11 0.0530611717656 60 0.85 + +# SUT164 +height FDR actual_density mean_random_density +>=5 0.0 184 0.0 +4 0.0381538109126 74 0.45 +3 0.105582113172 85 3.96 + +# MRP4 +height FDR actual_density mean_random_density +3 0.0495872033024 34 0.24 +2 0.173451291539 97 14.92 + +# INT_0_3824 +height FDR actual_density mean_random_density +>=3 0.0 80 0.0 +2 0.144965099419 71 3.99 + +# SUT169 +height FDR actual_density mean_random_density +3 0.0 13 0.0 +2 0.202207265882 20 0.98 + +# INT_0_3702 +height FDR actual_density mean_random_density +2 0.00986430346102 52 0.09 +1 0.168442414249 54 104.45 + +# OPI1 +height FDR actual_density mean_random_density +4 0.00199716911882 50 0.01 +3 0.0605176191814 67 0.98 + +# YHR049C-A +height FDR actual_density mean_random_density +>=6 0.0 189 0.0 +5 0.0240129331316 75 0.18 +4 0.0618045127075 90 2.15 + +# PAN5 +height FDR actual_density mean_random_density +>=4 0.0 48 0.0 +3 0.085337539038 52 0.63 + +# GRE3 +height FDR actual_density mean_random_density +4 0.00829981280097 12 0.01 +3 0.124877228482 55 2.3 + +# ENO2 +height FDR actual_density mean_random_density +>=10 0.0 715 0.0 +9 0.00878897548238 150 0.32 +8 0.0340489373408 175 2.47 +7 0.0648137406993 202 9.49 + +# CUT179 +height FDR actual_density mean_random_density +3 0.0110950199282 18 0.02 +2 0.240070080551 21 1.91 + +# tA(AGC)H +height FDR actual_density mean_random_density +11 0.0 12 0.0 +10 0.0188763920759 12 0.03 +9 0.0724446175203 13 0.18 + +# YSP1 +height FDR actual_density mean_random_density +>=4 0.0 276 0.0 +3 0.0909827334391 33 0.52 + +# INT_0_3790 +height FDR actual_density mean_random_density +4 0.0 51 0.0 +3 0.0605788920587 51 0.31 + +####### chromosome chrX ####### + +# INT_0_4150 +height FDR actual_density mean_random_density +4 0.0 1 0.0 +3 0.325832961191 6 0.27 + +# INT_0_4152 +height FDR actual_density mean_random_density +3 0.0 4 0.0 +2 0.122502208954 50 1.69 + +# INT_0_4091 +height FDR actual_density mean_random_density +>=4 0.0 250 0.0 +3 0.0879480160536 46 1.4 + +# TDH1 +height FDR actual_density mean_random_density +>=10 0.0 466 0.0 +9 0.0100458584805 104 0.17 +8 0.0333408405628 122 0.77 +7 0.0605718191547 138 3.12 + +# TDH2 +height FDR actual_density mean_random_density +>=6 0.0 106 0.0 +5 0.0745075380085 41 0.64 + +# CUT221 +height FDR actual_density mean_random_density +>=16 0.0 700 0.0 +15 0.00345544104019 29 0.01 +14 0.0271279867514 29 0.12 +13 0.0759223449147 30 0.43 + +# TPK1 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.116187562972 26 0.8 + +# tR(ACG)J +height FDR actual_density mean_random_density +>=35 0.0 393 0.0 +34 0.00839013877616 40 0.04 +33 0.0219784773275 42 0.17 +32 0.0543614254295 43 0.51 + +# PEP8 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.165534828803 41 2.01 + +# YJR115W +height FDR actual_density mean_random_density +>=4 0.0 82 0.0 +3 0.0699467926247 50 0.7 + +# EMC2 +height FDR actual_density mean_random_density +3 0.040157635468 28 0.16 +2 0.404766460814 31 6.34 + +# CUT677 +height FDR actual_density mean_random_density +5 0.0 8 0.0 +4 0.0198421086457 26 0.08 +3 0.198805408811 29 2.73 + +# IML2 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.334325215454 50 12.6 + +# SUT650 +height FDR actual_density mean_random_density +>=7 0.0 508 0.0 +6 0.00925724947115 111 0.14 +5 0.0388131681243 121 1.86 +4 0.127095504331 125 14.84 + +# INT_0_4233 +height FDR actual_density mean_random_density +>=3 0.0 70 0.0 +2 0.0637833598561 39 0.56 + +# RSF2 +height FDR actual_density mean_random_density +>=4 0.0 283 0.0 +3 0.0915700622072 80 2.59 + +# MNN11 +height FDR actual_density mean_random_density +3 0.0 47 0.0 +2 0.251125493219 54 6.08 + +# SSC1 +height FDR actual_density mean_random_density +3 0.0 35 0.0 +2 0.234525649874 40 4.12 + +# SUP7 +height FDR actual_density mean_random_density +>=18 0.0 303 0.0 +17 0.00443839188581 23 0.01 +16 0.0409230929899 25 0.1 +15 0.0578994283582 26 0.3 + +# MTR4 +height FDR actual_density mean_random_density +3 0.0 24 0.0 +2 0.0940673669458 27 0.38 + +# INT_0_4165 +height FDR actual_density mean_random_density +>=22 0.0 1069 0.0 +21 0.0084113858213 32 0.05 +20 0.0339370338982 33 0.35 +19 0.0669735969856 33 0.84 + +# INT_0_4169 +height FDR actual_density mean_random_density +>=6 0.0 18 0.0 +5 0.1939924457 6 0.17 + +# SUP51 +height FDR actual_density mean_random_density +5 0.0 16 0.0 +4 0.0617612112754 19 0.25 + +# INT_0_4019 +height FDR actual_density mean_random_density +4 0.0 5 0.0 +3 0.169027182406 14 0.31 + +# tR(UCU)J1 +height FDR actual_density mean_random_density +>=10 0.0 15 0.0 +9 0.0144918840222 14 0.02 +8 0.114592558336 14 0.3 + +# FBP26 +height FDR actual_density mean_random_density +4 0.0 30 0.0 +3 0.0621648555692 33 0.25 + +# NUP85 +height FDR actual_density mean_random_density +4 0.0 34 0.0 +3 0.125427037681 38 1.08 + +# INT_0_4341 +height FDR actual_density mean_random_density +2 0.0471707496742 34 0.18 +1 0.151136967827 36 68.88 + +# HMS2 +height FDR actual_density mean_random_density +>=5 0.0 178 0.0 +4 0.0296982282752 48 0.19 +3 0.205642421367 66 6.18 + +# RPS14B +height FDR actual_density mean_random_density +>=4 0.0 141 0.0 +3 0.12073734104 34 1.51 + +# TAD2 +height FDR actual_density mean_random_density +>=6 0.0 193 0.0 +5 0.0828528915733 22 0.4 + +# INT_0_4470 +height FDR actual_density mean_random_density +3 0.0 24 0.0 +2 0.11231458621 27 0.43 + +# INT_0_4331 +height FDR actual_density mean_random_density +5 0.0 31 0.0 +4 0.00769064988521 39 0.03 +3 0.142176216593 49 2.88 + +# OST1 +height FDR actual_density mean_random_density +4 0.0 20 0.0 +3 0.0664355885906 24 0.16 + +# YJR018W +height FDR actual_density mean_random_density +3 0.0 16 0.0 +2 0.225871785211 20 2.17 + +# INT_0_4380 +height FDR actual_density mean_random_density +5 0.0 2 0.0 +4 0.879780768852 4 0.58 + +# INT_0_4383 +height FDR actual_density mean_random_density +>=3 0.0 64 0.0 +2 0.149231552398 37 1.72 + +# SUT634 +height FDR actual_density mean_random_density +4 0.0 10 0.0 +3 0.119715175674 21 0.52 + +# INT_0_4492 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.227876793151 52 5.87 + +# SUP4 +height FDR actual_density mean_random_density +>=19 0.0 308 0.0 +18 0.00425814053851 24 0.01 +17 0.016369237196 25 0.04 +16 0.0341735469459 26 0.19 +15 0.0862797058089 26 0.66 + +# SWE1 +height FDR actual_density mean_random_density +3 0.0 42 0.0 +2 0.242009572856 48 4.95 + +# tK(CUU)J +height FDR actual_density mean_random_density +10 0.0 11 0.0 +9 0.0169940828559 18 0.03 +8 0.133326919354 24 0.76 + +# URA2 +height FDR actual_density mean_random_density +>=3 0.0 89 0.0 +2 0.242327886221 24 2.55 + +# URA8 +height FDR actual_density mean_random_density +>=4 0.0 90 0.0 +3 0.0510114673303 70 0.85 + +# MGM101 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.204027205864 30 2.46 + +# INT_0_4003 +height FDR actual_density mean_random_density +>=3 0.0 29 0.0 +2 0.193298293858 57 4.53 + +# CUT680 +height FDR actual_density mean_random_density +>=6 0.0 31 0.0 +5 0.0900717210242 17 0.17 + +# HSX1 +height FDR actual_density mean_random_density +7 0.0 37 0.0 +6 0.0463658750469 38 0.35 +5 0.233771951414 38 4.09 + +# INT_0_4173 +height FDR actual_density mean_random_density +>=3 0.0 77 0.0 +2 0.0515207433382 52 0.45 + +# INT_0_4170 +height FDR actual_density mean_random_density +>=5 0.0 57 0.0 +4 0.747978828299 6 0.64 + +# SNR3 +height FDR actual_density mean_random_density +>=15 0.0 340 0.0 +14 0.00328491096532 44 0.02 +13 0.0324938497256 45 0.29 +12 0.0881140577565 47 1.36 + +# UBX6 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.158989684974 39 2.51 + +# BNA3 +height FDR actual_density mean_random_density +>=6 0.0 351 0.0 +5 0.0119360280897 30 0.05 +4 0.109840984006 37 1.17 + +# AVT1 +height FDR actual_density mean_random_density +>=5 0.0 99 0.0 +4 0.044380120909 39 0.27 +3 0.151725424021 61 4.14 + +# TAH11 +height FDR actual_density mean_random_density +2 0.0495702470068 21 0.14 +1 0.156672191517 29 52.26 + +# INT_0_4130 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.253602605881 21 2.31 + +# YJL047C-A +height FDR actual_density mean_random_density +7 0.0100980225192 20 0.02 +6 0.112288867889 23 0.62 + +# INT_0_4241 +height FDR actual_density mean_random_density +>=5 0.0 17 0.0 +4 0.0199093641267 5 0.01 +3 2.1233026717 5 5.23 + +# INT_0_4246 +height FDR actual_density mean_random_density +>=3 0.0 68 0.0 +2 0.141950676691 37 1.16 + +# tE(UUC)J +height FDR actual_density mean_random_density +9 0.0 5 0.0 +8 0.022094017094 13 0.04 +7 0.133539264993 17 0.64 + +# ERG20 +height FDR actual_density mean_random_density +5 0.0 17 0.0 +4 0.0149495844715 20 0.03 +3 0.0653450719117 73 1.56 + +# SOD1 +height FDR actual_density mean_random_density +>=4 0.0 43 0.0 +3 0.180230615659 27 1.57 + +# CPA2 +height FDR actual_density mean_random_density +4 0.0 18 0.0 +3 0.12226351974 24 0.51 + +# CUT199 +height FDR actual_density mean_random_density +>=4 0.0 143 0.0 +3 0.192062210119 48 3.73 + +# CUT216 +height FDR actual_density mean_random_density +4 0.0 11 0.0 +3 0.0221483906211 18 0.04 +2 0.399534850561 19 4.82 + +# CUT196 +height FDR actual_density mean_random_density +>=5 0.0 50 0.0 +4 0.0366183065963 41 0.29 +3 0.209723818501 43 5.12 + +# CUT695 +height FDR actual_density mean_random_density +>=3 0.0 35 0.0 +2 0.223923101014 19 1.62 + +# CUT692 +height FDR actual_density mean_random_density +3 0.0158113380553 19 0.03 +2 0.340676996883 26 5.27 + +# tR(UCU)J2 +height FDR actual_density mean_random_density +>=19 0.0 143 0.0 +18 0.019895759836 34 0.09 +17 0.058509009342 34 0.38 + +# BAT2 +height FDR actual_density mean_random_density +>=5 0.0 103 0.0 +4 0.0845343844969 30 0.62 + +# INT_0_4208 +height FDR actual_density mean_random_density +3 0.0 39 0.0 +2 0.0872325156967 47 0.76 + +# INT_0_4197 +height FDR actual_density mean_random_density +>=5 0.0 82 0.0 +4 0.0263681548478 34 0.09 +3 0.0514957983193 35 0.2 + +# RPB4 +height FDR actual_density mean_random_density +4 0.0 24 0.0 +3 0.0383934358603 26 0.1 +2 0.357752156204 27 6.34 + +# INT_0_4105 +height FDR actual_density mean_random_density +>=11 0.0 36 0.0 +10 0.0190891279605 21 0.04 +9 0.0574509934658 21 0.13 + +# TIM8 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.234226111499 20 2.09 + +# SUT648 +height FDR actual_density mean_random_density +4 0.018992423633 21 0.04 +3 0.103864235781 46 1.18 + +# INT_0_4337 +height FDR actual_density mean_random_density +>=4 0.0 132 0.0 +3 0.0421514066703 73 0.54 +2 0.128185596491 127 11.85 + +# CYR1 +height FDR actual_density mean_random_density +2 0.0 34 0.0 +1 0.113762680105 36 69.23 + +# YJL068C +height FDR actual_density mean_random_density +>=4 0.0 114 0.0 +3 0.10695991904 53 1.98 + +# INT_0_4433 +height FDR actual_density mean_random_density +>=7 0.0 38 0.0 +6 0.00344654326197 29 0.01 +5 0.0367865644779 30 0.12 +4 0.102510893923 55 2.08 + +# tS(AGA)J +height FDR actual_density mean_random_density +8 0.0 13 0.0 +7 0.0477985479729 17 0.08 +6 0.106724018683 29 0.75 + +# KAR2 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.155381136848 78 6.11 + +# MHP1 +height FDR actual_density mean_random_density +2 0.0 43 0.0 +1 0.135852008866 55 96.65 + +# tD(GUC)J4 +height FDR actual_density mean_random_density +>=9 0.0 15 0.0 +8 0.0556440465474 20 0.15 + +# tD(GUC)J3 +height FDR actual_density mean_random_density +>=14 0.0 46 0.0 +13 0.0229618229004 14 0.04 +12 0.05127674896 24 0.29 + +# tD(GUC)J2 +height FDR actual_density mean_random_density +>=12 0.0 41 0.0 +11 0.00396576364699 26 0.01 +10 0.0528305370327 28 0.41 + +# tD(GUC)J1 +height FDR actual_density mean_random_density +>=11 0.0 30 0.0 +10 0.0570916802338 20 0.2 + +####### chromosome chrXI ####### + +# INT_0_4719 +height FDR actual_density mean_random_density +>=3 0.0 4 0.0 +2 2.66865686809 3 3.13 + +# INT_0_4524 +height FDR actual_density mean_random_density +2 0.0 17 0.0 +1 0.0841319025455 21 37.74 + +# CUT229 +height FDR actual_density mean_random_density +5 0.0 8 0.0 +4 0.09968496345 10 0.1 + +# UGP1 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.183834073106 49 5.98 + +# INT_0_4889 +height FDR actual_density mean_random_density +>=25 0.0 490 0.0 +24 0.0220828108611 11 0.04 +23 0.103630092123 11 0.24 + +# SUT228 +height FDR actual_density mean_random_density +3 0.0 39 0.0 +2 0.218576298945 41 3.56 + +# SUT222 +height FDR actual_density mean_random_density +>=14 0.0 1094 0.0 +13 0.00786899064291 65 0.06 +12 0.0229126624039 67 0.28 +11 0.0323307512844 75 0.53 +10 0.0580531217875 77 1.36 + +# SUT220 +height FDR actual_density mean_random_density +4 0.0 38 0.0 +3 0.0702911339114 41 0.35 + +# SUT221 +height FDR actual_density mean_random_density +3 0.0 30 0.0 +2 0.206318397918 33 3.07 + +# SIR1 +height FDR actual_density mean_random_density +3 0.0 18 0.0 +2 0.205369297285 19 1.07 + +# INT_0_4627 +height FDR actual_density mean_random_density +3 0.0 30 0.0 +2 0.09712843902 32 0.46 + +# SUT682 +height FDR actual_density mean_random_density +5 0.0 15 0.0 +4 0.0111073640198 18 0.02 +3 0.209745238751 23 1.55 + +# INT_0_4567 +height FDR actual_density mean_random_density +>=4 0.0 84 0.0 +3 0.0272963656936 62 0.17 +2 0.111466609673 106 8.59 + +# INT_0_4861 +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.258999636884 25 2.83 + +# CUT230 +height FDR actual_density mean_random_density +>=6 0.0 4 0.0 +5 0.022499445591 16 0.05 +4 0.134352861214 24 1.0 + +# tK(CUU)K +height FDR actual_density mean_random_density +12 0.0 12 0.0 +11 0.0205222326972 18 0.05 +10 0.0686942558188 20 0.2 + +# CUT235 +height FDR actual_density mean_random_density +>=4 0.0 69 0.0 +3 0.118024968347 28 0.66 + +# INT_0_4863 +height FDR actual_density mean_random_density +>=6 0.0 20 0.0 +5 0.265849903767 7 0.49 + +# LST4 +height FDR actual_density mean_random_density +>=4 0.0 347 0.0 +3 0.108982138915 46 1.65 + +# INT_0_4939 +height FDR actual_density mean_random_density +>=4 0.0 277 0.0 +3 0.00794870977566 45 0.05 +2 0.427538064856 52 22.71 + +# KTI12 +height FDR actual_density mean_random_density +>=5 0.0 58 0.0 +4 0.0485944094614 35 0.22 +3 0.151506645673 38 2.31 + +# DGR2 +height FDR actual_density mean_random_density +>=3 0.0 24 0.0 +2 0.256174066136 13 1.0 + +# AUR1 +height FDR actual_density mean_random_density +3 0.0 49 0.0 +2 0.22721266806 51 4.12 + +# INT_0_4762 +height FDR actual_density mean_random_density +>=3 0.0 112 0.0 +2 0.219362494108 72 10.58 + +# FBA1 +height FDR actual_density mean_random_density +>=7 0.0 120 0.0 +6 0.0814049435676 41 1.03 + +# tR(ACG)K +height FDR actual_density mean_random_density +17 0.0 10 0.0 +16 0.0319167194882 10 0.04 +15 0.105626330976 11 0.27 + +# INT_0_4649 +height FDR actual_density mean_random_density +>=9 0.0 45 0.0 +8 0.0712220463734 7 0.05 + +# INT_0_4648 +height FDR actual_density mean_random_density +>=5 0.0 4 0.0 +4 1.07005178808 2 0.37 + +# INT_0_4645 +height FDR actual_density mean_random_density +4 0.0 20 0.0 +3 0.0580609247534 28 0.23 + +# SAC1 +height FDR actual_density mean_random_density +>=5 0.0 143 0.0 +4 0.0131717254534 53 0.07 +3 0.097231620369 80 3.87 + +# INT_0_4643 +height FDR actual_density mean_random_density +>=3 0.0 13 0.0 +2 0.452459058161 9 1.32 + +# INT_0_4584 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.111258707355 22 0.57 + +# YET1 +height FDR actual_density mean_random_density +>=4 0.0 71 0.0 +3 0.13906742395 20 0.73 + +# INT_0_4872 +height FDR actual_density mean_random_density +3 0.0 29 0.0 +2 0.124912127954 31 0.79 + +# UBA1 +height FDR actual_density mean_random_density +>=4 0.0 91 0.0 +3 0.0768673896266 65 1.32 + +# YKL061W +height FDR actual_density mean_random_density +5 0.0166305923062 18 0.03 +4 0.0652084469972 29 0.29 + +# INT_0_4897 +height FDR actual_density mean_random_density +>=3 0.0 76 0.0 +2 0.189814977887 29 1.97 + +# YKR096W +height FDR actual_density mean_random_density +2 0.0221312505166 36 0.08 +1 0.149811705314 38 73.11 + +# TOA2 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.211554063057 46 4.22 + +# SFK1 +height FDR actual_density mean_random_density +>=4 0.0 95 0.0 +3 0.0465308777029 55 0.4 +2 0.343922604379 56 11.63 + +# SUT666 +height FDR actual_density mean_random_density +4 0.0 30 0.0 +3 0.0857172319846 31 0.46 + +# INT_0_4841 +height FDR actual_density mean_random_density +>=6 0.0 60 0.0 +5 0.188567275597 7 0.36 + +# tA(AGC)K2 +height FDR actual_density mean_random_density +8 0.0183646532774 11 0.02 +7 0.0966501739076 12 0.17 + +# tA(AGC)K1 +height FDR actual_density mean_random_density +>=17 0.0 56 0.0 +16 0.0218137878751 14 0.05 +15 0.0737999246137 14 0.21 + +# KAE1 +height FDR actual_density mean_random_density +>=5 0.0 301 0.0 +4 0.0397536195538 59 0.65 +3 0.250439793869 61 12.92 + +# INT_0_4608 +height FDR actual_density mean_random_density +>=4 0.0 32 0.0 +3 0.040413874219 52 0.45 +2 0.179867450428 87 15.94 + +# INT_0_4529 +height FDR actual_density mean_random_density +>=5 0.0 173 0.0 +4 0.0285931775108 35 0.11 +3 0.323288545158 35 8.02 + +# INT_0_4680 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.15133387242 17 0.66 + +# INT_0_4526 +height FDR actual_density mean_random_density +2 0.0 22 0.0 +1 0.065927482248 24 45.83 + +# INT_0_4522 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.152667758771 33 1.5 + +# RGT1 +height FDR actual_density mean_random_density +3 0.0 38 0.0 +2 0.123499110429 48 1.17 + +# TPO5 +height FDR actual_density mean_random_density +4 0.0 41 0.0 +3 0.0730029618468 42 0.37 + +# tH(GUG)K +height FDR actual_density mean_random_density +>=10 0.0 18 0.0 +9 0.0656746031746 14 0.1 + +# SNR42 +height FDR actual_density mean_random_density +>=36 0.0 3695 0.0 +>=34 0.00210138052246 96 0.02 +33 0.0151628761777 48 0.1 +32 0.0224637059451 49 0.19 +31 0.0355557106336 49 0.35 +30 0.0590271703138 50 0.66 + +# GPT2 +height FDR actual_density mean_random_density +>=5 0.0 160 0.0 +4 0.0476118657829 43 0.3 +3 0.128621033099 55 3.24 + +# SDS22 +height FDR actual_density mean_random_density +4 0.0 31 0.0 +3 0.101664586893 32 0.51 + +# MNN4 +height FDR actual_density mean_random_density +3 0.04166993568 64 0.38 +2 0.197223963453 76 9.33 + +# YJU3 +height FDR actual_density mean_random_density +>=4 0.0 116 0.0 +3 0.109014847946 40 1.14 + +# ADD66 +height FDR actual_density mean_random_density +3 0.0200124883137 50 0.1 +2 0.241712082041 54 6.1 + +# ECM4 +height FDR actual_density mean_random_density +>=4 0.0 89 0.0 +3 0.201180509613 49 2.83 + +# tD(GUC)K +height FDR actual_density mean_random_density +>=12 0.0 21 0.0 +11 0.0841131402106 14 0.16 + +# MDH1 +height FDR actual_density mean_random_density +5 0.0 37 0.0 +4 0.0151417485658 66 0.1 +3 0.093133720362 87 2.49 + +# INT_0_4605 +height FDR actual_density mean_random_density +>=5 0.0 19 0.0 +4 0.0774491541197 9 0.07 + +# tL(UAA)K +height FDR actual_density mean_random_density +6 0.00777279713525 13 0.01 +5 0.0730631469054 16 0.18 + +# UTH1 +height FDR actual_density mean_random_density +>=4 0.0 104 0.0 +3 0.13107530515 55 2.34 + +# INT_0_4824 +height FDR actual_density mean_random_density +>=5 0.0 275 0.0 +4 0.0485442853768 45 0.32 +3 0.314082346907 46 9.17 + +# AVT3 +height FDR actual_density mean_random_density +>=3 0.0 116 0.0 +2 0.334238821025 53 9.19 + +# INT_0_4822 +height FDR actual_density mean_random_density +>=6 0.0 242 0.0 +5 0.012096392687 33 0.04 +4 0.0520475980706 33 0.28 + +# TFA1 +height FDR actual_density mean_random_density +3 0.0 38 0.0 +2 0.34553742088 41 8.15 + +# CCP1 +height FDR actual_density mean_random_density +>=6 0.0 165 0.0 +5 0.0185647512895 86 0.23 +4 0.0858237052039 92 2.9 + +# YKR040C +height FDR actual_density mean_random_density +>=10 0.0 722 0.0 +9 0.00238885897724 42 0.01 +8 0.0305733062292 44 0.18 +7 0.122109019639 45 2.46 + +# tR(UCU)K +height FDR actual_density mean_random_density +9 0.0 2 0.0 +8 0.0532417881575 24 0.15 + +# YKL030W +height FDR actual_density mean_random_density +>=6 0.0 212 0.0 +5 0.0378109273797 45 0.17 +4 0.0778815806421 50 1.04 + +# GPM1 +height FDR actual_density mean_random_density +>=8 0.0 178 0.0 +7 0.0431856764164 28 0.21 +6 0.0679942529907 59 1.19 + +# INT_0_4547 +height FDR actual_density mean_random_density +>=3 0.0 2 0.0 +2 0.620072719359 18 6.23 + +# INT_0_4545 +height FDR actual_density mean_random_density +3 0.0 27 0.0 +2 0.205122720623 30 1.87 + +# FCJ1 +height FDR actual_density mean_random_density +>=4 0.0 151 0.0 +3 0.0608815766714 43 0.56 + +# INT_0_4818 +height FDR actual_density mean_random_density +3 0.0 4 0.0 +2 0.321165610618 8 0.57 + +# HAP4 +height FDR actual_density mean_random_density +>=4 0.0 90 0.0 +3 0.00383568921381 52 0.02 +2 0.33404207964 58 10.77 + +# CWP1 +height FDR actual_density mean_random_density +>=3 0.0 59 0.0 +2 0.266691983273 45 6.9 + +# MEH1 +height FDR actual_density mean_random_density +3 0.0138966693406 36 0.05 +2 0.283510926351 55 8.79 + +####### chromosome chrXII ####### + +# RDN18-2 +height FDR actual_density mean_random_density +>=18 0.0 2206 0.0 +17 0.000801545505241 125 0.01 +16 0.0048452969182 136 0.14 +15 0.0198221207643 155 0.78 +14 0.0327049419199 165 2.19 +13 0.0462813695548 202 5.31 +12 0.0695064389989 210 12.38 + +# RDN18-1 +height FDR actual_density mean_random_density +>=20 0.0 2517 0.0 +19 0.00236703069133 127 0.03 +18 0.00271137745765 148 0.04 +17 0.00416013862838 169 0.07 +16 0.00695261906191 180 0.22 +15 0.0158998868417 203 1.05 +14 0.0266819095428 220 2.77 +13 0.0458693474753 230 7.3 +12 0.0780546050241 234 19.14 + +# SSK1 +height FDR actual_density mean_random_density +>=4 0.0 85 0.0 +3 0.0988335454328 53 1.02 + +# SEC72 +height FDR actual_density mean_random_density +3 0.0399083410217 20 0.08 +2 0.294620288225 48 7.32 + +# IOC2 +height FDR actual_density mean_random_density +3 0.0 42 0.0 +2 0.198382214139 54 3.15 + +# SUT686 +height FDR actual_density mean_random_density +>=4 0.0 65 0.0 +3 0.018154213772 35 0.09 +2 0.322324745944 39 9.24 + +# ATP14 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.26349353129 20 2.49 + +# INT_0_4971 +height FDR actual_density mean_random_density +2 0.0 7 0.0 +1 0.0606447068004 29 35.78 + +# YEF3 +height FDR actual_density mean_random_density +3 0.0321270155831 31 0.1 +2 0.223749624074 77 9.71 + +# INT_0_4977 +height FDR actual_density mean_random_density +3 0.0 15 0.0 +2 0.0565869709941 20 0.14 + +# INT_0_4976 +height FDR actual_density mean_random_density +3 0.0 35 0.0 +2 0.232334457404 45 4.83 + +# GIS3 +height FDR actual_density mean_random_density +3 0.0 35 0.0 +2 0.166437518484 56 3.02 + +# EXG1 +height FDR actual_density mean_random_density +5 0.0 30 0.0 +4 0.00604221011504 33 0.02 +3 0.141812348723 37 1.3 + +# CPR6 +height FDR actual_density mean_random_density +4 0.0 25 0.0 +3 0.1487491864 27 0.6 + +# VMA6 +height FDR actual_density mean_random_density +>=3 0.0 42 0.0 +2 0.197788283241 39 3.19 + +# RPL26A +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0159608667555 25 0.04 +2 0.238766659138 26 2.87 + +# INT_0_5197 +height FDR actual_density mean_random_density +>=4 0.0 80 0.0 +3 0.00242813624079 41 0.01 +2 0.144291973828 69 4.99 + +# HSP104 +height FDR actual_density mean_random_density +>=6 0.0 274 0.0 +5 0.0466747855388 71 0.39 +4 0.103255219706 73 2.47 + +# SNR34 +height FDR actual_density mean_random_density +>=8 0.0 71 0.0 +7 0.0182474968639 45 0.09 +6 0.0816146960856 50 0.94 + +# SNR30 +height FDR actual_density mean_random_density +>=25 0.0 353 0.0 +24 0.00425367721996 71 0.03 +23 0.00827698883611 73 0.06 +22 0.0102078353492 79 0.08 +21 0.0180066597268 81 0.19 +20 0.0265628531097 82 0.32 +19 0.0333978322006 85 0.58 +18 0.0442228702514 87 0.98 +17 0.0618496437972 91 2.05 + +# YLR112W +height FDR actual_density mean_random_density +>=6 0.0 282 0.0 +5 0.105430154399 30 0.87 + +# PUT1 +height FDR actual_density mean_random_density +3 0.0 16 0.0 +2 0.149050069674 18 0.53 + +# BOP2 +height FDR actual_density mean_random_density +4 0.0 35 0.0 +3 0.00221646242972 45 0.01 +2 0.241777975391 53 6.36 + +# ITS1-2 +height FDR actual_density mean_random_density +>=10 0.0 20 0.0 +9 0.0333596180693 21 0.07 +8 0.0767955289339 21 0.26 + +# ITS1-1 +height FDR actual_density mean_random_density +>=8 0.0 33 0.0 +7 0.122118744173 21 0.7 + +# INT_0_5229 +height FDR actual_density mean_random_density +5 0.0 31 0.0 +4 0.109466344611 42 1.21 + +# INT_0_5224 +height FDR actual_density mean_random_density +>=5 0.0 2 0.0 +4 0.921311283578 1 0.18 + +# INT_0_5227 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.205422890073 23 1.55 + +# YLR137W +height FDR actual_density mean_random_density +>=8 0.0 38 0.0 +7 0.038423334886 41 0.26 +6 0.0477015095732 77 0.82 +5 0.0980503901779 102 5.6 + +# CTS1 +height FDR actual_density mean_random_density +4 0.0 10 0.0 +3 0.0612418588024 56 0.69 + +# CUT278 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.090049429217 19 0.24 + +# INT_0_5328 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.167404400385 30 1.04 + +# INT_0_5647 +height FDR actual_density mean_random_density +3 0.0 12 0.0 +2 0.228620730233 55 4.59 + +# INT_0_5644 +height FDR actual_density mean_random_density +>=3 0.0 57 0.0 +2 0.305690384682 55 9.47 + +# CCW12 +height FDR actual_density mean_random_density +>=11 0.0 158 0.0 +10 0.00257097370461 39 0.01 +9 0.0103399173446 69 0.08 +8 0.0506814256607 88 1.17 + +# SNR79 +height FDR actual_density mean_random_density +5 0.0216783022237 14 0.03 +4 0.237789630556 14 1.03 + +# YLR179C +height FDR actual_density mean_random_density +>=5 0.0 197 0.0 +4 0.0862888975801 29 0.57 + +# FKS1 +height FDR actual_density mean_random_density +>=3 0.0 202 0.0 +2 0.332831004813 57 10.48 + +# ISA1 +height FDR actual_density mean_random_density +3 0.0 40 0.0 +2 0.332861009484 42 7.07 + +# ILV5 +height FDR actual_density mean_random_density +>=7 0.0 92 0.0 +6 0.0150553341005 91 0.26 +5 0.0721566273455 108 3.85 + +# INT_0_5545 +height FDR actual_density mean_random_density +4 0.0 13 0.0 +3 0.0861557788698 19 0.23 + +# RRN5 +height FDR actual_density mean_random_density +3 0.0 16 0.0 +2 0.095757255845 18 0.32 + +# SUT251 +height FDR actual_density mean_random_density +3 0.0 11 0.0 +2 0.302816672441 26 4.28 + +# YPS1 +height FDR actual_density mean_random_density +>=4 0.0 49 0.0 +3 0.0471722493375 19 0.09 +2 0.29243031409 24 3.89 + +# RDN37-2 +height FDR actual_density mean_random_density +>=21 0.0 10065 0.0 +20 0.00021226057418 472 0.01 +19 0.00146962833306 496 0.09 +18 0.00353520022291 524 0.36 +17 0.00570100904612 552 0.77 +16 0.00931823248748 586 2.6 +15 0.0160952702869 643 8.06 +14 0.0281400473856 715 24.32 +13 0.0454849765375 812 61.97 +12 0.0708118075424 874 142.53 + +# RDN37-1 +height FDR actual_density mean_random_density +>=21 0.0 9580 0.0 +20 0.000197708138659 507 0.01 +19 0.00133433482546 526 0.07 +18 0.00187794440419 558 0.18 +17 0.00357890162289 605 0.76 +16 0.00942784260033 658 3.5 +15 0.0166469670897 729 9.82 +14 0.0272664330055 789 26.19 +13 0.0426221443134 834 64.94 +12 0.0658302876135 935 149.56 + +# INT_0_5062 +height FDR actual_density mean_random_density +>=5 0.0 89 0.0 +4 0.0388998810828 51 0.5 +3 0.251024168679 58 11.79 + +# YLR294C +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.302112051668 20 3.53 + +# CBF5 +height FDR actual_density mean_random_density +>=4 0.0 34 0.0 +3 0.0951466672203 26 0.43 + +# RPS22B +height FDR actual_density mean_random_density +>=13 0.0 2211 0.0 +12 0.00483442870968 62 0.03 +11 0.0196847886625 66 0.13 +10 0.0272769135126 101 0.34 +9 0.0428681486042 106 1.4 +8 0.0900819876006 107 5.3 + +# CUT737 +height FDR actual_density mean_random_density +>=4 0.0 59 0.0 +3 0.263021514412 32 3.4 + +# CUT733 +height FDR actual_density mean_random_density +>=6 0.0 121 0.0 +5 0.038791736414 38 0.24 +4 0.12138846521 38 1.45 + +# SUT280 +height FDR actual_density mean_random_density +>=6 0.0 298 0.0 +5 0.00415958361044 48 0.02 +4 0.0700599450518 48 0.4 + +# INT_0_5502 +height FDR actual_density mean_random_density +>=4 0.0 59 0.0 +3 0.0622383791602 41 0.42 + +# INT_0_5012 +height FDR actual_density mean_random_density +>=5 0.0 1381 0.0 +4 0.134011688593 62 4.68 + +# INT_0_5547 +height FDR actual_density mean_random_density +4 0.0328815571159 79 0.26 +3 0.0796822647376 89 1.87 + +# GSY2 +height FDR actual_density mean_random_density +4 0.0127758878425 39 0.05 +3 0.0788110249121 61 1.22 + +# INT_0_5605 +height FDR actual_density mean_random_density +>=6 0.0 346 0.0 +5 0.0144665764929 131 0.19 +4 0.0302779162243 148 1.16 +3 0.072269274794 226 14.86 + +# RPS31 +height FDR actual_density mean_random_density +>=9 0.0 574 0.0 +8 0.00455788143627 44 0.02 +7 0.0563042075885 45 0.4 + +# INT_0_5182 +height FDR actual_density mean_random_density +>=7 0.0 722 0.0 +6 0.00212053437004 47 0.01 +5 0.0490394666559 51 0.34 +4 0.172424858043 56 4.61 + +# INT_0_5232 +height FDR actual_density mean_random_density +>=4 0.0 288 0.0 +3 0.0979440301848 60 1.8 + +# INT_0_5230 +height FDR actual_density mean_random_density +>=10 0.0 274 0.0 +9 0.008029585908 75 0.06 +8 0.0253943081118 83 0.48 +7 0.0624743370266 101 2.88 + +# INT_0_5237 +height FDR actual_density mean_random_density +>=4 0.0 115 0.0 +3 0.116220711886 56 2.49 + +# INT_0_5234 +height FDR actual_density mean_random_density +>=9 0.0 3796 0.0 +8 0.00192711808725 207 0.04 +7 0.00860123171704 236 0.48 +6 0.0305297463215 262 4.01 +5 0.0530948910557 370 23.64 + +# SUT256 +height FDR actual_density mean_random_density +3 0.0398751977114 25 0.1 +2 0.226950387406 31 2.63 + +# tL(UAG)L1 +height FDR actual_density mean_random_density +4 0.0432363781391 14 0.06 +3 0.27011481093 30 4.02 + +# DIC1 +height FDR actual_density mean_random_density +>=6 0.0 80 0.0 +5 0.0404438035701 66 0.47 +4 0.144392291347 73 5.16 + +# CUT246 +height FDR actual_density mean_random_density +>=6 0.0 22 0.0 +5 0.0148851588756 59 0.14 +4 0.0676572760298 74 2.29 + +# INT_0_5494 +height FDR actual_density mean_random_density +>=18 0.0 6 0.0 +17 0.100230451028 3 0.03 + +# SUT708 +height FDR actual_density mean_random_density +>=8 0.0 127 0.0 +7 0.0379585966672 16 0.07 +6 0.251967081351 16 1.36 + +# HSP60 +height FDR actual_density mean_random_density +>=6 0.0 219 0.0 +5 0.0261158480265 65 0.17 +4 0.0773753522375 96 2.44 + +# VPS13 +height FDR actual_density mean_random_density +4 0.0 42 0.0 +3 0.0845753523443 43 0.49 + +# tA(AGC)L +height FDR actual_density mean_random_density +>=13 0.0 67 0.0 +12 0.0330473030557 17 0.1 +11 0.108944163097 17 0.66 + +# HOG1 +height FDR actual_density mean_random_density +>=6 0.0 384 0.0 +5 0.00443352357056 45 0.02 +4 0.100980279607 46 1.52 + +# INT_0_5574 +height FDR actual_density mean_random_density +>=3 0.0 53 0.0 +2 0.188220891489 37 1.82 + +# INT_0_5173 +height FDR actual_density mean_random_density +>=4 0.0 25 0.0 +3 0.373385255108 8 0.68 + +# FRA1 +height FDR actual_density mean_random_density +>=5 0.0 239 0.0 +4 0.0399496025778 98 0.68 +3 0.121366077787 98 6.23 + +# RDN5-1 +height FDR actual_density mean_random_density +>=22 0.0 128 0.0 +21 0.00394907303998 37 0.02 +20 0.0334616951823 42 0.23 +19 0.0519390512479 46 0.48 + +# RDN5-2 +height FDR actual_density mean_random_density +>=24 0.0 26 0.0 +23 0.00837559558933 12 0.01 +22 0.0252948539949 20 0.05 +21 0.0380683314125 24 0.09 +20 0.0422202280521 27 0.13 +19 0.0522794759872 28 0.19 + +# RDN5-3 +height FDR actual_density mean_random_density +>=19 0.0 140 0.0 +18 0.0176598129417 29 0.07 +17 0.0349170133138 30 0.16 +16 0.0560622830624 31 0.32 + +# RDN5-4 +height FDR actual_density mean_random_density +>=20 0.0 126 0.0 +19 0.00878056458696 35 0.03 +18 0.0176967226296 40 0.12 +17 0.0564044595097 46 0.82 + +# RDN5-5 +height FDR actual_density mean_random_density +>=18 0.0 76 0.0 +17 0.0353709024434 29 0.11 +16 0.0624433747496 34 0.34 + +# RDN5-6 +height FDR actual_density mean_random_density +>=20 0.0 103 0.0 +18 0.0240462971614 48 0.17 +19 0.0246936015798 42 0.11 +17 0.0341907451252 49 0.34 +16 0.0660321559731 49 0.81 + +# tD(GUC)L1 +height FDR actual_density mean_random_density +>=10 0.0 25 0.0 +9 0.00975384860736 21 0.02 +8 0.0677899965495 27 0.46 + +# tD(GUC)L2 +height FDR actual_density mean_random_density +>=10 0.0 52 0.0 +9 0.0354742159546 31 0.14 +8 0.119004898925 32 0.85 + +# BDF1 +height FDR actual_density mean_random_density +>=5 0.0 102 0.0 +4 0.0117497680196 85 0.1 +3 0.0582870702481 104 2.25 + +# INT_0_5383 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.247481975911 24 2.74 + +# NHA1 +height FDR actual_density mean_random_density +>=4 0.0 89 0.0 +3 0.0588050318238 51 0.47 + +# CUT750 +height FDR actual_density mean_random_density +>=9 0.0 313 0.0 +8 0.010323693717 39 0.04 +7 0.0380851994543 39 0.35 +6 0.116993219781 39 2.0 + +# FRS1 +height FDR actual_density mean_random_density +>=4 0.0 142 0.0 +3 0.0718647926251 52 0.51 + +# INT_0_5201 +height FDR actual_density mean_random_density +>=5 0.0 443 0.0 +4 0.0211202152164 33 0.07 +3 0.139325784182 36 1.75 + +# INT_0_5205 +height FDR actual_density mean_random_density +3 0.0193233550732 29 0.08 +2 0.148438485479 102 10.63 + +# YRF1-5 +height FDR actual_density mean_random_density +3 0.0 41 0.0 +2 0.155403545486 45 2.01 + +# MRPL4 +height FDR actual_density mean_random_density +5 0.0 6 0.0 +4 0.0369457089903 29 0.14 +3 0.103183730108 68 2.42 + +# INT_0_5100 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.278352321619 22 2.3 + +# INT_0_5106 +height FDR actual_density mean_random_density +3 0.0 28 0.0 +2 0.242237340468 37 4.58 + +# NAM2 +height FDR actual_density mean_random_density +>=4 0.0 172 0.0 +3 0.0534158548932 47 0.43 + +# RPS25B +height FDR actual_density mean_random_density +>=5 0.0 186 0.0 +4 0.0893622989451 47 0.74 + +# SNR44 +height FDR actual_density mean_random_density +>=28 0.0 1365 0.0 +27 0.00417100187772 55 0.03 +26 0.0167582938389 55 0.16 +25 0.0320522363423 55 0.43 +24 0.0581218625555 56 1.03 + +# INT_0_5400 +height FDR actual_density mean_random_density +>=3 0.0 52 0.0 +2 0.120597661569 31 1.08 + +# ZRT2 +height FDR actual_density mean_random_density +>=4 0.0 27 0.0 +3 0.122762408627 24 0.56 + +# RDN25-2 +height FDR actual_density mean_random_density +>=25 0.0 6853 0.0 +24 0.00033795724584 297 0.01 +23 0.00250582158852 315 0.12 +22 0.00546654156762 335 0.42 +21 0.0099260044997 360 0.99 +20 0.0147628732838 380 2.12 +19 0.0216676899541 399 4.56 +18 0.0335903381404 412 9.4 +17 0.0487276396782 427 20.25 +16 0.0720823832784 442 43.88 + +# RDN25-1 +height FDR actual_density mean_random_density +>=24 0.0 6189 0.0 +23 0.00095644100522 315 0.03 +22 0.00261661319681 330 0.12 +21 0.007796524324 350 0.58 +20 0.0135252698017 386 1.59 +19 0.0193314688028 399 3.46 +18 0.0285749731561 410 7.8 +17 0.0442708879631 436 17.71 +16 0.0677297883049 478 40.36 + +# INT_0_5240 +height FDR actual_density mean_random_density +3 0.0172461344375 31 0.07 +2 0.153869111539 113 13.92 + +# INT_0_5249 +height FDR actual_density mean_random_density +>=6 0.0 480 0.0 +5 0.0123683083808 121 0.15 +4 0.042524865309 178 3.02 +3 0.123805951889 211 27.82 + +# YLR154C-G +height FDR actual_density mean_random_density +>=29 0.0 3162 0.0 +28 0.000636080038335 158 0.01 +27 0.00182809152974 165 0.03 +26 0.00426425179298 170 0.1 +25 0.00738552402364 181 0.23 +24 0.0141338635016 187 0.72 +23 0.019437722856 202 1.32 +22 0.0279897447432 220 2.82 +21 0.0371722881258 241 5.58 +20 0.0538075513471 255 11.17 + +# CKI1 +height FDR actual_density mean_random_density +2 0.0 49 0.0 +1 0.293991412371 54 97.1 + +# CUT252 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0877029104681 28 0.52 + +# GTT2 +height FDR actual_density mean_random_density +2 0.0 20 0.0 +1 0.121561615224 21 40.73 + +# MEF1 +height FDR actual_density mean_random_density +>=4 0.0 84 0.0 +3 0.0597865941926 51 0.88 + +# RPS29A +height FDR actual_density mean_random_density +3 0.00277734926862 36 0.01 +2 0.32138165198 38 6.37 + +# HMG2 +height FDR actual_density mean_random_density +>=4 0.0 161 0.0 +3 0.0730189612891 46 0.42 + +# tE(UUC)L +height FDR actual_density mean_random_density +9 0.0 14 0.0 +8 0.0190077757219 17 0.04 +7 0.108616342104 17 0.39 + +# INT_0_5484 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.127359236577 18 0.37 + +# ERG27 +height FDR actual_density mean_random_density +>=4 0.0 59 0.0 +3 0.0820033489951 38 0.83 + +# YLR125W +height FDR actual_density mean_random_density +4 0.0380989305203 21 0.08 +3 0.14761145679 22 0.93 + +# ETS1-2 +height FDR actual_density mean_random_density +>=9 0.0 31 0.0 +8 0.0124801389695 24 0.03 +7 0.027794297367 53 0.29 +6 0.0730718157894 68 1.92 + +# ETS1-1 +height FDR actual_density mean_random_density +7 0.0 10 0.0 +6 0.0664553001751 42 0.55 + +# INT_0_5148 +height FDR actual_density mean_random_density +3 0.0 38 0.0 +2 0.207348216114 41 3.27 + +# INT_0_5141 +height FDR actual_density mean_random_density +2 0.0 19 0.0 +1 0.131678622542 22 40.56 + +# INT_0_5142 +height FDR actual_density mean_random_density +>=5 0.0 461 0.0 +4 0.0325424469922 55 0.28 +3 0.163740568677 57 5.11 + +# SSA2 +height FDR actual_density mean_random_density +>=7 0.0 199 0.0 +6 0.0198208351494 87 0.3 +5 0.0544797320333 107 2.2 + +# INT_0_5365 +height FDR actual_density mean_random_density +>=4 0.0 304 0.0 +3 0.0595295867568 62 0.88 + +# CDC3 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0199580238004 50 0.1 +2 0.215488251986 55 6.14 + +# YLL056C +height FDR actual_density mean_random_density +>=4 0.0 78 0.0 +3 0.0581518175996 53 0.51 + +# CUT747 +height FDR actual_density mean_random_density +>=5 0.0 38 0.0 +4 0.0674862796257 24 0.29 + +# CUT742 +height FDR actual_density mean_random_density +>=5 0.0 89 0.0 +4 0.0821876930834 31 0.57 + +# UBI4 +height FDR actual_density mean_random_density +4 0.0 22 0.0 +3 0.0894784858289 45 1.17 + +# INT_0_4990 +height FDR actual_density mean_random_density +>=5 0.0 965 0.0 +4 0.00266717826771 112 0.03 +3 0.0478877389699 130 3.18 +2 0.233394897487 169 87.07 + +# NTS1-2 +height FDR actual_density mean_random_density +>=8 0.0 370 0.0 +7 0.0121216820893 42 0.06 +6 0.0922132529272 43 0.6 + +# ECM19 +height FDR actual_density mean_random_density +>=8 0.0 111 0.0 +6 0.015405060008 39 0.06 +7 0.0156279795178 32 0.05 +5 0.0651935544212 41 0.56 + +# YCT1 +height FDR actual_density mean_random_density +3 0.0 18 0.0 +2 0.13108744632 44 2.3 + +# VPS36 +height FDR actual_density mean_random_density +>=5 0.0 108 0.0 +4 0.0636034396005 29 0.25 + +# tL(UAA)L +height FDR actual_density mean_random_density +5 0.0100689219901 10 0.01 +4 0.212868215641 18 1.18 + +# INT_0_5489 +height FDR actual_density mean_random_density +>=6 0.0 504 0.0 +5 0.00391031487941 51 0.02 +4 0.0911212951043 57 1.34 + +# INT_0_5315 +height FDR actual_density mean_random_density +4 0.0 10 0.0 +3 0.137254475928 25 0.71 + +# INT_0_5317 +height FDR actual_density mean_random_density +>=4 0.0 101 0.0 +3 0.0316325470494 45 0.17 +2 0.229398521576 72 10.85 + +# IKI3 +height FDR actual_density mean_random_density +2 0.0110625998759 27 0.03 +1 0.156597635101 48 73.53 + +# PDC1 +height FDR actual_density mean_random_density +>=7 0.0 559 0.0 +6 0.0225707099583 79 0.39 +5 0.0677215335883 86 2.76 + +# RPS1A +height FDR actual_density mean_random_density +4 0.0 43 0.0 +3 0.0181933500792 55 0.1 +2 0.379195288244 57 15.53 + +####### chromosome chrXIII ####### + +# tW(CCA)M +height FDR actual_density mean_random_density +5 0.0437589450648 20 0.14 +4 0.247772178156 22 2.59 + +# DIA1 +height FDR actual_density mean_random_density +5 0.0 5 0.0 +4 0.0665083160412 36 0.38 + +# ARP9 +height FDR actual_density mean_random_density +2 0.0482341056472 31 0.15 +1 0.175048647218 34 63.79 + +# INT_0_6174 +height FDR actual_density mean_random_density +>=5 0.0 49 0.0 +4 0.0630083635737 31 0.3 + +# UBC7 +height FDR actual_density mean_random_density +3 0.009677454371 31 0.03 +2 0.272256033335 54 9.3 + +# INT_0_6078 +height FDR actual_density mean_random_density +4 0.0 9 0.0 +3 0.234664130775 11 0.68 + +# INT_0_6079 +height FDR actual_density mean_random_density +>=6 0.0 67 0.0 +5 0.0814681431428 11 0.09 + +# ERG5 +height FDR actual_density mean_random_density +4 0.0 15 0.0 +3 0.0124528468398 24 0.03 +2 0.179387098998 27 1.88 + +# INT_0_6255 +height FDR actual_density mean_random_density +>=5 0.0 34 0.0 +4 0.0678810809764 22 0.15 + +# ERG8 +height FDR actual_density mean_random_density +3 0.0 42 0.0 +2 0.233251375054 44 4.19 + +# ERV41 +height FDR actual_density mean_random_density +2 0.0 21 0.0 +1 0.195568436273 40 59.55 + +# SNR83 +height FDR actual_density mean_random_density +>=18 0.0 1141 0.0 +17 0.0239096193795 42 0.15 +16 0.0668906927482 42 0.74 + +# SNR85 +height FDR actual_density mean_random_density +>=27 0.0 996 0.0 +26 0.0021754740792 47 0.01 +25 0.0078896619465 47 0.05 +24 0.0142521231758 47 0.12 +23 0.0317920187846 47 0.32 +22 0.0580134853401 49 0.86 + +# YMR262W +height FDR actual_density mean_random_density +3 0.0344246910522 16 0.09 +2 0.225383204391 40 7.63 + +# CUT773 +height FDR actual_density mean_random_density +4 0.0 3 0.0 +3 0.185847957925 20 1.12 + +# CUT776 +height FDR actual_density mean_random_density +>=4 0.0 35 0.0 +3 0.103956664331 21 0.49 + +# CUT777 +height FDR actual_density mean_random_density +4 0.0 10 0.0 +3 0.0901379697065 18 0.2 + +# YMR196W +height FDR actual_density mean_random_density +>=4 0.0 53 0.0 +3 0.0849624871432 63 0.89 + +# CUT779 +height FDR actual_density mean_random_density +4 0.0 16 0.0 +3 0.0535145265118 35 0.42 + +# PAH1 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.121880387575 42 1.6 + +# CUT299 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.179933110368 23 1.5 + +# tR(UCU)M2 +height FDR actual_density mean_random_density +>=16 0.0 35 0.0 +15 0.0177472627192 24 0.05 +14 0.0381627870495 25 0.17 +13 0.0660068160932 33 0.39 + +# tR(UCU)M1 +height FDR actual_density mean_random_density +7 0.0 14 0.0 +6 0.169512097352 16 0.77 + +# INT_0_6206 +height FDR actual_density mean_random_density +>=4 0.0 828 0.0 +3 0.152056468595 56 3.46 + +# SUT717 +height FDR actual_density mean_random_density +>=4 0.0 62 0.0 +3 0.094603406059 28 0.4 + +# INT_0_5886 +height FDR actual_density mean_random_density +>=6 0.0 141 0.0 +5 0.00612781751133 49 0.03 +4 0.110040850163 49 1.57 + +# PLB1 +height FDR actual_density mean_random_density +>=6 0.0 80 0.0 +5 0.0112438191455 71 0.08 +4 0.0262995870424 112 0.71 +3 0.118255365978 128 13.52 + +# ASI1 +height FDR actual_density mean_random_density +3 0.0 15 0.0 +2 0.168297110322 17 0.82 + +# SUP8 +height FDR actual_density mean_random_density +>=16 0.0 235 0.0 +15 0.0191648722343 22 0.05 +14 0.0495207686672 22 0.15 +13 0.0938736408777 22 0.46 + +# CUT306 +height FDR actual_density mean_random_density +>=8 0.0 37 0.0 +7 0.0160444095856 25 0.04 +6 0.0925522443762 27 0.43 + +# SUP5 +height FDR actual_density mean_random_density +>=14 0.0 228 0.0 +13 0.0147079719671 22 0.04 +12 0.0451540956274 22 0.23 +11 0.118323877074 23 0.87 + +# CUT303 +height FDR actual_density mean_random_density +5 0.0 19 0.0 +4 0.124937286399 19 0.48 + +# YMR031C +height FDR actual_density mean_random_density +3 0.00915268997549 46 0.06 +2 0.308218075716 55 8.92 + +# INT_0_5880 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.150286579195 22 0.78 + +# CTK3 +height FDR actual_density mean_random_density +3 0.0443034634624 18 0.08 +2 0.232305800782 20 1.99 + +# INT_0_5733 +height FDR actual_density mean_random_density +>=11 0.0 26 0.0 +10 0.0166396211269 6 0.01 +9 0.199675453523 6 0.12 + +# INT_0_6096 +height FDR actual_density mean_random_density +8 0.0 4 0.0 +7 0.0469571189956 11 0.08 +6 0.123437614476 20 0.69 + +# SUT288 +height FDR actual_density mean_random_density +4 0.0 24 0.0 +3 0.0345858728229 26 0.09 +2 0.335249510065 32 7.92 + +# YMR103C +height FDR actual_density mean_random_density +>=7 0.0 365 0.0 +6 0.0365068523214 59 0.28 +5 0.126500043012 59 2.63 + +# LCB1 +height FDR actual_density mean_random_density +3 0.0292917938265 17 0.05 +2 0.659332113541 18 8.19 + +# ITT1 +height FDR actual_density mean_random_density +3 0.0 3 0.0 +2 0.242625036557 38 3.6 + +# MVP1 +height FDR actual_density mean_random_density +3 0.00564974534265 53 0.03 +2 0.262083429047 55 5.7 + +# RNA1 +height FDR actual_density mean_random_density +4 0.0 40 0.0 +3 0.054293641667 49 0.32 + +# INT_0_5690 +height FDR actual_density mean_random_density +>=10 0.0 7 0.0 +9 0.51966903978 4 0.68 + +# INT_0_5985 +height FDR actual_density mean_random_density +>=5 0.0 169 0.0 +4 0.0597881469178 57 0.75 + +# YMR258C +height FDR actual_density mean_random_density +>=6 0.0 74 0.0 +5 0.028036286477 32 0.09 +4 0.134727526656 32 1.41 + +# ERO1 +height FDR actual_density mean_random_density +>=4 0.0 170 0.0 +3 0.104421088767 76 3.16 + +# CUT767 +height FDR actual_density mean_random_density +5 0.0 5 0.0 +4 0.119802948335 33 1.31 + +# CUT761 +height FDR actual_density mean_random_density +5 0.0206844362729 26 0.07 +4 0.107217563017 39 0.63 + +# YMR045C +height FDR actual_density mean_random_density +4 0.0 29 0.0 +3 0.0944171058227 32 0.53 + +# FMS1 +height FDR actual_density mean_random_density +>=4 0.0 89 0.0 +3 0.118340594401 52 2.07 + +# ESC1 +height FDR actual_density mean_random_density +>=3 0.0 45 0.0 +2 0.26921970382 29 2.92 + +# STV1 +height FDR actual_density mean_random_density +>=5 0.0 843 0.0 +4 0.0851713183942 66 1.84 + +# PPZ1 +height FDR actual_density mean_random_density +>=4 0.0 127 0.0 +3 0.0263277465108 46 0.14 +2 0.284752571187 54 9.85 + +# TCB3 +height FDR actual_density mean_random_density +>=3 0.0 134 0.0 +2 0.211861595611 61 6.3 + +# SNR86 +height FDR actual_density mean_random_density +>=6 0.0 222 0.0 +5 0.020438528886 94 0.51 +4 0.101928337295 98 6.24 + +# TSL1 +height FDR actual_density mean_random_density +>=6 0.0 175 0.0 +5 0.0239909518125 54 0.13 +4 0.0543925926622 112 2.19 + +# FET3 +height FDR actual_density mean_random_density +3 0.0 39 0.0 +2 0.123354447305 49 1.51 + +# SNR11 +height FDR actual_density mean_random_density +>=12 0.0 81 0.0 +11 0.0143691450041 28 0.04 +10 0.077363494599 28 0.28 + +# INT_0_5971 +height FDR actual_density mean_random_density +5 0.0 1 0.0 +4 2.30546421725 1 0.49 + +# INT_0_5974 +height FDR actual_density mean_random_density +>=4 0.0 62 0.0 +3 0.102863899138 34 0.93 + +# tK(CUU)M +height FDR actual_density mean_random_density +>=19 0.0 48 0.0 +18 0.0206493247604 23 0.07 +17 0.0409278568187 24 0.2 +16 0.0913207106215 24 0.5 + +# ASC1 +height FDR actual_density mean_random_density +>=6 0.0 113 0.0 +5 0.0124875221753 56 0.07 +4 0.0476931194256 57 0.56 +3 0.201513506442 58 6.3 + +# RCO1 +height FDR actual_density mean_random_density +>=3 0.0 77 0.0 +2 0.179895195368 57 3.54 + +# INT_0_6087 +height FDR actual_density mean_random_density +>=3 0.0 35 0.0 +2 0.0298617713213 20 0.06 +1 0.0711123905826 21 75.78 + +# TSA1 +height FDR actual_density mean_random_density +>=5 0.0 99 0.0 +4 0.0301149971879 50 0.16 +3 0.177789501604 55 5.92 + +# YIM1 +height FDR actual_density mean_random_density +>=3 0.0 37 0.0 +2 0.221758055698 20 1.85 + +# MSC1 +height FDR actual_density mean_random_density +>=8 0.0 1184 0.0 +7 0.0189749023244 79 0.15 +6 0.0449915184046 90 1.31 +5 0.156404458115 93 10.68 + +# HMG1 +height FDR actual_density mean_random_density +3 0.0 25 0.0 +2 0.200510539111 43 3.2 + +# INT_0_5756 +height FDR actual_density mean_random_density +>=5 0.0 317 0.0 +4 0.0193861278319 36 0.07 +3 0.212794141414 37 4.21 + +# SUT298 +height FDR actual_density mean_random_density +>=15 0.0 114 0.0 +14 0.0158554442379 26 0.04 +13 0.0461186570183 27 0.13 +12 0.0664819076003 28 0.3 + +# INT_0_5750 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.133277630298 35 0.93 + +# INT_0_5859 +height FDR actual_density mean_random_density +>=4 0.0 60 0.0 +3 0.0865498639087 24 0.27 + +# INT_0_5854 +height FDR actual_density mean_random_density +>=8 0.0 5 0.0 +7 0.169215090111 3 0.06 + +# INT_0_6230 +height FDR actual_density mean_random_density +>=3 0.0 48 0.0 +2 0.113308892385 27 0.81 + +# INT_0_6239 +height FDR actual_density mean_random_density +4 0.0 42 0.0 +3 0.0232025739457 43 0.1 +2 0.318396330402 45 9.16 + +# YMR102C +height FDR actual_density mean_random_density +>=7 0.0 463 0.0 +6 0.00359906296434 111 0.04 +5 0.0306317318058 118 0.74 +4 0.0810749649132 131 6.5 + +# TRS130 +height FDR actual_density mean_random_density +3 0.0 45 0.0 +2 0.158965682731 49 2.1 + +# AVO2 +height FDR actual_density mean_random_density +>=3 0.0 47 0.0 +2 0.287078696789 25 3.13 + +# BUL1 +height FDR actual_density mean_random_density +3 0.0 34 0.0 +2 0.157477902528 55 2.13 + +# INT_0_5924 +height FDR actual_density mean_random_density +>=3 0.0 63 0.0 +2 0.167217988869 69 6.49 + +# YMR086W +height FDR actual_density mean_random_density +>=4 0.0 77 0.0 +3 0.0120203525304 83 0.1 +2 0.247864083718 85 16.69 + +# tD(GUC)M +height FDR actual_density mean_random_density +>=13 0.0 34 0.0 +12 0.0323111994138 21 0.11 +11 0.0640337844972 33 0.56 + +# SUT732 +height FDR actual_density mean_random_density +>=4 0.0 56 0.0 +3 0.0352256167632 30 0.15 +2 0.406520005981 33 10.04 + +# INT_0_5788 +height FDR actual_density mean_random_density +>=4 0.0 56 0.0 +3 0.0302976109621 23 0.07 +2 0.256606055856 30 4.47 + +# SUT738 +height FDR actual_density mean_random_density +3 0.0165949025148 6 0.01 +2 0.444589930123 32 11.06 + +# INT_0_6164 +height FDR actual_density mean_random_density +>=7 0.0 96 0.0 +6 0.0228201273522 23 0.09 +5 0.120035062804 24 0.92 + +# HSC82 +height FDR actual_density mean_random_density +>=6 0.0 437 0.0 +5 0.00562878738682 73 0.05 +4 0.0815162261037 75 2.59 + +# INT_0_5867 +height FDR actual_density mean_random_density +3 0.0 3 0.0 +2 0.888342155397 4 0.89 + +# INT_0_5962 +height FDR actual_density mean_random_density +3 0.0 31 0.0 +2 0.390012536859 34 8.73 + +# PGM2 +height FDR actual_density mean_random_density +>=6 0.0 148 0.0 +5 0.0118295647689 49 0.08 +4 0.0634510141212 49 0.88 + +# PRC1 +height FDR actual_density mean_random_density +>=6 0.0 229 0.0 +5 0.0179696722187 93 0.41 +4 0.0807924443337 98 4.0 + +# ARG7 +height FDR actual_density mean_random_density +3 0.00511667402191 39 0.02 +2 0.187253551222 71 9.97 + +# CUT288 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.0989905469369 25 0.35 + +# GAD1 +height FDR actual_density mean_random_density +>=4 0.0 134 0.0 +3 0.0855181636678 67 2.15 + +# INT_0_6002 +height FDR actual_density mean_random_density +>=3 0.0 135 0.0 +2 0.141022782046 47 1.66 + +# YMR265C +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.229851499653 56 4.81 + +# ADH2 +height FDR actual_density mean_random_density +>=8 0.0 243 0.0 +7 0.00702860632726 100 0.07 +6 0.0116757525433 121 0.32 +5 0.0604883780513 122 3.21 + +# IMD4 +height FDR actual_density mean_random_density +>=5 0.0 317 0.0 +4 0.0346973655786 72 0.47 +3 0.145843415311 88 7.26 + +# STO1 +height FDR actual_density mean_random_density +3 0.00595302350511 67 0.04 +2 0.173341766909 86 8.95 + +# INT_0_6133 +height FDR actual_density mean_random_density +2 0.0 20 0.0 +1 0.0659788333126 30 49.76 + +# SNR72 +height FDR actual_density mean_random_density +>=7 0.0 70 0.0 +6 0.0722143539445 23 0.49 + +# CUT311 +height FDR actual_density mean_random_density +>=4 0.0 58 0.0 +3 0.152280777289 20 0.97 + +# CUT793 +height FDR actual_density mean_random_density +7 0.0 37 0.0 +6 0.0105868664171 38 0.04 +5 0.0665822077362 41 0.55 + +####### chromosome chrXIV ####### + +# SSK2 +height FDR actual_density mean_random_density +>=3 0.0 68 0.0 +2 0.107853709717 74 2.85 + +# SIW14 +height FDR actual_density mean_random_density +4 0.0 22 0.0 +3 0.035892128381 25 0.09 +2 0.298605299291 26 5.03 + +# INT_0_6674 +height FDR actual_density mean_random_density +>=4 0.0 56 0.0 +3 0.0237152774756 21 0.05 +2 0.260771988124 22 3.07 + +# TOP2 +height FDR actual_density mean_random_density +2 0.0 26 0.0 +1 0.154516394752 28 53.23 + +# VPS27 +height FDR actual_density mean_random_density +>=3 0.0 58 0.0 +2 0.291428005796 32 4.49 + +# APJ1 +height FDR actual_density mean_random_density +>=6 0.0 214 0.0 +5 0.0399153723394 50 0.2 +4 0.0989595659789 51 0.82 + +# IMP4 +height FDR actual_density mean_random_density +>=5 0.0 305 0.0 +4 0.0587640487205 35 0.49 + +# PBI2 +height FDR actual_density mean_random_density +3 0.0422276822277 37 0.22 +2 0.322790482658 40 8.99 + +# MSB3 +height FDR actual_density mean_random_density +4 0.0 10 0.0 +3 0.0689276909583 13 0.09 + +# INT_0_6545 +height FDR actual_density mean_random_density +>=9 0.0 3974 0.0 +8 0.000907276765494 110 0.01 +7 0.0315078085211 110 0.94 +6 0.109547524199 111 8.15 + +# INT_0_6540 +height FDR actual_density mean_random_density +>=3 0.0 40 0.0 +2 0.213238759872 23 1.7 + +# SUT329 +height FDR actual_density mean_random_density +3 0.0 24 0.0 +2 0.302792014758 25 3.68 + +# SUT328 +height FDR actual_density mean_random_density +3 0.00425075355342 47 0.02 +2 0.318422953856 49 9.81 + +# KTR5 +height FDR actual_density mean_random_density +3 0.0175772469525 17 0.03 +2 0.23687072801 45 6.51 + +# YNL134C +height FDR actual_density mean_random_density +>=5 0.0 72 0.0 +4 0.125415839731 29 1.11 + +# INT_0_6719 +height FDR actual_density mean_random_density +>=4 0.0 21 0.0 +3 0.421915813961 9 0.49 + +# SUT747 +height FDR actual_density mean_random_density +2 0.0275248261876 31 0.12 +1 0.122511066169 32 62.52 + +# INT_0_6399 +height FDR actual_density mean_random_density +>=4 0.0 109 0.0 +3 0.0542375815315 48 0.44 + +# HCH1 +height FDR actual_density mean_random_density +>=8 0.0 117 0.0 +7 0.0151520198283 33 0.05 +6 0.0212160068882 52 0.11 +5 0.0443777004009 60 0.54 +4 0.139324388608 64 5.57 + +# TPM1 +height FDR actual_density mean_random_density +4 0.0 30 0.0 +3 0.0840091631738 33 0.5 + +# MDG1 +height FDR actual_density mean_random_density +>=5 0.0 205 0.0 +4 0.023978301613 50 0.12 +3 0.17558272418 53 4.41 + +# APP1 +height FDR actual_density mean_random_density +3 0.0 30 0.0 +2 0.197869735454 45 4.24 + +# URE2 +height FDR actual_density mean_random_density +>=4 0.0 122 0.0 +3 0.0802353108683 53 1.05 + +# CUT344 +height FDR actual_density mean_random_density +4 0.0466209644161 19 0.14 +3 0.32249849904 21 2.91 + +# CUT348 +height FDR actual_density mean_random_density +7 0.0 8 0.0 +6 0.0555636835671 27 0.31 + +# CIT1 +height FDR actual_density mean_random_density +3 0.0341868476872 35 0.12 +2 0.196236852799 102 14.74 + +# INT_0_6597 +height FDR actual_density mean_random_density +>=4 0.0 37 0.0 +3 0.013890835081 31 0.07 +2 0.165594667644 91 11.48 + +# INT_0_6591 +height FDR actual_density mean_random_density +>=6 0.0 720 0.0 +5 0.0213671190442 73 0.23 +4 0.103947468103 78 4.12 + +# YNR014W +height FDR actual_density mean_random_density +>=6 0.0 43 0.0 +5 0.0389928805975 41 0.16 +4 0.0953257116891 63 1.82 + +# INT_0_6506 +height FDR actual_density mean_random_density +2 0.0493167218754 18 0.12 +1 0.161133135322 21 38.45 + +# ACC1 +height FDR actual_density mean_random_density +>=4 0.0 51 0.0 +3 0.051052293076 39 0.2 + +# SNR19 +height FDR actual_density mean_random_density +>=19 0.0 586 0.0 +18 0.00143901625824 70 0.01 +17 0.00255416680458 79 0.02 +16 0.00784919226882 94 0.13 +15 0.0205720506649 99 0.41 +14 0.0512069178844 102 1.44 + +# INT_0_6275 +height FDR actual_density mean_random_density +>=3 0.0 45 0.0 +2 0.288607741383 57 10.03 + +# LAT1 +height FDR actual_density mean_random_density +>=7 0.0 189 0.0 +6 0.014979723088 60 0.09 +5 0.0358511650707 66 0.36 +4 0.0803519649711 72 1.35 + +# NOG2 +height FDR actual_density mean_random_density +>=5 0.0 147 0.0 +4 0.0466605133309 92 0.63 +3 0.129849688716 94 6.08 + +# RPD3 +height FDR actual_density mean_random_density +>=3 0.0 103 0.0 +2 0.309919880379 53 9.29 + +# ZWF1 +height FDR actual_density mean_random_density +>=6 0.0 178 0.0 +5 0.00234940579164 95 0.03 +4 0.0392671418125 133 1.95 +3 0.139936096481 159 24.21 + +# FAP1 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.462513564579 20 4.54 + +# RPS3 +height FDR actual_density mean_random_density +>=6 0.0 56 0.0 +5 0.0286014798155 49 0.14 +4 0.115782990018 51 1.46 + +# INT_0_6659 +height FDR actual_density mean_random_density +>=4 0.0 22 0.0 +3 0.341218226478 10 0.67 + +# YNL097W-A +height FDR actual_density mean_random_density +>=16 0.0 218 0.0 +15 0.00213699305807 48 0.01 +14 0.0202999625428 48 0.13 +13 0.0291420879432 52 0.31 +12 0.0872367579505 52 1.74 + +# THO2 +height FDR actual_density mean_random_density +>=4 0.0 32 0.0 +3 0.0323642089358 40 0.13 +2 0.232812458944 50 5.44 + +# INT_0_6339 +height FDR actual_density mean_random_density +3 0.0 1 0.0 +2 10.0389897957 1 2.74 + +# INT_0_6332 +height FDR actual_density mean_random_density +>=6 0.0 10 0.0 +5 0.104874957231 15 0.21 + +# INT_0_6331 +height FDR actual_density mean_random_density +>=6 0.0 28 0.0 +5 0.0541948768553 20 0.16 + +# CUT805 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.249150586831 22 2.52 + +# INT_0_6567 +height FDR actual_density mean_random_density +>=9 0.0 830 0.0 +8 0.0136569631751 93 0.2 +7 0.0340506764702 107 1.02 +6 0.0866149842579 107 6.12 + +# SRP1 +height FDR actual_density mean_random_density +3 0.0 52 0.0 +2 0.255271732327 55 8.62 + +# ATP23 +height FDR actual_density mean_random_density +>=7 0.0 249 0.0 +6 0.0263826688791 76 0.32 +5 0.0741985442439 86 2.04 + +# INT_0_6517 +height FDR actual_density mean_random_density +>=6 0.0 53 0.0 +5 0.0405347550383 30 0.17 +4 0.184079115829 31 2.05 + +# INT_0_6510 +height FDR actual_density mean_random_density +>=19 0.0 7825 0.0 +18 0.013194007549 61 0.09 +17 0.0227135355267 62 0.2 +16 0.0522147111799 62 0.49 + +# INT_0_6519 +height FDR actual_density mean_random_density +6 0.0 26 0.0 +5 0.0505448264008 28 0.14 + +# CRZ1 +height FDR actual_density mean_random_density +3 0.0 29 0.0 +2 0.148996005836 45 1.47 + +# YNL143C +height FDR actual_density mean_random_density +>=19 0.0 1811 0.0 +18 0.0107121991983 47 0.05 +17 0.0214232873639 47 0.14 +16 0.0550456934206 48 0.52 + +# INT_0_6603 +height FDR actual_density mean_random_density +3 0.0 27 0.0 +2 0.0526835197897 28 0.19 + +# INT_0_6465 +height FDR actual_density mean_random_density +3 0.0398782066539 50 0.2 +2 0.1968392815 52 4.67 + +# CUT322 +height FDR actual_density mean_random_density +>=9 0.0 549 0.0 +8 0.0141203007519 40 0.08 +7 0.0522750560829 40 0.49 + +# LAP3 +height FDR actual_density mean_random_density +3 0.0 51 0.0 +2 0.220868719576 52 4.08 + +# SUT760 +height FDR actual_density mean_random_density +3 0.0313626173036 39 0.25 +2 0.267267032325 87 26.47 + +# KEX2 +height FDR actual_density mean_random_density +3 0.0 30 0.0 +2 0.146238968749 54 3.27 + +# VAC7 +height FDR actual_density mean_random_density +3 0.0 51 0.0 +2 0.184293270796 54 2.9 + +# INT_0_6643 +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.303176360981 23 3.26 + +# SAM50 +height FDR actual_density mean_random_density +>=3 0.0 89 0.0 +2 0.279852871576 48 9.12 + +# INT_0_6359 +height FDR actual_density mean_random_density +>=3 0.0 55 0.0 +2 0.205743146073 21 1.46 + +# INT_0_6738 +height FDR actual_density mean_random_density +4 0.0 3 0.0 +3 0.118849382321 11 0.15 + +# ADE12 +height FDR actual_density mean_random_density +>=4 0.0 53 0.0 +3 0.0940512243586 52 1.28 + +# CUT818 +height FDR actual_density mean_random_density +>=13 0.0 467 0.0 +12 0.0135837635504 52 0.07 +11 0.0709041262507 53 0.71 + +# CUT814 +height FDR actual_density mean_random_density +3 0.00906668505452 22 0.02 +2 0.2094456127 55 9.51 + +# CUT816 +height FDR actual_density mean_random_density +>=7 0.0 116 0.0 +6 0.0378396059902 33 0.22 +5 0.140402110607 34 1.59 + +####### chromosome chrXV ####### + +# CUT387 +height FDR actual_density mean_random_density +3 0.0263618158669 19 0.05 +2 0.327026509834 20 3.78 + +# CUT386 +height FDR actual_density mean_random_density +8 0.0 12 0.0 +7 0.0154386465734 26 0.04 +6 0.0601719996321 32 0.35 + +# EFT1 +height FDR actual_density mean_random_density +>=5 0.0 93 0.0 +4 0.0219916511083 55 0.19 +3 0.153030891296 86 6.47 + +# INT_0_7386 +height FDR actual_density mean_random_density +>=13 0.0 471 0.0 +12 0.00273047754947 37 0.01 +11 0.0153024881449 38 0.09 +10 0.0448743820513 39 0.43 +9 0.118052330827 40 1.82 + +# VPH1 +height FDR actual_density mean_random_density +3 0.0 6 0.0 +2 0.414498104392 26 6.32 + +# YOR292C +height FDR actual_density mean_random_density +>=5 0.0 269 0.0 +4 0.0910414874555 40 1.09 + +# SNR81 +height FDR actual_density mean_random_density +>=38 0.0 1970 0.0 +37 0.00558362035974 52 0.04 +36 0.0209578585488 53 0.15 +35 0.0388967403353 53 0.3 +34 0.0532498788994 53 0.55 + +# tR(ACG)O +height FDR actual_density mean_random_density +>=15 0.0 26 0.0 +14 0.0177377497816 24 0.05 +13 0.0775073344611 26 0.33 + +# FRT1 +height FDR actual_density mean_random_density +>=3 0.0 52 0.0 +2 0.233362383785 52 5.01 + +# INT_0_7424 +height FDR actual_density mean_random_density +2 0.0 29 0.0 +1 0.0707893018592 35 63.79 + +# INT_0_7133 +height FDR actual_density mean_random_density +>=6 0.0 235 0.0 +5 0.0622590775171 30 0.34 + +# INT_0_6817 +height FDR actual_density mean_random_density +5 0.0 29 0.0 +4 0.0283319813808 70 0.31 +3 0.069092663626 148 4.39 + +# RPS28A +height FDR actual_density mean_random_density +>=6 0.0 38 0.0 +5 0.024301039057 21 0.06 +4 0.214124138437 21 1.45 + +# TOP1 +height FDR actual_density mean_random_density +>=4 0.0 196 0.0 +3 0.0979711405586 39 1.04 + +# SNR35 +height FDR actual_density mean_random_density +>=21 0.0 747 0.0 +20 0.0208140358403 41 0.16 +19 0.0515039467182 41 0.47 + +# CUT355 +height FDR actual_density mean_random_density +3 0.0 32 0.0 +2 0.303367395243 34 5.31 + +# INT_0_7033 +height FDR actual_density mean_random_density +7 0.0 1 0.0 +6 1.57331862052 1 0.26 + +# INT_0_7031 +height FDR actual_density mean_random_density +>=5 0.0 352 0.0 +4 0.00255305979349 39 0.01 +3 0.130208745609 39 1.43 + +# SUT374 +height FDR actual_density mean_random_density +>=5 0.0 623 0.0 +4 0.0653237844802 37 0.61 + +# YOL097W-A +height FDR actual_density mean_random_density +>=4 0.0 70 0.0 +3 0.160954976225 26 1.45 + +# ABP140 +height FDR actual_density mean_random_density +2 0.0 19 0.0 +1 0.142154230373 21 39.48 + +# INT_0_7155 +height FDR actual_density mean_random_density +>=4 0.0 238 0.0 +3 0.0776494659242 42 0.84 + +# PNS1 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.0781084328397 18 0.42 + +# PLB3 +height FDR actual_density mean_random_density +3 0.0 18 0.0 +2 0.172780218194 42 3.08 + +# INT_0_7266 +height FDR actual_density mean_random_density +3 0.0 3 0.0 +2 1.94713641684 3 1.48 + +# SUP3 +height FDR actual_density mean_random_density +>=10 0.0 143 0.0 +9 0.0487780330918 23 0.26 +8 0.123700876539 24 1.16 + +# CRS5 +height FDR actual_density mean_random_density +5 0.0 26 0.0 +4 0.0592920796242 39 0.23 + +# CUT372 +height FDR actual_density mean_random_density +3 0.0482683238388 42 0.24 +2 0.309787420341 47 9.41 + +# SKM1 +height FDR actual_density mean_random_density +>=4 0.0 59 0.0 +3 0.0540123427045 54 0.52 + +# SHR5 +height FDR actual_density mean_random_density +>=7 0.0 183 0.0 +6 0.00638439121349 47 0.03 +5 0.0411074490076 50 0.31 +4 0.0921154433798 51 1.36 + +# RPP2A +height FDR actual_density mean_random_density +4 0.0 26 0.0 +3 0.00344649503841 29 0.01 +2 0.311385408083 30 5.79 + +# INT_0_7305 +height FDR actual_density mean_random_density +3 0.0 40 0.0 +2 0.201802445818 49 3.93 + +# PTP2 +height FDR actual_density mean_random_density +3 0.0 45 0.0 +2 0.184838976523 50 3.09 + +# INT_0_7539 +height FDR actual_density mean_random_density +3 0.0 14 0.0 +2 0.181592363363 55 4.57 + +# CUT869 +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.0610899245768 18 0.18 + +# CUT865 +height FDR actual_density mean_random_density +3 0.0 3 0.0 +2 0.767109779657 7 3.29 + +# HER1 +height FDR actual_density mean_random_density +>=4 0.0 23 0.0 +3 0.199129292336 14 0.42 + +# INT_0_7051 +height FDR actual_density mean_random_density +>=3 0.0 56 0.0 +2 0.113593038135 47 1.16 + +# INT_0_7055 +height FDR actual_density mean_random_density +4 0.0 19 0.0 +3 0.168967559716 21 1.05 + +# INT_0_6935 +height FDR actual_density mean_random_density +3 0.0 9 0.0 +2 0.141251300653 21 0.52 + +# INT_0_7434 +height FDR actual_density mean_random_density +4 0.0 31 0.0 +3 0.0746747505846 40 0.3 + +# CUT362 +height FDR actual_density mean_random_density +>=6 0.0 253 0.0 +5 0.0674693696806 39 0.63 + +# SUT792 +height FDR actual_density mean_random_density +3 0.00996629473231 10 0.01 +2 0.393850793953 15 3.65 + +# SUT386 +height FDR actual_density mean_random_density +4 0.0 13 0.0 +3 0.0209690217473 19 0.04 +2 0.200748467011 30 2.75 + +# INT_0_7273 +height FDR actual_density mean_random_density +2 0.0 18 0.0 +1 0.0928298881652 19 36.73 + +# LAS17 +height FDR actual_density mean_random_density +>=3 0.0 76 0.0 +2 0.237019606807 37 4.67 + +# INT_0_7016 +height FDR actual_density mean_random_density +>=7 0.0 71 0.0 +6 0.0084022630829 36 0.03 +5 0.104668446965 36 0.58 + +# CUT836 +height FDR actual_density mean_random_density +>=6 0.0 111 0.0 +5 0.0260646931073 23 0.06 +4 0.113405228299 24 0.8 + +# INT_0_7087 +height FDR actual_density mean_random_density +12 0.0 9 0.0 +11 0.0192747223043 21 0.04 +10 0.0539741627205 22 0.15 + +# APM4 +height FDR actual_density mean_random_density +>=5 0.0 197 0.0 +4 0.0343510493321 49 0.38 +3 0.24682418855 53 7.62 + +# DNL4 +height FDR actual_density mean_random_density +>=4 0.0 134 0.0 +3 0.0499364292409 56 0.3 +2 0.37556442235 58 17.47 + +# INT_0_7471 +height FDR actual_density mean_random_density +>=5 0.0 393 0.0 +4 0.0388661786879 41 0.16 +3 0.143151975962 41 1.74 + +# PFY1 +height FDR actual_density mean_random_density +5 0.0 31 0.0 +4 0.0262924581366 35 0.11 +3 0.196890137309 41 2.74 + +# SNR17A +height FDR actual_density mean_random_density +>=16 0.0 980 0.0 +15 0.0021374027103 47 0.01 +14 0.015234224862 48 0.09 +13 0.0325482645581 48 0.2 +12 0.0674926854781 49 0.9 + +# SUT350 +height FDR actual_density mean_random_density +3 0.0417636312524 43 0.18 +2 0.230881325802 47 3.34 + +# SUT358 +height FDR actual_density mean_random_density +>=3 0.0 87 0.0 +2 0.335097911892 53 11.48 + +# ATG19 +height FDR actual_density mean_random_density +4 0.029890690875 20 0.06 +3 0.140587232787 29 0.92 + +# YOR142W-B +height FDR actual_density mean_random_density +2 0.0134552656438 37 0.05 +1 0.105265834787 74 109.7 + +# STI1 +height FDR actual_density mean_random_density +>=5 0.0 92 0.0 +4 0.01931650107 62 0.12 +3 0.0948683164429 90 4.35 + +# SUT772 +height FDR actual_density mean_random_density +>=4 0.0 71 0.0 +3 0.152028181849 53 2.56 + +# SNR9 +height FDR actual_density mean_random_density +>=9 0.0 32 0.0 +8 0.0425706311881 34 0.21 +7 0.112325209287 44 1.35 + +# SNR8 +height FDR actual_density mean_random_density +>=16 0.0 109 0.0 +15 0.0257446533849 32 0.14 +14 0.0797694297918 34 0.58 + +# INT_0_7331 +height FDR actual_density mean_random_density +>=4 0.0 50 0.0 +3 0.123435984562 25 0.65 + +# INT_0_7334 +height FDR actual_density mean_random_density +>=5 0.0 83 0.0 +4 0.0415174401716 24 0.1 +3 0.159418227708 25 1.15 + +# INT_0_7335 +height FDR actual_density mean_random_density +3 0.0 26 0.0 +2 0.219815381021 28 1.92 + +# BDS1 +height FDR actual_density mean_random_density +3 0.0 34 0.0 +2 0.144168597927 55 2.2 + +# INT_0_7523 +height FDR actual_density mean_random_density +>=20 0.0 1038 0.0 +19 0.00274123856876 37 0.01 +18 0.0136787280702 38 0.1 +17 0.0514652155959 39 0.59 + +# INT_0_7295 +height FDR actual_density mean_random_density +>=3 0.0 39 0.0 +2 0.119848962879 36 1.05 + +# INT_0_6836 +height FDR actual_density mean_random_density +>=3 0.0 186 0.0 +2 0.227443248629 36 3.33 + +# YRM1 +height FDR actual_density mean_random_density +>=4 0.0 83 0.0 +3 0.0381730910964 47 0.18 +2 0.264514807283 55 9.02 + +# VMA4 +height FDR actual_density mean_random_density +>=5 0.0 41 0.0 +4 0.0241928225267 30 0.09 +3 0.200342656958 39 3.52 + +# TYE7 +height FDR actual_density mean_random_density +>=5 0.0 90 0.0 +4 0.0175648331032 65 0.17 +3 0.122646673621 90 7.27 + +# MDH2 +height FDR actual_density mean_random_density +3 0.0 38 0.0 +2 0.176855880104 41 2.4 + +# GPD2 +height FDR actual_density mean_random_density +4 0.0 26 0.0 +3 0.0456779022948 44 0.3 +2 0.255192832869 83 19.81 + +# PIN2 +height FDR actual_density mean_random_density +>=4 0.0 91 0.0 +3 0.110926760757 31 0.95 + +# CUT378 +height FDR actual_density mean_random_density +>=8 0.0 371 0.0 +7 0.0229320275245 50 0.14 +6 0.0812532934011 51 1.11 + +# INT_0_7110 +height FDR actual_density mean_random_density +>=5 0.0 250 0.0 +4 0.0610537143427 49 0.3 + +# INT_0_7114 +height FDR actual_density mean_random_density +3 0.0 29 0.0 +2 0.157954243205 55 2.85 + +# tD(GUC)O +height FDR actual_density mean_random_density +10 0.0 4 0.0 +9 0.0127269554479 18 0.03 +8 0.0477080625429 31 0.2 +7 0.0925131846587 34 0.8 + +# CUT395 +height FDR actual_density mean_random_density +3 0.0284577255237 21 0.06 +2 0.208184887061 22 1.34 + +# RPO31 +height FDR actual_density mean_random_density +3 0.0 40 0.0 +2 0.159504567893 54 3.07 + +# INT_0_7482 +height FDR actual_density mean_random_density +3 0.0 21 0.0 +2 0.125479241804 36 1.29 + +# INT_0_7393 +height FDR actual_density mean_random_density +>=10 0.0 36 0.0 +9 0.00281170088191 36 0.01 +8 0.0285900640156 39 0.11 +7 0.0426777287206 41 0.29 +6 0.0907766984257 43 1.68 + +# HRP1 +height FDR actual_density mean_random_density +3 0.0 31 0.0 +2 0.0885564712781 33 0.68 + +# YOR019W +height FDR actual_density mean_random_density +3 0.036060335871 47 0.17 +2 0.231951342484 48 5.35 + +# PET123 +height FDR actual_density mean_random_density +3 0.0 39 0.0 +2 0.257871242919 41 4.81 + +# INT_0_7413 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.126307825642 38 1.0 + +# INT_0_7145 +height FDR actual_density mean_random_density +3 0.0 20 0.0 +2 0.0744825546293 31 0.38 + +# INT_0_6941 +height FDR actual_density mean_random_density +4 0.0 35 0.0 +3 0.012454059781 40 0.05 +2 0.242931422312 43 4.45 + +# INT_0_7094 +height FDR actual_density mean_random_density +>=3 0.0 54 0.0 +2 0.254870413813 35 3.59 + +# CPA1 +height FDR actual_density mean_random_density +>=3 0.0 77 0.0 +2 0.289784834307 51 9.06 + +# SGT2 +height FDR actual_density mean_random_density +5 0.0333828856852 75 0.25 +4 0.0628248893063 87 1.7 + +# SGT1 +height FDR actual_density mean_random_density +>=3 0.0 41 0.0 +2 0.301248390522 23 3.56 + +# MAM3 +height FDR actual_density mean_random_density +>=4 0.0 57 0.0 +3 0.0806746482512 36 0.68 + +# TIR2 +height FDR actual_density mean_random_density +3 0.0 16 0.0 +2 0.164098108771 24 1.22 + +# IRC13 +height FDR actual_density mean_random_density +>=7 0.0 62 0.0 +6 0.054307851256 24 0.13 + +# INT_0_7326 +height FDR actual_density mean_random_density +>=15 0.0 41 0.0 +14 0.0571276114182 14 0.08 + +# ADH1 +height FDR actual_density mean_random_density +>=12 0.0 15 0.0 +11 0.0581015924101 12 0.07 + +# YOL164W-A +height FDR actual_density mean_random_density +3 0.0 44 0.0 +2 0.284097262164 56 8.98 + +# INT_0_7516 +height FDR actual_density mean_random_density +4 0.0 50 0.0 +3 0.0380224171539 53 0.28 +2 0.277727753176 55 12.65 + +# TPO4 +height FDR actual_density mean_random_density +>=6 0.0 153 0.0 +5 0.0084357417992 71 0.06 +4 0.0604031078578 88 1.05 + +# RPB11 +height FDR actual_density mean_random_density +>=4 0.0 37 0.0 +3 0.104496566372 20 0.49 + +# INT_0_7071 +height FDR actual_density mean_random_density +2 0.0 37 0.0 +1 0.135447447796 49 84.93 + +# INT_0_7173 +height FDR actual_density mean_random_density +>=7 0.0 251 0.0 +6 0.0333566170362 49 0.28 +5 0.14735663976 51 3.22 + +# INT_0_7106 +height FDR actual_density mean_random_density +>=4 0.0 167 0.0 +3 0.0532617246723 52 0.55 + +# LEU9 +height FDR actual_density mean_random_density +3 0.0244279617537 26 0.09 +2 0.157788638447 87 8.7 + +# DIS3 +height FDR actual_density mean_random_density +>=3 0.0 37 0.0 +2 0.141763254619 57 3.9 + +# PMT3 +height FDR actual_density mean_random_density +2 0.00538686113352 37 0.02 +1 0.19834900201 54 88.66 + +# CUT368 +height FDR actual_density mean_random_density +>=5 0.0 481 0.0 +4 0.0971055769607 67 3.04 + +# CUT364 +height FDR actual_density mean_random_density +6 0.0 15 0.0 +5 0.0758392091357 19 0.29 + +####### chromosome chrXVI ####### + +# SUT426 +height FDR actual_density mean_random_density +4 0.0 25 0.0 +3 0.0793028609267 27 0.37 + +# INT_0_7901 +height FDR actual_density mean_random_density +>=3 0.0 68 0.0 +2 0.279338957022 47 8.51 + +# INT_0_7774 +height FDR actual_density mean_random_density +3 0.0 4 0.0 +2 0.202959315834 19 0.99 + +# ALD6 +height FDR actual_density mean_random_density +>=6 0.0 369 0.0 +5 0.0563148605433 72 0.8 + +# ISM1 +height FDR actual_density mean_random_density +3 0.0 10 0.0 +2 0.206583129778 23 1.6 + +# INT_0_8005 +height FDR actual_density mean_random_density +>=3 0.0 61 0.0 +2 0.220556500584 23 1.4 + +# NSL1 +height FDR actual_density mean_random_density +>=5 0.0 134 0.0 +4 0.104482972438 44 1.26 + +# RPL7B +height FDR actual_density mean_random_density +>=6 0.0 401 0.0 +5 0.00994502059019 81 0.09 +4 0.0758343701511 88 3.65 + +# INT_0_7817 +height FDR actual_density mean_random_density +3 0.0 17 0.0 +2 0.134997440387 18 0.51 + +# YPL222C-A +height FDR actual_density mean_random_density +>=18 0.0 819 0.0 +17 0.00566158117105 40 0.03 +16 0.0356398122493 40 0.22 +15 0.0876358201652 41 0.75 + +# INT_0_7558 +height FDR actual_density mean_random_density +3 0.0 22 0.0 +2 0.0974728887544 55 1.04 + +# CUT896 +height FDR actual_density mean_random_density +4 0.0 20 0.0 +3 0.0769538655012 22 0.35 + +# ICY2 +height FDR actual_density mean_random_density +5 0.0251557632399 36 0.1 +4 0.0847359270355 51 1.86 + +# LSP1 +height FDR actual_density mean_random_density +>=5 0.0 34 0.0 +4 0.0276787328457 18 0.05 +3 0.201601671571 23 1.22 + +# YPL162C +height FDR actual_density mean_random_density +4 0.0 28 0.0 +3 0.109033445789 31 0.96 + +# CUT923 +height FDR actual_density mean_random_density +>=11 0.0 524 0.0 +10 0.0222922378314 36 0.08 +9 0.0445336343492 39 0.39 +8 0.112897167459 42 1.83 + +# SAM4 +height FDR actual_density mean_random_density +>=5 0.0 252 0.0 +4 0.0404146397783 54 0.41 +3 0.221058268124 55 7.31 + +# HSP82 +height FDR actual_density mean_random_density +>=7 0.0 337 0.0 +6 0.00753206648215 66 0.07 +5 0.0336913228978 94 0.85 +4 0.101919452552 102 7.04 + +# NCR1 +height FDR actual_density mean_random_density +>=3 0.0 42 0.0 +2 0.182382935184 23 1.22 + +# INT_0_7985 +height FDR actual_density mean_random_density +3 0.0 15 0.0 +2 0.124326860768 30 1.09 + +# CUT411 +height FDR actual_density mean_random_density +3 0.0090724773794 22 0.02 +2 0.320943945726 26 3.38 + +# YDC1 +height FDR actual_density mean_random_density +>=5 0.0 107 0.0 +4 0.0105073072438 38 0.04 +3 0.17787493359 50 3.64 + +# SYT1 +height FDR actual_density mean_random_density +2 0.0280084715464 32 0.09 +1 0.108436879476 57 87.5 + +# INT_0_7762 +height FDR actual_density mean_random_density +3 0.0 23 0.0 +2 0.265331130294 25 3.71 + +# INT_0_8065 +height FDR actual_density mean_random_density +>=6 0.0 70 0.0 +5 0.0202205882353 21 0.06 +4 0.0906308403332 22 0.52 + +# FMP40 +height FDR actual_density mean_random_density +3 0.0 2 0.0 +2 1.17602459219 8 3.09 + +# TEF1 +height FDR actual_density mean_random_density +>=5 0.0 64 0.0 +4 0.0498665951188 62 0.73 +3 0.193170442436 74 9.62 + +# SNR59 +height FDR actual_density mean_random_density +>=13 0.0 90 0.0 +12 0.0155639092888 13 0.02 +11 0.047018652978 14 0.1 +10 0.108748612644 14 0.33 + +# CUT907 +height FDR actual_density mean_random_density +>=9 0.0 12 0.0 +8 0.0275790818209 23 0.08 +7 0.0522589887894 27 0.44 + +# BET2 +height FDR actual_density mean_random_density +3 0.0 8 0.0 +2 0.195476615951 23 1.32 + +# YPR137C-B +height FDR actual_density mean_random_density +4 0.0 17 0.0 +3 0.028188490205 53 0.15 +2 0.29019071022 73 16.96 + +# CAR1 +height FDR actual_density mean_random_density +5 0.0 17 0.0 +4 0.0155904232367 32 0.05 +3 0.108442755531 40 0.82 + +# SUP16 +height FDR actual_density mean_random_density +>=37 0.0 1045 0.0 +36 0.0025487498466 41 0.01 +35 0.0124548446345 42 0.05 +34 0.0221497447533 43 0.1 +33 0.037903679736 43 0.32 +32 0.0694659337859 43 0.75 + +# CUR1 +height FDR actual_density mean_random_density +>=6 0.0 111 0.0 +5 0.079054190703 32 0.44 + +# SUT400 +height FDR actual_density mean_random_density +3 0.0458866760684 20 0.13 +2 0.362111521211 21 4.2 + +# SUT818 +height FDR actual_density mean_random_density +>=4 0.0 47 0.0 +3 0.0944995212512 27 0.46 + +# SKI3 +height FDR actual_density mean_random_density +3 0.0 26 0.0 +2 0.137772455437 41 1.51 + +# tA(AGC)P +height FDR actual_density mean_random_density +9 0.0 19 0.0 +8 0.0766555973815 21 0.22 + +# INT_0_7675 +height FDR actual_density mean_random_density +>=6 0.0 70 0.0 +5 0.0995545576642 6 0.06 + +# INT_0_8150 +height FDR actual_density mean_random_density +>=4 0.0 504 0.0 +3 0.0617396704052 46 0.64 + +# INT_0_8153 +height FDR actual_density mean_random_density +>=3 0.0 42 0.0 +2 0.424807464397 30 8.28 + +# RPL1A +height FDR actual_density mean_random_density +>=5 0.0 70 0.0 +4 0.0230642051209 52 0.24 +3 0.14935887013 57 4.29 + +# YPL250W-A +height FDR actual_density mean_random_density +>=7 0.0 36 0.0 +6 0.0335134701258 30 0.1 +5 0.0742018080341 44 0.79 + +# tK(CUU)P +height FDR actual_density mean_random_density +9 0.0 11 0.0 +8 0.0642851499743 12 0.1 + +# GCR1 +height FDR actual_density mean_random_density +3 0.0 40 0.0 +2 0.176869065948 42 2.63 + +# YPR091C +height FDR actual_density mean_random_density +>=4 0.0 66 0.0 +3 0.0119710319045 49 0.09 +2 0.331220064476 50 10.82 + +# INT_0_7974 +height FDR actual_density mean_random_density +2 0.0497854959801 23 0.21 +1 0.135287510283 64 86.03 + +# CUT424 +height FDR actual_density mean_random_density +>=4 0.0 30 0.0 +3 0.0994589640486 24 0.45 + +# NOG1 +height FDR actual_density mean_random_density +>=5 0.0 103 0.0 +4 0.0199309847975 35 0.07 +3 0.0712284666793 75 1.4 + +# GPH1 +height FDR actual_density mean_random_density +3 0.0 28 0.0 +2 0.177589740983 79 7.93 + +# GDB1 +height FDR actual_density mean_random_density +>=4 0.0 51 0.0 +3 0.0196489914236 94 0.26 +2 0.213839526415 103 15.77 + +# MRN1 +height FDR actual_density mean_random_density +4 0.0 29 0.0 +3 0.0417865425801 31 0.13 +2 0.278822295901 39 5.47 + +# RPS23B +height FDR actual_density mean_random_density +4 0.0 26 0.0 +3 0.115432327918 28 0.9 + +# SNR45 +height FDR actual_density mean_random_density +>=21 0.0 830 0.0 +20 0.0094882552289 43 0.04 +19 0.0200512103561 48 0.15 +18 0.04188456228 48 0.53 +17 0.0862158605047 49 1.45 + +# INT_0_7683 +height FDR actual_density mean_random_density +2 0.0115686662962 50 0.08 +1 0.140256941492 55 103.49 + +# CUT878 +height FDR actual_density mean_random_density +>=7 0.0 44 0.0 +6 0.0456955120938 27 0.28 +5 0.138510658736 27 1.49 + +# INT_0_7639 +height FDR actual_density mean_random_density +>=4 0.0 63 0.0 +3 0.0460653277831 120 1.51 +2 0.193229598236 150 31.15 + +# INT_0_7630 +height FDR actual_density mean_random_density +>=6 0.0 130 0.0 +5 0.0348929131649 43 0.15 +4 0.0613961147374 52 0.5 + +# RPL21B +height FDR actual_density mean_random_density +4 0.0 51 0.0 +3 0.0591390989129 52 0.48 + +# SSE1 +height FDR actual_density mean_random_density +>=4 0.0 185 0.0 +3 0.0988140309038 61 2.08 + +# ULA1 +height FDR actual_density mean_random_density +3 0.0438954753518 43 0.34 +2 0.260242007385 57 10.9 + +# SUT412 +height FDR actual_density mean_random_density +>=5 0.0 60 0.0 +4 0.067191362812 33 0.25 + +# SUT417 +height FDR actual_density mean_random_density +>=4 0.0 115 0.0 +3 0.0848436491489 47 0.4 + +# SUT823 +height FDR actual_density mean_random_density +4 0.0 30 0.0 +3 0.027278708289 44 0.12 +2 0.2863706473 47 9.57 + +# CUT912 +height FDR actual_density mean_random_density +>=5 0.0 41 0.0 +4 0.0174388094757 23 0.04 +3 0.227174858555 26 2.78 + +# CDC60 +height FDR actual_density mean_random_density +2 0.0 49 0.0 +1 0.225322352308 51 96.98 + +# tE(UUC)P +height FDR actual_density mean_random_density +>=11 0.0 48 0.0 +10 0.0326107499227 25 0.13 +9 0.0962190505459 31 0.89 + +# YPR114W +height FDR actual_density mean_random_density +3 0.0 19 0.0 +2 0.226972769557 36 3.24 + +# INT_0_7643 +height FDR actual_density mean_random_density +8 0.0 15 0.0 +7 0.0107204655498 19 0.02 +6 0.0681609453184 21 0.25 + +# INT_0_8009 +height FDR actual_density mean_random_density +4 0.0 14 0.0 +3 0.0971623080447 20 0.33 + +# CUT910 +height FDR actual_density mean_random_density +4 0.0383959923746 28 0.14 +3 0.15134230431 58 3.66 + +# DPB2 +height FDR actual_density mean_random_density +4 0.0 39 0.0 +3 0.0394140780354 41 0.23 +2 0.275043926259 45 5.98 + +# GLN1 +height FDR actual_density mean_random_density +4 0.0 37 0.0 +3 0.0664260680185 49 0.52 + +# RHO1 +height FDR actual_density mean_random_density +4 0.0 23 0.0 +3 0.175945847686 25 0.98 + +# DIP5 +height FDR actual_density mean_random_density +4 0.0 18 0.0 +3 0.0580396516841 37 0.3 + +# INT_0_8160 +height FDR actual_density mean_random_density +3 0.0 28 0.0 +2 0.0639346792822 29 0.37 + +# CUT432 +height FDR actual_density mean_random_density +>=5 0.0 101 0.0 +4 0.014968639168 40 0.06 +3 0.150377303462 61 4.61 + +# YPR003C +height FDR actual_density mean_random_density +3 0.0 24 0.0 +2 0.206375578389 24 1.78 + +# USV1 +height FDR actual_density mean_random_density +>=4 0.0 41 0.0 +3 0.124528314611 44 1.35 + +# CUT917 +height FDR actual_density mean_random_density +3 0.0332842917484 21 0.07 +2 0.422360326519 23 7.92 + +# FAS2 +height FDR actual_density mean_random_density +>=4 0.0 76 0.0 +3 0.0450416864566 74 0.61 +2 0.275673017729 86 18.74 + +# INT_0_8212 +height FDR actual_density mean_random_density +3 0.0 25 0.0 +2 0.142630268417 27 1.21 + +# YPR045C +height FDR actual_density mean_random_density +>=4 0.0 59 0.0 +3 0.126459939987 27 1.22 + +# TPO3 +height FDR actual_density mean_random_density +>=4 0.0 72 0.0 +3 0.16026373296 39 1.92 + +# CSR2 +height FDR actual_density mean_random_density +>=3 0.0 78 0.0 +2 0.217198646733 56 4.73 + +# VMA13 +height FDR actual_density mean_random_density +>=6 0.0 473 0.0 +5 0.0633461060527 54 0.76 + +# YPR036W-A +height FDR actual_density mean_random_density +>=9 0.0 110 0.0 +8 0.022753172543 62 0.14 +7 0.044807164846 74 0.69 +6 0.0989871272946 87 3.68 + +# GDE1 +height FDR actual_density mean_random_density +2 0.0412045736878 29 0.12 +1 0.097738469763 33 61.61 + +# INT_0_7991 +height FDR actual_density mean_random_density +4 0.0 21 0.0 +3 0.152042653571 22 0.69 + +# INT_0_7995 +height FDR actual_density mean_random_density +>=6 0.0 106 0.0 +5 0.0380353311813 45 0.22 +4 0.134819773906 50 1.8 + +# CUT405 +height FDR actual_density mean_random_density +>=5 0.0 18 0.0 +4 0.0590013157251 28 0.3
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/makeFasta.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,84 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "id=s", "input=s", "out=s", "output_path=s", "genes=s", "limit=i", "outFormat=s"); + +my @genes = (split /,/, $opt{genes}); + + +# Create the output directory (for the multiple output files) +my $output_path = $opt{output_path}; + +my @files = (); +my $found = 0; + +open(LOG, ">$opt{out}") or die "cannot write to output file\n"; + +foreach my $g(@genes){ + $g =~ tr/a-z/A-Z/; + open (IN, $opt{input}) or die "Cannot open input file\n"; + while(my $line = <IN>){ + chomp ($line); + if ($line =~ m/##/){ + if ($found == 1){ + close OUT; + $found = 0; + } + my $l = $line; + $line =~ s/#//g; + my $gene = (split (/\s+/,$line))[1]; + $gene =~ tr/a-z/A-Z/; + + if ($gene eq $g){ + my $sense = (split (/\s+/,$line))[2]; + + my $label = "$gene.$sense"; + + my $fileName = "$output_path/primary_$opt{id}_$label"."_visible_fasta"; + push (@files,$label); + + open(OUT, ">$fileName") or die "cannot write to output file\n"; + print OUT "$l\n"; + $found = 1; + } + } + elsif ($found == 1){ + print OUT "$line\n"; + } + } + if ($found == 1){ + close OUT; + } + close IN; +} + + +my $count = 0; +print LOG "Files produced:\n\n"; +foreach(@files){ + + if ($opt{outFormat}eq "align" || $opt{outFormat} eq "both"){ + #For production version will need to provide alignment to tab on path. + my $label = "$_.aln"; + system "/usr/local/bin/pyAlignment2Tab.py $output_path/primary_$opt{id}_$_"."_visible_fasta --limit $opt{limit} --galaxy > $output_path/primary_$opt{id}_$label"."_visible_tabular"; + print LOG "$_.aln\n"; + $count ++; + if ($opt{outFormat}eq "align"){ + system "rm $output_path/primary_$opt{id}_$_"."_visible_fasta"; + } + } + if ($opt{outFormat}eq "fasta" || $opt{outFormat} eq "both"){ + print LOG "$_\n"; + $count ++; + } +} +print LOG "\n$count files produced:\n\n"; +print LOG "Please refresh history if not all files are displayed"; + +close LOG; + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/makeFasta.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,79 @@ +<tool id="makeFasta" name="Extract IDs" force_history_refresh="True"> + <description>from Read Aligner output</description> + <command interpreter="perl"> + #if $format.formatChoice == "fasta" #makeFasta.pl --input $input --genes "$genes.g" --outFormat $format.formatChoice --out $out --id $out.id --output_path $__new_file_path__ + #else #makeFasta.pl --input $input --genes "$genes.g" --outFormat $format.formatChoice --limit $format.limit --out $out --id $out.id --output_path $__new_file_path__ + #end if# + + </command> + <inputs> + <param name="input" type="data" format="fasta" label="Read Aligner output file" help="Fasta file"/> + <conditional name="genes"> + <param name="choice" type="select" label="Choose IDs by"> + <option value="index">ID Index File</option> + <option value="number" selected="true">Text Box</option> + </param> + <when value="index"> + <param name="indices" type="data" format="tabular" label="ID Index"/> + <param name="g" type="select" multiple="true" accept_default="true" label="ID" > + <options from_dataset="indices"> + <column name="name" index="0"/> + <column name="value" index="0"/> + </options> + </param> + </when> + <when value="number"> + <param name="g" type="text" format="txt" size="200" value="" label="IDs" help="Enter identifiers separated by a comma"> + <validator type="empty_field" /> + </param> + </when> + </conditional> + <conditional name="format"> + <param name="formatChoice" type="select" label="Choose output format"> + <option value="fasta" selected="true">Fasta</option> + <option value="align">Tabular Alignment</option> + <option value="both">Both</option> + </param> + <when value="align"> + <param name="limit" type="integer" format="integer" value="90" size="4" label="Set the column width of alignment" help="Enter a value > 50"> + <validator type="in_range" min="50" message="Please enter a value greater than 50"/> + </param> + </when> + <when value="both"> + <param name="limit" type="integer" format="integer" value="90" size="4" label="Set the column width of alignment" help="Enter a value > 50"> + <validator type="in_range" min="50" message="Please enter a value greater than 50"/> + </param> + </when> + <when value="fasta"> + </when> + </conditional> + </inputs> + <outputs> + <data name="out" format="txt" label="Extract IDs"/> + </outputs> + <help> +.. class:: infomark + +**What it does** + +Splits the fasta pyReadAligner output in to individual files per selected ID. + +To select IDs by text box + + - Enter identifiers separated by a comma e.g RDN37-1,RPL7A,SNR17A. + +To select IDs by ID index file + + - Provide a file of data type indexfile (use pencil icon to edit data type) + - The index file should contain all possible IDs in the first column + - Select multiple IDs by holding Shift or Ctrl keys + +Output formats + + - Fasta - Output reads and reference sequence in fasta format + - Alignment tab - Format output to show read sequences aligned to reference sequence + - Both - Output both of the formats above + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyAlignment2Tab.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,139 @@ +<tool id="pyAlignment2Tab" name="pyAlignment2Tab"> + <description>converter</description> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python">/usr/local/bin/pyAlignment2Tab.py -f $input --limit $limit -o $output --singlefile + </command> + <version_command>/usr/local/bin/pyAlignment2Tab.py --version</version_command> + <inputs> + <param name="input" type="data" format="fasta" label="pyReadAligner output file -f" help="Fasta file"/> + <param name="limit" type="integer" format="integer" value="90" size="4" label="Set the column width of alignment" help="Enter a value > 50"> + <validator type="in_range" min="50" message="Please enter a value greater than 50"/> + </param> + <param name="label" type="text" format="txt" size="30" value="pyAlignment2Tab" label="Enter output file label -o" /> + </inputs> + <outputs> + <data name="output" format="txt" label="${label.value}.tab"/> + </outputs> + <help> + +.. class:: infomark + +**pyAlignment2Tab** + +pyAlignment2Tab is part of the pyCRAC_ package. Converts pyReadAligner fasta output to a tabular alignment output. + +Example:: + + The tool expects a standard pyReadAligner fasta-formatted output file: + + >GeneX + ATGTCTCGTACTAACATGGATACAAGACACGCACATTCTGCTTTACTGGCAGCACCACAGAGTGCTACTGCAAATAGCAGGAGCAGCAACAGCAGCAGCGAGAGTAGTAGTAACAAAAACAATATCAATGTCGGCGTCGGTGACGATAGCGGTAA + >257930-10 + ---TCTCGTACcAACATGGATACAAGACACGCACATTCTGCTT---------------------------------------------------------------------------------------------------------------- + >3664964-1 + ---TCTCGcACcAACATGGATACAAGACACGCACATTtTGCTT---------------------------------------------------------------------------------------------------------------- + >4033560-1 + ---TCTCGTACcAACATGGATACAAGACACGCACATTCTGtTT---------------------------------------------------------------------------------------------------------------- + >8571880-1 + ---TCTCGTACcAACATGGATACAAGACACGCAgATTCTGCTT---------------------------------------------------------------------------------------------------------------- + >9617396-1 + ---TCTCGTACcAACATGGATACAAGACACGCcCATTCTGCTT---------------------------------------------------------------------------------------------------------------- + >843368-5 + ------------AACAcGGATACAAGACACGCACATTCTG------------------------------------------------------------------------------------------------------------------- + >854553-5 + ------------AACATGGATACAAGACACGCAC--TCTG------------------------------------------------------------------------------------------------------------------- + >1522401-2 + --------------CATGGATACAAGACACGCACATTCTGCTTTACTGGCAGgA----------------------------------------------------------------------------------------------------- + >5981234-1 + --------------CATGGATACAAGACACGCACAcTCTGCTTTACTGGCAGCA----------------------------------------------------------------------------------------------------- + >997684-4 + --------------CATGGATACAAGACACGCACATTCTGCTTTACTGGCAGCA----------------------------------------------------------------------------------------------------- + >1046653-4 + ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGGCAGgAC---------------------------------------------------------------------------------------------------- + >1103730-4 + ---------------ATGGATACAAGACACGCACAcTCTG------------------------------------------------------------------------------------------------------------------- + >1603913-2 + ---------------ATGGATACAAGAaACGCACAcTCTG------------------------------------------------------------------------------------------------------------------- + >180349-12 + ---------------ATGGATACAAGACACGCACATTCcGCTTTACTG----------------------------------------------------------------------------------------------------------- + >1985106-1 + ---------------ATGGATACAAGACACGCACATTCgGCTTTACTGGCAGCcC---------------------------------------------------------------------------------------------------- + >1987775-1 + ---------------ATGGATACccGACACGCACATTCTGCTTTACTGcCAGCAC---------------------------------------------------------------------------------------------------- + >2258725-1 + ---------------ATGGATACAAGACACGCACATTCTGCTTTgCTGGCAGCAC---------------------------------------------------------------------------------------------------- + >2631987-1 + ---------------ATGGATACAAGACACGCACATTCTGCTTTACcGGCAGgAC---------------------------------------------------------------------------------------------------- + + This will be converted into: + + 1 .........|.........|.........|.........|.........|.........|.........|.........|.........| 90 + >GeneX ATGTCTCGTACTAACATGGATACAAGACACGCACATTCTGCTTTACTGGCAGCACCACAGAGTGCTACTGCAAATAGCAGGAGCAGCAAC + >257930-10 ---TCTCGTACcAACATGGATACAAGACACGCACATTCTGCTT----------------------------------------------- + >3664964-1 ---TCTCGcACcAACATGGATACAAGACACGCACATTtTGCTT----------------------------------------------- + >4033560-1 ---TCTCGTACcAACATGGATACAAGACACGCACATTCTGtTT----------------------------------------------- + >8571880-1 ---TCTCGTACcAACATGGATACAAGACACGCAgATTCTGCTT----------------------------------------------- + >9617396-1 ---TCTCGTACcAACATGGATACAAGACACGCcCATTCTGCTT----------------------------------------------- + >843368-5 ------------AACAcGGATACAAGACACGCACATTCTG-------------------------------------------------- + >854553-5 ------------AACATGGATACAAGACACGCAC--TCTG-------------------------------------------------- + >1522401-2 --------------CATGGATACAAGACACGCACATTCTGCTTTACTGGCAGgA------------------------------------ + >5981234-1 --------------CATGGATACAAGACACGCACAcTCTGCTTTACTGGCAGCA------------------------------------ + >997684-4 --------------CATGGATACAAGACACGCACATTCTGCTTTACTGGCAGCA------------------------------------ + >1046653-4 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGGCAGgAC----------------------------------- + >1103730-4 ---------------ATGGATACAAGACACGCACAcTCTG-------------------------------------------------- + >1603913-2 ---------------ATGGATACAAGAaACGCACAcTCTG-------------------------------------------------- + >180349-12 ---------------ATGGATACAAGACACGCACATTCcGCTTTACTG------------------------------------------ + >1985106-1 ---------------ATGGATACAAGACACGCACATTCgGCTTTACTGGCAGCcC----------------------------------- + >1987775-1 ---------------ATGGATACccGACACGCACATTCTGCTTTACTGcCAGCAC----------------------------------- + >2258725-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTgCTGGCAGCAC----------------------------------- + >2631987-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTACcGGCAGgAC----------------------------------- + >337206-9 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGGCAGCAC----------------------------------- + >4616761-1 ---------------ATGGATAgAAGACACGCACATTCTGCTTTACTGGtAGCAC----------------------------------- + >4756312-1 ---------------ATGGATACAAcACACGCACAcTCTG-------------------------------------------------- + >4763682-1 ---------------ATGGATACAAGACACGCACATTCcGCTTTcCTG------------------------------------------ + >5971268-1 ---------------ATGGATACAAGACACGCACATTCcGCTcTACTc------------------------------------------ + >6644790-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTcGCAGCAC----------------------------------- + >7112423-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGtCAGCAC----------------------------------- + >7559990-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGGCcGgAC----------------------------------- + >8007281-1 ---------------ATGGATAtAAGACACGCACAcTCTG-------------------------------------------------- + >9150255-1 ---------------ATGGATACAcGACACGCACATTCcGCTTTcCTG------------------------------------------ + >9180814-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGGCAGgcC----------------------------------- + >963117-4 ---------------ATGGATACAAGACACGCACATTCTGCTTTACcGGCAGCAC----------------------------------- + >9672073-1 ---------------ATGGATACAAGACACGCACATTCTGCTTTACTGGCAGCcC----------------------------------- + >971218-4 ---------------ATGGATACAAGACACGCACATcCTGCTTTACTGG-AGCACC---------------------------------- + >10040274-1 -------------------ATACAAGACACGCACATTCTGCTTTACTGGCAGgACCACA------------------------------- + >1063072-4 -------------------ATACAAGACACGCACATTCTGCTTcACTGGCAGCACCACA------------------------------- + >1430188-2 -------------------ATACAAGACACGCACATTCTGCTTTACTGGCAGCACCACA------------------------------- + >5196741-1 -------------------ATACAAGACACGCACATTCTGCTTcACTGGCcGCACCACA------------------------------- + >6017337-1 -------------------ATACAAGACACGCACATTCTGCTTcACTGtCAGaACCcCA------------------------------- + >7159053-1 -------------------ATACAAGACACGCACATTCTGCTTTACTGGCAGCACCcaA------------------------------- + >7528336-1 -------------------ATACAAGACACGCACATTCTGCTTcACTGGCAGCAaCACA------------------------------- + >735584-6 --------------------------------------------------------ACAGAGTGCTACTGCAAAcAGCAGGAGCAGCAAC + >8551047-1 --------------------------------------------------------ACAGAGTGCTAtTGCAAAcAGCAGGAGtAGtAAC + >3000121-1 ------------------------------------------------------------AGTcCTACcGCAAATAGCAGcAGCAGCAAC + >928481-5 ------------------------------------------------------------AGTGCTACcGCAAATAGCAGGAGCAGCAAC + >126987-15 ----------------------------------------------------------------------CAAATAGCAGGAGCAGCAAC + >3122797-1 ----------------------------------------------------------------------CAAATAGCAGGcGCAGCAAC + >6684686-1 ----------------------------------------------------------------------CAAATAGCAGGAGCAGCAAC + + Note that the column width here was set to 90 characters + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f data.fasta + Type the path to the fasta file that you want to use. + --limit=90 + Allows the user to set the column width of the alignment. Default=90 characters + -o output.fasta + Provide the name of your output file + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyBarcodeFilter.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,71 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "f=s", "b=s", "out=s", "output_path=s","id=s","m=i", "file_type=s", "both", "r=s", "version", "i"); + +my $cmnd; + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyBarcodeFilter.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyBarcodeFilter.py -f $opt{f} -b $opt{b} -m $opt{m} --file_type $opt{file_type}"; + + if(defined $opt{r}){ + + $cmnd.= " -r $opt{r}"; + + if(exists $opt{both}){ + $cmnd .= " --both"; + } + } + + if(exists $opt{i}){ + $cmnd .= " -i"; + } +} + +# Create the output directory (for the multiple output files) +my $output_path = $opt{output_path}; + +system $cmnd; + +open(BC,$opt{b}) || die "Cannot open barcode file"; +my %bc; +while(my $line = <BC>){ + chomp($line); + my ($barcode,$sample) = (split(/\t/,$line))[0,1]; + $bc{$barcode}=$sample; +} + +system "mv barcode_statistics.txt $opt{out}"; + +my $ft = lc($opt{file_type}); + +foreach my $key(keys %bc){ + my @split = (split(/\//,$opt{f})); + my $l = @split; + my $output = $split[$l-1]; + $output = (split(/\./,$output))[0]; + $output = "$output"."_"."$key"."_"."$bc{$key}"."."."$ft"; + my $rename = "$output_path/primary_$opt{id}_$bc{$key}-1"."_visible_"."$ft"; + system "mv $output $rename"; + + if(defined $opt{r}){ + my @split2 = (split(/\//,$opt{r})); + $l = @split2; + $output = $split2[$l-1]; + $output = (split(/\./,$output))[0]; + $output = "$output"."_"."$key"."_"."$bc{$key}"."."."$ft"; + $rename = "$output_path/primary_$opt{id}_$bc{$key}-2"."_visible_"."$ft"; + system "mv $output $rename"; + } +} + + +close BC; +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyBarcodeFilter.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,125 @@ + <tool id ="pyBarcodeFilter" name="pyBarcodeFilter" force_history_refresh="True"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + /usr/local/bin/pyBarcodeFilter.pl + --file_type $ftype.type + -f $ftype.f + -b $barcode + -m $mismatch + $index + --out $out + --id $out.id + --output_path $__new_file_path__ + #if $ftype.reverse.rev == "yes": + -r=$ftype.reverse.r + $ftype.reverse.both + #end if# + </command> + <version_command>pyBarcodeFilter.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="type" type="select" label="File type"> + <option value="fastq" selected="true">FASTQ</option> + <option value="fasta">FASTA</option> + </param> + <when value="fastq"> + <param format="fastq" name="f" type="data" label="FastQ File -f" help="FastQ format" /> + <conditional name="reverse"> + <param name="rev" type="select" label="Add a reverse or paired FastQ file"> + <option value="no" selected="true">NO</option> + <option value="yes">YES</option> + </param> + <when value="yes"> + <param format="fastq" name="r" type="data" label="Reverse FastQ File -f" help="FastQ format" /> + <param name="both" type="select" label="Search for barcode in both reads"> + <option value="" selected="true">NO</option> + <option value="--both">YES</option> + </param> + </when> + <when value="no"> + </when> + </conditional> + </when> + <when value="fasta"> + <param format="fasta" name="f" type="data" label="FastA File -f" help="FastA format" /> + <conditional name="reverse"> + <param name="rev" type="select" label="Add a reverse or paired FastA file"> + <option value="no" selected="true">NO</option> + <option value="yes">YES</option> + </param> + <when value="yes"> + <param format="fasta" name="r" type="data" label="Reverse FastA File -f" help="FastA format" /> + <param name="both" type="select" label="Search for barcode in both reads"> + <option value="" selected="true">NO</option> + <option value="--both">YES</option> + </param> + </when> + <when value="no"> + </when> + </conditional> + </when> + </conditional> + <param format="tabular" name="barcode" type="data" label="Barcode File -f" help="Tab delimited file with barcodes and barcode names" /> + <param format="integer" name="mismatch" type="integer" label="Mismatches -m" value="0" size="3" help="Set the number of allowed mismatches in a barcode"> + <validator type="in_range" min="0" max="100" message="Please enter a value between 0 and 100"/> + </param> + <param name="index" type="select" label="Split data using Illumina indexing barcode information -i"> + <option value="" selected="true">NO</option> + <option value="-i">YES</option> + </param> + </inputs> + <outputs> + <data format="text" name="out" label="pyBarcodeFilter"/> + </outputs> + <help> + +.. class:: infomark + +**pySolexaBarcodeFilter** + +pySolexaBarcodeFilter is part of the pyCRAC_ package. Filters sequence files by barcodes. + +This tool requires FASTA or FASTQ input files containing the raw data and a text file containing barcode information. +To process paired end data, use -f and the -r flags to indicate the path to the forward and reverse sequencing reactions, respectively. +The barcodes file should two columns separated by a tab (see the table below). The first column should contain the barcode nucleotide sequences. +The second column should contain an identifier, for example, the name of the barcode or the name of the experiment. +The ’N’ in the barcode sequence indicates a random nucleotide. Make sure to use a simple text editor like TextEdit (MacOS X), gedit (Linux/Unix) or use a text editor in the terminal. +The program is case sensitive: all the nucleotide sequences should be upper case. +You can freely combine different barcodes but if you are mixing samples containing random nucleotide barcodes and normal barcodes. +**NOTE!** make sure to place the regular barcode sequence below the sequence with random nucleotides and make sure the shortest sequence is ALWAYS at the bottom in the column (see below) + +Example of a barcode text file:: + + NNNCGCTTAGC mutant2 + NNNGCGCAGC mutant1 + NNNATTAG control + NNNTAAGC myfavprotein + AGC oldcontrol + AC veryfirstbarcodedsample + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f FILE, --input_file=FILE + name of the FASTQ or FASTA input file + -r FILE, --reverse_input_file=FILE + name of the paired (or reverse) FASTQ or FASTA input file + --file_type=FASTQ + type of file, uncompressed (fasta or fastq) or compressed (fasta.gz or fastq.gz, gzip/gunzip + compressed). Default is fastq + -b FILE, --barcode_list=FILE + name of tab-delimited file containing barcodes and barcode names + -m 1, --mismatches=1 + to set the number of allowed mismatches in a barcode. A maximum of one mismatch is allowed. Default = 0 + -i, --index + use this option if you want to split the data using the Illumina indexing barcode information + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyBinCollector.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,47 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt=(s=>"genomic",numberofbins=>20); + + +GetOptions(\%opt, "f=s","version","gtf=s","range=i","annotation=s", "numberofbins=i","min_length=i","max_length=i","s=s","o=s","ignorestrand","outputall","sd=s","ssub=s","sdel=s","asd=s","assub=s","asdel=s","out=s","options","bins1=i","bins2=i","id=s"); + +my $cmnd; + +my $prefix = "bc_$opt{id}"; + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyBinCollector.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyBinCollector.py -f $opt{f} --gtf $opt{gtf} --annotation $opt{annotation} -o $prefix"; + + if(exists $opt{outputall}) + { + $cmnd .= " --outputall"; + } + + if(exists $opt{options}){ + + $cmnd .= " --range=$opt{range} --numberofbins $opt{numberofbins} --min_length $opt{min_length} --max_length $opt{max_length} -s $opt{s}"; + + if(exists $opt{ignorestrand}){ $cmnd .= " --ignorestrand";} + if(exists $opt{bins1}){ $cmnd .= " --binselect $opt{bins1} $opt{bins2}";} + } +} + + +system $cmnd; +if(exists $opt{outputall}){ + + system "mv sense_data_$prefix.txt $opt{sd}"; + system "mv sense_subs_$prefix.txt $opt{ssub}"; + system "mv sense_dels_$prefix.txt $opt{sdel}"; + system "mv anti_sense_data_$prefix.txt $opt{asd}"; + system "mv anti_sense_subs_$prefix.txt $opt{assub}"; + system "mv anti_sense_dels_$prefix.txt $opt{asdel}"; +} +else{ + system "mv $prefix"."_cumulative_densities_$opt{annotation}"."_$opt{s}_"."$opt{numberofbins}_bins.pileup $opt{out}"; +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyBinCollector.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,290 @@ + <tool id ="pyBinCollector" name="pyBinCollector"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + pyBinCollector.pl + -f $input + --gtf $addGTF.gtf + #if $addGTF.gtfFile == "default" and $addGTF.annotate.annotations == "auto": + --annotation $addGTF.annotate.scan.annotation + #else: + --annotation $addGTF.annotate.annotation + #end if# + #if $addOpt.options == "edit": + --options + --range $addOpt.range + --min_length $addOpt.min_length + --max_length $addOpt.max_length + --numberofbins $addOpt.numberofbins + -s $addOpt.sequence + #if $addOpt.limitBins.binselect == "yes": + --bins1 $addOpt.limitBins.bs_first + --bins2 $addOpt.limitBins.bs_last + #end if# + $addOpt.ignore + $addOpt.oall.outputall + #end if# + -o "$input.name" + #if $addOpt.options == "edit" and $addOpt.oall.outputall == "--outputall": + --id $sd.id + --sd $sd + --ssub $ssub + --sdel $sdel + --asd $asd + --assub $assub + --asdel $asdel + #else: + --out $out + --id $out.id + #end if# + </command> + <version_command>/usr/local/bin/pyBinCollector.py --version</version_command> + <inputs> + <param format="gtf" name="input" type="data" label="Input File -f" help="pyReadCounters or pyMotif gtf output files" /> + + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan pyGetGTFSources file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param format="tabular" name="gtf_annotation" type="data" label="GTF annotation File (pyGetGTFSources output)" help="Tabular file containing unique list of annotations/sources in selected GTF file. Refer to pyGetGTFSources"/> + <conditional name="scan"> + <param name="annotations" type="select" label="Scan this file for annotations" help="Choose the correct GTF file then choose GO"> + <option value="wait" selected="true">Waiting</option> + <option value="scanning">Go</option> + </param> + <when value="wait"> + </when> + <when value="scanning"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf_annotation"> + <column name="name" index="0"/> + <column name="value" index="0"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + + </when> + <when value="other"> + <param format="gtf" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan selected file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf"> + <column name="name" index="1"/> + <column name="value" index="1"/> + <filter type="unique_value" name="unique" column="1"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + + + <conditional name="addOpt"> + <param name="options" type="select" label="Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + <param format="integer" name="numberofbins" type="integer" label="Set the number of bins --numberofbins" value="20" size="7" help="Set the number of bins you want to divide the genes into"> + <validator type="in_range" min="20" max="1000" message="Please enter a value between 20 and 1000"/> + </param> + <param format="integer" name="min_length" type="integer" label="Set the minimum gene length (nt) --min_length" value="50" size="7" help="To filter the data for gene length (nucleotides)" > + <validator type="in_range" min="20" message="Please enter a value greater than 20"/> + </param> + <param format="integer" name="max_length" type="integer" label="Set the maximum gene length (nt) --max_length" help="Default = 100000000" value="100000000" size="10" > + <validator type="in_range" min="50" max="100000000" message="Please enter a value between 50 and 100000000"/> + </param> + <param name="sequence" type="select" label="What sequences do you want to run pyBinCollector on? --sequence"> + <option value="genomic" selected="true">Genomic Sequence</option> + <option value="coding">Coding Sequence</option> + <option value="intron">Introns</option> + <option value="exon">Exons</option> + <option value="CDS">CDS</option> + <option value="5UTR">5UTR</option> + <option value="3UTR">3UTR</option> + </param> + <conditional name="limitBins"> + <param name="binselect" type="select" label="Select sequences that map to specific bins --binselect"> + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <when value="yes"> + <param format="integer" name="bs_first" type="integer" label="Select First Bin" value="1" size="7"> + <validator type="in_range" min="1" message="Please enter a value greater than 0"/> + </param> + <param format="integer" name="bs_last" type="integer" label="Select Last Bin" value="2" size="7"> + <validator type="in_range" min="2" message="Please enter a value greater than 0"/> + </param> + </when> + <when value="no"> + </when> + </conditional> + <param name="ignore" type="select" label="Ignore strand information? --ignorestrand"> + <option value="" selected="true">No</option> + <option value="--ignorestrand">Yes</option> + </param> + <conditional name="oall"> + <param name="outputall" type="select" label="Output all genes --outputall" help="output the normalized distribution for each individual gene, rather than making a cumulative coverage plot"> + <option value="" selected="true">No</option> + <option value="--outputall">Yes</option> + </param> + <when value="--outputall"/> + <when value=""/> + </conditional> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyBinCollector" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="gtf" name="out" label="${label.value}.gtf"> + <filter>addOpt['oall']['outputall'] == ""</filter> + </data> + <data format="txt" name="sd" label="sense_data_${label.value}.txt"> + <filter>addOpt['options'] == "edit" and addOpt['oall']['outputall'] == "--outputall"</filter> + </data> + <data format="txt" name="ssub" label="sense_subs_${label.value}.txt"> + <filter>addOpt['options'] == "edit" and addOpt['oall']['outputall'] == "--outputall"</filter> + </data> + <data format="txt" name="sdel" label="sense_dels_${label.value}.txt"> + <filter>addOpt['options'] == "edit" and addOpt['oall']['outputall'] == "--outputall"</filter> + </data> + <data format="txt" name="asd" label="anti_sense_data_${label.value}.txt"> + <filter>addOpt['options'] == "edit" and addOpt['oall']['outputall'] == "--outputall"</filter> + </data> + <data format="txt" name="assub" label="anti_sense_subs_${label.value}.txt"> + <filter>addOpt['options'] == "edit" and addOpt['oall']['outputall'] == "--outputall"</filter> + </data> + <data format="txt" name="asdel" label="anti_sense_dels_${label.value}.txt"> + <filter>addOpt['options'] == "edit" and addOpt['oall']['outputall'] == "--outputall"</filter> + </data> + </outputs> + <help> + + +.. class:: infomark + +**pyBinCollector** + +pyBinCollector is part of the pyCRAC_ package. Allows the user to generate genome-wide coverage plots. Normalises gene lengths by dividing genes into a +fixed number of bins and then calculates the hit density in each bin. The program also allows the user to input specific bin numbers to extract +blocks/clusters present in these bins. + + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +File input options:: + + -f FILE, --input_file=FILE + Provide the path and name of the pyReadCounters.py or + pyMotif.py GTF file. By default the program expects + data from the standard input. + -o OUTPUT_FILE, --output_file=OUTPUT_FILE + To set an output file name. Do not add a file + extension. By default, if the --outputall flag is not + used, the program writes to the standard output. + --gtf=yeast.gtf + type the path to the gtf annotation file that you want + to use. Default is /usr/local/pyCRAC/db/Saccharomyces_ + cerevisiae.EF2.59.1.2.gtf + +pyBinCollector.py specific options:: + + -a protein_coding, --annotation=protein_coding + select which annotation (i.e. protein_coding, ncRNA, + sRNA, rRNA, tRNA, snoRNA, all) you would like to focus + your search on. Default = all + --min_length=20 + to set a minimum length threshold for genes. Genes + shorter than the minimal length will be discarded. + Default = 1 + --max_length=10000 + to set a maximum length threshold for genes. Genes + larger than the maximum length will be discarded. + Default = 100000000 + -n 20, --numberofbins=20 + select the number of bins you want to generate. + Default=20 + --binselect=2 4 + allows selection of sequences that were mapped to + specific bins. This option expects two numbers, one + for each bin, separated by a space. For example: + --binselect 20 30. + --outputall + use this flag to output the normalized distribution + for each individual gene, rather than making a + cumulative coverage plot. Useful for making box plots + or for making heat maps. + +Common options:: + + -r 100, --range=100 + allows you to set the length of the UTR regions. If + you set '-r 50' or '--range=50', then the program will + set a fixed length (50 bp) regardless of whether the + GTF file has genes with annotated UTRs. + -s intron, --sequence=intron + with this option you can select whether you want to + generate bins from the coding or genomic sequence or + introns,exon,CDS, or UTR coordinates. Default = + genomic + --ignorestrand + To ignore strand information and all reads overlapping + with genomic features will be considered sense reads. + Useful for analysing ChIP or RIP data + + + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyCalculateChromosomeLengths.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,53 @@ +<tool id="pyCalculateChromosomeLengths" name="pyCalculateChromosomeLengths"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyCalculateChromosomeLengths.py + -f $ftype.input + --file_type $ftype.filetype + -o $output </command> + <version_command>/usr/local/bin/pyCalculateChromosomeLengths.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="filetype" type="select" label="File type"> + <option value="fasta" selected="true">Fasta</option> + <option value="tab">Tab</option> + </param> + <when value="fasta"> + <param name="input" type="data" format="fasta" label="Input file" help="Fasta or Tab file"/> + </when> + <when value="tab"> + <param name="input" type="data" format="tabular" label="Input file" help="Fasta or Tab file"/> + </when> + </conditional> + </inputs> + <param name="label" type="text" format="txt" size="30" value="pyCalculateChromosomeLengths" label="Enter output file label -o" /> + <outputs> + <data name="output" format="txt" label="${label.value}.len"/> + </outputs> + <help> + +.. class:: infomark + +**pyCalculateChromosomeLengths** + +pyCalculateChromosomeLengths is part of the pyCRAC_ package. Takes a genome sequence in fasta or tab format and generates a tab-delimited file showing chromosome name and chromosome length. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------- + +**Parameter list** + +Options:: + + -f chromosomes.fasta, --input_file=chromosomes.fasta + provide the name and path of your fasta or tab genomic + sequence file. Default is standard input. + --file_type=fasta + provide the file type (fasta or tab). Default is fasta + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyCalculateFDRs.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,247 @@ + <tool id ="pyCalculateFDRs" name="pyCalculateFDRs"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyCalculateFDRs.py + -f $ftype.input + --file_type $ftype.file_type + --gtf=$addGTF.gtf + + #if $addGTF.annotate.annotations != "all": + #if $addGTF.gtfFile == "default" and $addGTF.annotate.annotations == "auto": + --annotation $addGTF.annotate.scan.annotation + #else: + --annotation $addGTF.annotate.annotation + #end if# + #end if# + --chromfile=$addChr.chr + #if $addOpt.options == "edit" + -s $addOpt.sequence + --min $addOpt.min + --minfdr $addOpt.minfdr + --iterations=$addOpt.iterations + --range $addOpt.range + #end if# + -o $output + + </command> + <version_command>/usr/local/bin/pyCalculateFDRs.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="file_type" type="select" label="Input File Type --file_type" help="Use bed6, gff or gtf input files containing read/cDNA co-ordinates"> + <option value="gff" selected="true">GFF</option> + <option value="bed">Bed6</option> + <option value="gtf">GTF</option> + </param> + <when value="gff"> + <param format="gff" name="input" type="data" label="Input File --readdatafile" help="GFF format containing read/cDNA co-ordinates" /> + </when> + <when value="gtf"> + <param format="gtf" name="input" type="data" label="Input File --readdatafile" help="GTF format containing read/cDNA co-ordinates" /> + </when> + <when value="bed"> + <param format="bed6" name="input" type="data" label="Input File --readdatafile" help="Bed 6 column format containing read/cDNA co-ordinates" /> + </when> + </conditional> + + <conditional name="addChr"> + <param name="chrfile" type="select" label="Choose Chromosome length file from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="chr" type="select" label="Chromosome length file -c" help="This file should have two columns: first column is the names of the chromosomes, second column is length of the chromosomes"> + <options from_data_table="pycrac_chr"/> + </param> + </when> + <when value="other"> + <param format="tabular" name="chr" type="data" label="Chromosome length file -c" help="This file should have two columns: first column is the names of the chromosomes, second column is length of the chromosomes. Use pyCrac utility pyCalculateChromosomeLengths to create."/> + </when> + </conditional> + + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan pyGetGTFSources file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param format="tabular" name="gtf_annotation" type="data" label="GTF annotation File (pyGetGTFSources output)" help="Tabular file containing unique list of annotations/sources in selected GTF file. Refer to pyGetGTFSources"/> + <conditional name="scan"> + <param name="annotations" type="select" label="Scan this file for annotations" help="Choose the correct GTF file then choose GO"> + <option value="wait" selected="true">Waiting</option> + <option value="scanning">Go</option> + </param> + <when value="wait"> + </when> + <when value="scanning"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf_annotation"> + <column name="name" index="0"/> + <column name="value" index="0"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + </when> + <when value="other"> + <param format="gtf" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan selected file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf"> + <column name="name" index="1"/> + <column name="value" index="1"/> + <filter type="unique_value" name="unique" column="1"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + <conditional name="addOpt"> + <param name="options" type="select" label="Standard options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="sequence" type="select" label="Align reads to --sequence"> + <option value="genomic" selected="true">Genomic Sequence</option> + <option value="coding">Coding Sequence</option> + </param> + <param format="integer" name="min" type="integer" label="Minimum read coverage --min " value="1" size="10" help="Set the minimal read coverage for a region"> + <validator type="in_range" min="1" message="Please enter a value >= 1"/> + </param> + <param name="minfdr" type="float" label="Minimum FDR threshold --minfdr" value="0.05" size="6" help="Set a minimal FDR threshold for filtering interval data"> + <validator type="in_range" min="0" max="1" message="Please enter a value between 0 and 1"/> + </param> + <param format="integer" name="iterations" type="integer" label="Number of iterations --iterations" value="100" size="6" help="The number of iterations for randomization of read coordinates"> + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyCalculateFDRs" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="gtf" name="output" label="${label.value}.gtf"/> + </outputs> + <help> + +.. class:: infomark + +**pyCalculateFDRs** + +By default the FDR value is set to 0.05, meaning that there is a 5% chance that the interval is not significantly enriched. +The tool reports significant intervals in the GTF format and reports overlapping genomic features. +Mutation frequencies are not included but these can be added using the pyCalculateMutationFrequencies tool + +**NOTE!** By default it calls each significant interval an "exon" but this has no meaning! It may overlap with an intron. +Use bedtools to extract those intervals that overlap with introns or other features + +Example of an output file:: + + ##gff-version 2 + # generated by pyCalculateFDRs version 0.0.3, Sat Jun 1 21:16:23 2013 + # pyCalculateFDRs.py -f test_count_output_reads.gtf -r 200 -o test_count_output_FDRs_005.gtf -v -m 0.05 + # chromosome feature source start end minimal_coverage strand . attributes + chrI protein_coding exon 140846 140860 5 - . gene_id "YAL005C"; gene_name "SSA1"; + chrI intergenic_region exon 223118 223164 4 - . gene_id "INT_0_179"; gene_name "INT_0_179"; + chrI intergenic_region exon 71889 71922 3 + . gene_id "INT_0_94"; gene_name "INT_0_94"; + chrII intergenic_region exon 296127 296158 3 - . gene_id "INT_0_365"; gene_name "INT_0_365"; + chrII intergenic_region exon 680697 680722 4 - . gene_id "INT_0_626"; gene_name "INT_0_626"; + chrII intergenic_region exon 680827 680846 4 - . gene_id "INT_0_626"; gene_name "INT_0_626"; + chrII snRNA exon 680827 680838 5 - . gene_id "LSR1"; gene_name "LSR1"; + chrII snRNA exon 680951 681001 5 - . gene_id "LSR1"; gene_name "LSR1"; + chrII intergenic_region exon 577985 577996 3 - . gene_id "INT_0_556"; gene_name "INT_0_556"; + chrII protein_coding exon 203838 203887 3 + . gene_id "YBL011W"; gene_name "SCT1"; + chrII protein_coding exon 296127 296158 3 - . gene_id "YBR028C"; gene_name "YBR028C"; + + +pyCalculateFDRs is part of the pyCRAC_ package. Takes interval information in GTF or bed format and calculates False Discovery Rates (FDRs). + + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f read_file, --readdatafile=read_file + Name of the bed/gff/gtf file containing the read/cDNA + coordinates + --file_type=FILE_TYPE + this tool supports bed6, gtf and gff input files. + Please select from 'bed','gtf' or 'gff'. Default=gtf + -o outfile.gtf, --outfile=outfile.gtf + Optional. Provide the name of the output file. Default + is 'selected_intervals.gtf' + -r 100, --range=100 + allows you to set the length of the UTR regions. If + you set '-r 50' or '--range=50', then the program will + set a fixed length (50 bp) regardless of whether the + GTF file has genes with annotated UTRs. + -a protein_coding, --annotation=protein_coding + select which annotation (i.e. protein_coding, ncRNA, + sRNA, rRNA,snoRNA,snRNA, depending on the source of + your GTF file) you would like to focus your analysis + on. Default = all annotations + -c yeast.txt, --chromfile=yeast.txt + Location of the chromosome info file. This file should + have two columns: first column is the names of the + chromosomes, second column is length of the + chromosomes. Default is yeast + --gtf=yeast.gtf + Name of the annotation file. Default is /usr/local/pyC + RAC/db/Saccharomyces_cerevisiae.EF2.59.1.2.gtf + -m MINFDR, --minfdr=MINFDR + To set a minimal FDR threshold for filtering interval + data. Default is 0.05 + --min=MIN + to set a minimal read coverages for a region. Regions + with coverage less than minimum will be ignoredve an + FDR of zero + --iterations=ITERATIONS + to set the number of iterations for randomization of + read coordinates. Default=100 + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyCalculateMutationFrequencies.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,126 @@ +<tool id ="pyCalculateMutationFrequencies" name="pyCalculateMutationFrequencies"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyCalculateMutationFrequencies.py + -r $readdatafile + -i $intervaldatafile + -c $addChr.chr + -o $output + --mutsfreq $mutsfreq + </command> + <version_command>/usr/local/bin/pyCalculateMutationFrequencies.py --version</version_command> + <inputs> + <param format="gff" name="readdatafile" type="data" label="GFF Reads File --readdatafile" help="GFF file containing read data" /> + <param format="gtf" name="intervaldatafile" type="data" label="GFF Interval File --intervaldatafile" help="GFF file containing interval co-ordinates"/> + <conditional name="addChr"> + <param name="chrfile" type="select" label="Choose Chromosome length file from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="chr" type="select" label="Chromosome length file -c" help="This file should have two columns: first column is the names of the chromosomes, second column is length of the chromosomes.Use pyCrac utility pyCalculateChromosomeLengths to create."> + <options from_data_table="pycrac_chr"/> + </param> + </when> + <when value="other"> + <param format="tabular" name="chr" type="data" label="Chromosome length file -c" help="This file should have two columns: first column is the names of the chromosomes, second column is length of the chromosomes"/> + </when> + </conditional> + + <param format="integer" name="mutsfreq" type="integer" label="Minimum mutation frequency --mutsfreq " value="0" size="10" help="sets the minimal mutations frequency for an interval that you want to have written to our output file"> + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param name="label" type="text" format="txt" size="30" value="pyCalculateMutationFrequencies" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="gtf" name="output" label="${label.value}.gtf"/> + </outputs> + <help> + +.. class:: infomark + +**pyCalculateMutationFrequencies** + +pyCalculateMutationFrequencies is part of the pyCRAC_ package. Takes an interval file and a pyReadCounters GTF file and calculates (cross-linking induced) mutation frequencies fore each interval. +This tool can be used to calculate mutation frequencies for significant intervals (pyCalculateFDRs output file) or over-represented motifs (pyMotif GTF output file). +It expects a pyCRAC GTF count_output_reads.gtf file and a GTF file with the intervals. + +For example:: + + This pyCalculateFDRs GTF output file:: + + ##gff-version 2 + # generated by pyCalculateFDRs version 0.0.3, Sat Jun 1 21:16:23 2013 + # pyCalculateFDRs.py -f test_count_output_reads.gtf -r 200 -o test_count_output_FDRs_005.gtf -v -m 0.05 + # chromosome feature source start end minimal_coverage strand . attributes + chrII protein_coding exon 203838 203887 3 + . gene_id "YBL011W"; gene_name "SCT1"; + chrII intergenic_region exon 407669 407708 3 + . gene_id "INT_0_445"; gene_name "INT_0_445"; + chrII intergenic_region exon 585158 585195 2 + . gene_id "INT_0_562"; gene_name "INT_0_562"; + chrII protein_coding exon 372390 372433 4 - . gene_id "YBR067C"; gene_name "TIP1"; + chrII intergenic_region exon 380754 380815 6 - . gene_id "INT_0_431"; gene_name "INT_0_431"; + chrIII protein_coding exon 138001 138044 5 + . gene_id "YCR012W"; gene_name "PGK1"; + chrIII intergenic_region exon 227997 228036 5 + . gene_id "INT_0_885"; gene_name "INT_0_885"; + chrIII intergenic_region exon 227997 228037 4 + . gene_id "INT_0_887"; gene_name "INT_0_887"; + chrIII tRNA exon 227997 228037 4 + . gene_id "tS(CGA)C"; gene_name "SUP61"; + + Will be converted into:: + + ##gff-version 2 + # generated by pyCalculateFDRs version 0.0.3, Sat Jun 1 21:16:23 2013 + # /Library/Frameworks/EPD64.framework/Versions/Current/bin/pyCalculateFDRs.py -f test_count_output_reads.gtf -r 200 -o test_count_output_FDRs_005.gtf -v -m 0.05 + # chromosome feature source start end minimal_coverage strand . attributes + chrII protein_coding exon 203838 203887 3 + . gene_id "YBL011W"; gene_name "SCT1"; # 203882D33.3,203883D33.3,203884D33.3; + chrII intergenic_region exon 407669 407708 3 + . gene_id "INT_0_445"; gene_name "INT_0_445"; # 407680D33.3,407681D33.3; + chrII intergenic_region exon 585158 585195 2 + . gene_id "INT_0_562"; gene_name "INT_0_562"; # 585171D100.0,585172D100.0,585173D100.0; + chrII protein_coding exon 372390 372433 4 - . gene_id "YBR067C"; gene_name "TIP1"; # 372412D50.0,372413D50.0; + chrII intergenic_region exon 380754 380815 6 - . gene_id "INT_0_431"; gene_name "INT_0_431"; # 380786D90.2,380787D90.2; + chrIII protein_coding exon 138001 138044 5 + . gene_id "YCR012W"; gene_name "PGK1"; # 138025D40.0,138026D30.0,138027D40.0; + chrIII intergenic_region exon 227997 228036 5 + . gene_id "INT_0_885"; gene_name "INT_0_885"; # 228006D85.7,228007D100.0; + chrIII intergenic_region exon 227997 228037 4 + . gene_id "INT_0_887"; gene_name "INT_0_887"; # 228006D85.7,228007D100.0; + chrIII tRNA exon 227997 228037 4 + . gene_id "tS(CGA)C"; gene_name "SUP61"; # 228006D85.7,228007D100.0; + + +The hash character at the end of each line (#) shows chromosomal coordinates of mutated nucleotides within the cluster interval and their mutation frequencies. + +For example:: + + # 228007D100.0 + +indicates that 100% of the nucleotides in position 228007 were deleted in the interval. + +By setting the --mutsfreq flag you can set a limit for the lowest mutation frequency that you want to have reported. +This makes it relatively easy to select those significant regions that have nucleotides with high mutation frequencies. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -i intervals.gtf, --intervaldatafile=intervals.gtf + provide the path to your GTF interval data file. + -r reads.gtf, --readdatafile=reads.gtf + provide the path to your GTF read data file. + -c yeast.txt, --chromfile=yeast.txt + Location of the chromosome info file. This file should + have two columns: first column is the names of the + chromosomes, second column is length of the + chromosomes. Default is yeast + -o intervals_with_muts.gtf, --output_file=intervals_with_muts.gtf + provide a name for an output file. By default it + writes to the standard output + --mutsfreq=10, --mutationfrequency=10 + sets the minimal mutations frequency for an interval + that you want to have written to our output file. + Default = 0%. Example: if the mutsfrequency is set at + 10 and an interval position has a mutated in less than + 10% of the reads,then the mutation will not be + reported. + + + </help> + </tool> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyCheckGTFfile.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,53 @@ + <tool id ="pyCheckGTFfile" name="pyCheckGTFfile"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyCheckGTFfile.py --gtf $addGTF.gtf -o $out + </command> + <version_command>/usr/local/bin/pyCheckGTFfile.py --version</version_command> + <inputs> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyCheckGTFfile" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="gtf" name="out" label="${label.value}.gtf"/> + </outputs> + <help> +.. class:: infomark + +**pyCheckGTFfile** + +pyCheckGTFfile is part of the pyCRAC_ package. Renames duplicated gene names in your GTF annotation file. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + --gtf=gtf input file + type the path to the gtf file that you want to use. + -o FILE, --output=FILE + Optional. Specify the name of the output file. Default + is standard output. Make sure it has the .gtf + extension! + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyClusterReads.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,230 @@ +<tool id="pyClusterReads" name="pyClusterReads" force_history_refresh="True"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyClusterReads.py + -f $input + --gtf=$addGTF.gtf + #if $addGTF.annotate.annotations != "all": + #if $addGTF.gtfFile == "default" and $addGTF.annotate.annotations == "auto": + --annotation=$addGTF.annotate.scan.annotation + #else: + --annotation=$addGTF.annotate.annotation + #end if# + #end if# + -o $output + #if $addOpt.options == "edit": + --range=$addOpt.range + --cic=$addOpt.cic + --co=$addOpt.co + --ch=$addOpt.ch + --cl=$addOpt.cl + --mutsfreq=$addOpt.mutsfreq + #end if# + </command> + <version_command>/usr/local/bin/pyClusterReads.py --version</version_command> + <inputs> + <param format="gtf" name="input" type="data" label="Input Read Data File -f" help="GTF format sorted by position i.e. pyReadCounters output file."/> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan pyGetGTFSources file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param format="tabular" name="gtf_annotation" type="data" label="GTF annotation File (pyGetGTFSources output)" help="Tabular file containing unique list of annotations/sources in selected GTF file. Refer to pyGetGTFSources"/> + <conditional name="scan"> + <param name="annotations" type="select" label="Scan this file for annotations" help="Choose the correct GTF file then choose GO"> + <option value="wait" selected="true">Waiting</option> + <option value="scanning">Go</option> + </param> + <when value="wait"> + </when> + <when value="scanning"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf_annotation"> + <column name="name" index="0"/> + <column name="value" index="0"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan selected file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf"> + <column name="name" index="1"/> + <column name="value" index="1"/> + <filter type="unique_value" name="unique" column="1"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + + <conditional name="addOpt"> + <param name="options" type="select" label="Standard Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + <param format="integer" name="ch" type="integer" label="Cluster height --ch" value="2" size="10" help="Minimal height of a cluster"> + <validator type="in_range" min="1" message="Please enter a value >= 1"/> + </param> + <param format="integer" name="cl" type="integer" label="Cluster length --cl" value="1" size="10" help="Maximum length of a cluster"> + <validator type="in_range" min="1" message="Please enter a value >= 1"/> + </param> + <param format="integer" name="cic" type="integer" label="cDNAs in clusters --cic" value="2" size="10" > + <validator type="in_range" min="2" message="Please enter a value >= 1"/> + </param> + <param format="integer" name="co" type="integer" label="cDNA-cluster nucleotide overlap --co" value="1" size="10" > + <validator type="in_range" min="1" message="Please enter a value >= 1"/> + </param> + <param format="integer" name="mutsfreq" type="integer" label="Minimum mutation frequency for a cluster position --mutsfreq" value="0" size="3" > + <validator type="in_range" min="0" max="100" message="Please enter a value between 0 and 100"/> + </param> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyClusterReads" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="gtf" name="output" label="${label.value}_clusters.gtf"/> + </outputs> + <help> + +.. class:: infomark + +**pyClusterReads** + +pyClusterReads is part of the pyCRAC_ package. Takes a reads_count_output GTF file from pyReadCounters generates clusters from the interval coordinates. +Produces a GTF output file with cluster intervals and overlapping genomic features. +It also includes mutation frequencies (after the # character) for nucleotides in intervals using chromosomal coordinates +The pyClusterReads GTF output file essentially has the same layout as other pyCRAC GTF output files. + +**NOTE!** By default it calls each cluster an "exon" but this has no meaning. It may overlap with an intron. +Use bedtools to extract those intervals that overlap with introns or other features + +The maximum height of the cluster is indicated in column 8. +The hash character at the end of each line (#) shows chromosomal coordinates of mutated nucleotides within the cluster interval and their mutation frequencies. + +For example:: + + # 114099S100.0 + +indicates that 100% of the nucleotides in position 114099 were substituted in the cluster. + +An example of a pyClusterReads output file:: + + ##gff-version 2 + # generated by pyClusterReads.py version 0.0.1, Fri Jan 18 11:59:42 2013 + # pyClusterReads.py -f count_output_reads.gtf -o count_output_clusters.gtf -v + # chromosome feature source start end cDNAs strand height attributes + chrI cluster exon 112583 112643 6 - 5 gene_id "INT_0_114,YAL021C"; gene_name "INT_0_114,CCR4"; # 112612S75.0; + chrI cluster exon 113176 113232 3 - 3 gene_id "INT_0_114,YAL021C"; gene_name "INT_0_114,CCR4"; # 113184S100.0; + chrI cluster exon 113334 113386 2 - 2 gene_id "INT_0_114,YAL021C"; gene_name "INT_0_114,CCR4"; # 113349S50.0,113379S100.0; + chrI cluster exon 113534 113564 3 - 3 gene_id "INT_0_119,INT_0_114"; gene_name "INT_0_119,INT_0_114"; # 113554S33.3,113556S33.3,113557S33.3; + chrI cluster exon 113644 113691 5 - 4 gene_id "YAL020C,INT_0_114"; gene_name "ATS1,INT_0_114"; # 113649S50.0,113657S33.3,113679S25.0 + chrI cluster exon 113912 113958 2 - 2 gene_id "YAL020C,INT_0_114"; gene_name "ATS1,INT_0_114"; # 113932S50.0,113946S50.0; + chrI cluster exon 113966 114066 5 - 3 gene_id "YAL020C,INT_0_114"; gene_name "ATS1,INT_0_114"; # 113987S50.0,114033S33.3,114039S33.3; + chrI cluster exon 114067 114130 3 - 3 gene_id "YAL020C,INT_0_114"; gene_name "ATS1,INT_0_114"; # 114099S100.0; + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + + +File input options:: + + -f reads.gtf, --input_file=reads.gtf + provide the path to your GTF read data file. NOTE the + file has to be correctly sorted! If you used + pyReadCounters to generate the file you should be + fine. If you modified it, use the sort command + described in the manual to sort your file first by + chromosome, then by strand and then by start position. + -o clusters.gtf, --output_file=clusters.gtf + provide a name for an output file. By default it + writes to the standard output + --gtf=Yourfavoritegtf.gtf + type the path to the gtf annotation file that you want + to use + +Common pyCRAC options:: + + -r 100, --range=100 + allows you to set the length of the UTR regions. If + you set '-r 50' or '--range=50', then the program will + set a fixed length (50 bp) regardless of whether the + GTF annotation file has genes with annotated UTRs. + -a protein_coding, --annotation=protein_coding + select which annotation (i.e. protein_coding, ncRNA, + sRNA, rRNA,snoRNA,snRNA, depending on the source of + your GTF file) you would like to focus your analysis + on. Default = all annotations + +Options for cluster analysis:: + + --cic=2, --cdnasinclusters=2 + sets the minimal number of overlapping cDNAs in each + cluster. Default = 2 + --co=5, --clusteroverlap=5 + sets the number of nucleotides cDNA sequences have to + overlap to form a cluster. Default = 1 nucleotide + --ch=5, --clusterheight=5 + sets the minimal height of the cluster. Default = 2 + nucleotides + --cl=100, --clusterlength=100 + to set the maximum cluster sequence length + --mutsfreq=10, --mutationfrequency=10 + sets the minimal mutations frequency for a cluster + position in the GTF output file. Default = 0%. + Example: if the mutsfrequency is set at 10 and a + cluster position has a mutated in less than 10% of the + reads, then the mutation will not be reported. + </help> +</tool> \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyExtractLinesFromGTF.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,77 @@ + <tool id ="pyExtractLinesFromGTF" name="pyExtractLinesFromGTF"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyExtractLinesFromGTF.py --gtf $addGTF.gtf --genes_file $g --attribute $attribute $v -o $out + </command> + <version_command>/usr/local/bin/pyExtractLinesFromGTF.py --version</version_command> + <inputs> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <param format="txt" name="g" type="data" label="File containing gene list --genes_file" help="Tabular file with 1 column of gene or annotation names"/> + <param name="attribute" type="select" label="Select the attribute to extract names from --attribute"> + <option value="gene_name" selected="true">gene_name</option> + <option value="gene_id">gene_id</option> + <option value="transcript_name">transcript_name</option> + <option value="transcript_id">transcript_id</option> + </param> + <param name="v" type="select" label="Extract lines from GTF that -v"> + <option value="" selected="true">Match the gene file</option> + <option value="-v">Do not match in gene fil</option> + </param> + <param name="label" type="text" format="txt" size="30" value="pyExtractLinesFromGTF" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="gtf" name="out" label="${label.value}.gtf"/> + </outputs> + <help> +.. class:: infomark + +**pyExtractLinesFromGTF** + +pyExtractLinesFromGTF is part of the pyCRAC_ package. Extracts lines from a GTF file that contain gene names of interest. + + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + --gtf=Yourfavoritegtf.gtf + type the path to the gtf file that you want to use. By + default it expects data from the standard input. + -g FILE, --genes_file=FILE + name of your gene list or annotations list file (1 + column) + -o OUTFILE, --outfile=OUTFILE + type the name and path of the file you want to write + the output to. Default is standard output + -a ATTRIBUTE, --attribute=ATTRIBUTE + from which attribute do you want to extract names? + Choices: gene_name, gene_id, transcript_name, + transcript_id + -v + similar to grep -v option. Remove the genes from the + GTF that are in the gene list + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyFasta2tab.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,51 @@ +<tool id="pyFasta2Tab" name="pyFasta2Tab"> + <description>converter</description> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python">/usr/local/bin/pyFasta2tab.py -f $input -o $output + </command> + <version_command>/usr/local/bin/pyFasta2tab.py --version</version_command> + <inputs> + <param name="input" type="data" format="fasta" label="Fasta file -f"/> + </inputs> + <param name="label" type="text" format="txt" size="30" value="pyFasta2Tab" label="Enter output file label -o" /> + <outputs> + <data name="output" format="tabular" label="${label.value}.tab"/> + </outputs> + <help> + +.. class:: infomark + +**pyFasta2Tab** + +pyFasta2Tab is part of the pyCRAC_ package. Converts fasta to tabular format. Is used to convert your reference sequences in fasta format to the tabular format that pyCRAC uses for almost all tools. + +Example:: + + >sequence1 + ATAGGATACATAACCATATTATGAGACC + +Is converted into:: + + sequence1 ATAGGATACATAACCATATTATGAGACC + +The pyCRAC package lo + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------- + +**Parameter list** + +Options:: + + -f fasta_file, --input_file=fasta_file + provide the name and path of your fasta input file. + Default is standard input. + + + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyFastqDuplicateRemover.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,34 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "f=s", "r=s", "o=s", "out2=s", "version","id=s"); + +my $cmnd; + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyFastqDuplicateRemover.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyFastqDuplicateRemover.py -f $opt{f} -o $opt{id}"; + + if(defined $opt{r}){ + $cmnd.= " -r $opt{r}"; + } +} + +system $cmnd; + + + +if(defined $opt{r}){ + system "mv $opt{id}"."_1.fasta $opt{o}"; + system "mv $opt{id}"."_2.fasta $opt{out2}"; +} +else{ + system "mv $opt{id} $opt{o}"; +} +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyFastqDuplicateRemover.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,117 @@ + <tool id ="pyFastqDuplicateRemover" name="pyFastqDuplicateRemover"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + pyFastqDuplicateRemover.pl + -f $ftype.f + #if $ftype.reverse.rev == "yes": + -r=$ftype.reverse.r + --out2 $out2 + #end if# + -o $out + --id $out.id + </command> + <version_command>pyFastqDuplicateRemover.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="type" type="select" label="File type"> + <option value="fastq" selected="true">FASTQ</option> + <option value="fasta">FASTA</option> + </param> + <when value="fastq"> + <param format="fastq" name="f" type="data" label="FastQ File -f" help="FastQ format" /> + <conditional name="reverse"> + <param name="rev" type="select" label="Add a reverse or paired FastQ file"> + <option value="no" selected="true">NO</option> + <option value="yes">YES</option> + </param> + <when value="yes"> + <param format="fastq" name="r" type="data" label="Reverse FastQ File -f" help="FastQ format" /> + </when> + <when value="no"> + </when> + </conditional> + </when> + <when value="fasta"> + <param format="fasta" name="f" type="data" label="FastA File -f" help="FastA format" /> + <conditional name="reverse"> + <param name="rev" type="select" label="Add a reverse or paired FastA file"> + <option value="no" selected="true">NO</option> + <option value="yes">YES</option> + </param> + <when value="yes"> + <param format="fasta" name="r" type="data" label="Reverse FastA File -f" help="FastA format" /> + </when> + <when value="no"> + </when> + </conditional> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyFastqDuplicateRemover" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="fasta" name="out" label="${label.value}.fasta"/> + <data format="fasta" name="out2" label="${label.value}_reverse.fasta"> + <filter>ftype['reverse']['rev'] == "yes"</filter> + </data> + </outputs> + <help> + +.. class:: infomark + +**pyFastqDuplicateRemover** + +pyFastqDuplicateRemover is part of the pyCRAC_ package. Removes identical sequences from fastq and fasta files and returns a fasta file with collapsed data. + +Can also process paired-end data. + +**Examples** + +Unprocessed fastq data with six random nucleotides at 5' end of the read:: + + @FCC102EACXX:3:1101:3231:2110#TGACCAAT/1 + GCGCCTGCCAATTCCATCGTAATGATTAATAGGGACGGTCGGGGGCATC + + + bb_ceeeegggggiiiiiifghiihiihiiiiiiiiiifggfhiecccc + +After pyBarcodeFilter:: + + @FCC102EACXX:3:1101:3231:2110#TGACCAAT/1##GCGCCT + TCCATCGTAATGATTAATAGGGACGGTCGGGGGCATC + + + giiiiiifghiihiihiiiiiiiiiifggfhiecccc + + This entry is printed to the NNNNNNGCCAAT barcode file. + +After pyFastqDuplicateRemover:: + + >1_GCGCCT_5/1 + TCCATCGTAATGATTAATAGGGACGGTCGGGGGCATC + + The '1' indicates that this is the first unique cDNA in the data + GCGCCT is the random barcode sequence + the '5' indicates that 5 reads were found with identical read and random barcode sequences + the '/1' indicates that the seqeuence originates from the forward sequencing reaction + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f FILE, --input_file=FILE + name of the FASTQ or FASTA input file + + -r FILE, --reverse_input_file=FILE + name of the paired (or reverse) FASTQ or FASTA input file + + -o FILE, --output_file=FILE + Provide the path and name of the fastq or fasta output file. Default is standard output. + For paired-end data just provide a file name without file extension (!) + </help> +</tool> + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyFastqJoiner.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,139 @@ + <tool id ="pyFastqJoiner" name="pyFastqJoiner"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyFastqJoiner.py + -f $ftype.f1 $ftype.f2 + -o $out + --file_type=$ftype.type + #if $joinc.ch == "-c": + -c $joinc.c + #end if# + </command> + <version_command>/usr/local/bin/pyFastqJoiner.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="type" type="select" label="File type"> + <option value="fastq" selected="true">FASTQ</option> + <option value="fasta">FASTA</option> + </param> + <when value="fastq"> + <param format="fastq" name="f1" type="data" label="First FastQ File -f" help="FastQ format" /> + <param format="fastq" name="f2" type="data" label="Second FastQ File -f" help="FastQ format" /> + </when> + <when value="fasta"> + <param format="fasta" name="f1" type="data" label="First FastA File -f" help="FastA format" /> + <param format="fasta" name="f2" type="data" label="Second FastA File -f" help="FastA format" /> + </when> + </conditional> + <conditional name="joinc"> + <param name="ch" type="select" label="Insert a character at join"> + <option value="" selected="true">NO</option> + <option value="-c">YES</option> + </param> + <when value="-c"> + <param type="text" name="c" label="Add this character -c" value=":" > + <validator type="empty_field" message="enter a character or turn this option off" /> + </param> + </when> + <when value=""> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyFastqJoiner" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="input" name="out" label="${label.value}.${ftype.type}"/> + <change_format> + <when input="ftype.type" value="fasta" format="fasta" /> + </change_format> + </outputs> + <help> + +.. class:: infomark + +**pyFastqJoiner** + +pyFastqJoiner is part of the pyCRAC_ package. Merges paired sequences from two fastq or fasta formatted files. + +Example:: + + Forward reaction: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG + CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT + + + `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYae + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA + CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG + + + ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBB + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC + CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT + + + bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_ef + @FCC102EACXX:3:1101:1574:2214#ATCACGAT/1##CGTTTT + CTAATGACCCACTCGGCACCTTACGAAATCAAAGTCT + + + cdfgYY`cefhhZef\eaggXaceeghfQaeghWNW\ + + Reverse reaction: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/2 + AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA + + + YJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/2 + AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA + + + YJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/2 + GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC + + + PP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg + + Here the ":" character is used to split the two sequences. This character tells pyFastqSplitter where to split the sequences. + This character is ignored by pyFastqDuplicateRemover + + Result: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG@FCC102EACXX:3:1101:1343:2181#ATCACGAT/2 + CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT:AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA + + + `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYaeYJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA@FCC102EACXX:3:1101:1424:2248#ATCACGAT/2 + CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG:AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA + + + ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBBYJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC@FCC102EACXX:3:1101:1623:2036#ATCACGAN/2 + CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT:GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC + + + bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_efPP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f fastq_file1 fastq_file2 + Provide the names of two raw data files separated by a single space. + Make sure the first file is the data file of the forward (/1) sequencing reaction. + + --file_type=FASTQ + Can join fasta and fastq files. Fastq is default + + -o mergedfastq.fastq, --outfile=mergedfastq.fastq + provide the name of the output file. By default it + will be printed to the standard output + + -c : + This option adds the '|' character between the DNA + sequences so that it is much easier to split the data + again later on + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyFastqSplitter.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,27 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "f=s", "c=s", "o1=s", "o2=s","file_type=s", "version","id=s"); + +my $cmnd; + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyFastqSplitter.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyFastqSplitter.py -f $opt{f} -o $opt{id} --file_type=$opt{file_type}"; + + if(defined $opt{c}){ + $cmnd.= " -c $opt{c}"; + } + +} + +system $cmnd; +system "mv $opt{id}_1.$opt{file_type} $opt{o1}"; +system "mv $opt{id}_2.$opt{file_type} $opt{o2}"; +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyFastqSplitter.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,140 @@ + <tool id ="pyFastqSplitter" name="pyFastqSplitter" force_history_refresh="True"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + pyFastqSplitter.pl + -f $f + --o1 $out1 + --id $label.value + --o2 $out2 + --file_type $ftype.type + #if $joinc.ch == "-c": + -c $joinc.c + #end if# + </command> + <version_command>/usr/local/bin/pyFastqSplitter.py --version</version_command> + <inputs> + <conditional name="ftype"> + <param name="type" type="select" label="File type"> + <option value="fastq" selected="true">FASTQ</option> + <option value="fasta">FASTA</option> + </param> + <when value="fastq"> + <param format="fastq" name="f" type="data" label="FastQ File -f" help="FastQ format" /> + </when> + <when value="fasta"> + <param format="fasta" name="f" type="data" label="FastA File -f" help="FastA format" /> + </when> + </conditional> + <conditional name="joinc"> + <param name="ch" type="select" label="Insert a character at join"> + <option value="" selected="true">NO</option> + <option value="-c">YES</option> + </param> + <when value="-c"> + <param type="text" name="c" label="Split the reads on the -c character" value=":" > + <validator type="empty_field" message="enter a character or turn this option off" /> + </param> + </when> + <when value=""> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyFastqSplitter" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="input" name="out1" label="${label.value}_1.${ftype.type}"/> + <data format="input" name="out2" label="${label.value}_2.${ftype.type}"/> + <change_format> + <when input="ftype.type" value="fasta" format="fasta" /> + </change_format> + </outputs> + <help> + +.. class:: infomark + +**pyFastqSplitter** + +pyFastqSplitter is part of the pyCRAC_ package. Splits a merged fastq file (pyFastqJoiner output) in to two files. + +Example:: + + Here the ":" character was used to separate the two sequences. By using the -c flag you can tell pyFastqSplitter where to split the sequences. + This character is ignored by pyFastqDuplicateRemover + + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG@FCC102EACXX:3:1101:1343:2181#ATCACGAT/2 + CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT:AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA + + + `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYaeYJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA@FCC102EACXX:3:1101:1424:2248#ATCACGAT/2 + CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG:AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA + + + ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBBYJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC@FCC102EACXX:3:1101:1623:2036#ATCACGAN/2 + CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT:GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC + + + bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_efPP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg + + Result: + + Forward reaction: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/1##CAATAG + CAAATTAGAGTGTTCAAAGCAGGCGTATTGCTCGAAT + + + `efhYb][bdQQ`eeaeaYbeY^ceU__IXa[^ZYae + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/1##CCAGGA + CTAACCATAAACTATGCCTACTAGGGATCCAGAGGTG + + + ^_adddhJbaehbedd`dIb_^cXaRI^BBBBBBBBB + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/1##CTCAGC + CAAAGTTAGGGGATCGAAGATGATCAGATACCGTCGT + + + bghfc^YbgbeadggfdffeaS^ac_X^cegaGZ_ef + @FCC102EACXX:3:1101:1574:2214#ATCACGAT/1##CGTTTT + CTAATGACCCACTCGGCACCTTACGAAATCAAAGTCT + + + cdfgYY`cefhhZef\eaggXaceeghfQaeghWNW\ + + Reverse reaction: + + @FCC102EACXX:3:1101:1343:2181#ATCACGAT/2 + AGCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAAGA + + + YJaSJ`Z`K`YbSb[[daeJRR[YeWd_I^I^ecgc]OV\bdeaegbXb + @FCC102EACXX:3:1101:1424:2248#ATCACGAT/2 + AAGTCCTTTAAGTTACAGCCTTGCGACCATACTACACCCAGAACCCAAA + + + YJJ\`JQY\`KJ`gY[[QRYY[[`H[_ceI^e[PYO^IWOHW^eaefhh + @FCC102EACXX:3:1101:1623:2036#ATCACGAN/2 + GGCCAATCCTTATTGTGTCTGGACCTGGTGAGTTTCCCCGTGTTGAGTC + + + PP\`ccQ`eY[bQQ[d`ghehaghfgdg[`gb^bd[ePbH^c_c\a_eg + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + -f fastq_file, --filename=fastq_file + To provide the names of two raw data files separated + by a single space. Default = standard input + --file_type=FASTQ + Can split joined fasta and fastq files. Fastq is default + If there isn't a specific character splitting the two reads + the tool assumes that the two reads were of equal length + -o splitfastq, --outfile=splitfastq + Provide the name of the output files (WITHOUT file + extension). By default the data will be printed to the + standard output + -c :, --character=: + If the joined sequences were separated by a specific + character then the program can divide the sequences by + looking for that character + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyGTF2bed.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,107 @@ +<tool id="pyGTF2bed" name="pyGTF2bed"> + <description>converter</description> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python">/usr/local/bin/pyGTF2bed.py --gtf $input -o $output + #if $addtrack.track == "--track": + --track + --name $addtrack.name + --description $addtrack.description + #if $addtrack.colorscheme.colorsel == "default": + -c $addtrack.colorscheme.color + #else: + -s '$addtrack.colorscheme.plus,$addtrack.colorscheme.minus' + #end if# + #end if# + </command> + <version_command>/usr/local/bin/pyGTF2bed.py --version</version_command> + <inputs> + <param name="input" type="data" format="gtf" label="GTF file --gtf"/> + <conditional name="addtrack"> + <param name="track" type="select" label="Add UCSC track line to output --track"> + <option value="" selected="true">NO</option> + <option value="--track">YES</option> + </param> + <when value=""/> + <when value="--track"> + <param name="name" format="txt" type="text" value="User_supplied_track" size="80" label="Track name -n"/> + <param name="description" format="txt" type="text" value="User_supplied_track" size="80" label="Track description -d"/> + <conditional name="colorscheme"> + <param name="colorsel" type="select" label="Colouring scheme"> + <option value="default" selected="true">One Colour</option> + <option value="strand">By Strand</option> + </param> + <when value="default"> + <param name="color" type="select" label="Choose track colour -c"> + <option value="black" selected="true">Black</option> + <option value="red">Red</option> + <option value="blue">Blue</option> + <option value="green">Green</option> + <option value="purple">Purple</option> + </param> + </when> + <when value="strand"> + <param name="plus" type="select" label="Choose forward strand track colour -s"> + <option value="black" selected="true">Black</option> + <option value="red">Red</option> + <option value="blue">Blue</option> + <option value="green">Green</option> + <option value="purple">Purple</option> + </param> + <param name="minus" type="select" label="Choose minus strand track colour -s"> + <option value="black" selected="true">Black</option> + <option value="red">Red</option> + <option value="blue">Blue</option> + <option value="green">Green</option> + <option value="purple">Purple</option> + </param> + </when> + </conditional> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyGTF2bed" label="Enter output file label -o" /> + </inputs> + <outputs> + <data name="output" format="bed6" label="${label.value}.bed"/> + </outputs> + <help> + +.. class:: infomark + +**pyGTF2bed** + +pyGTF2bed is part of the pyCRAC_ package. Converts GTF files to the bed 6 format. Gene names present in the GTF file will be included in the bed file. + + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +These options can be used to add and modify a track line for the UCSC genome browser:: + + --track + Use this flag to add a UCSC genome browser track line + to the beginning of your file + -n NAME, --name=NAME + For the USCS track line: provide a track name. Default + = 'User_supplied_track' + -d DESCRIPTION, --description=DESCRIPTION + For the USCS track line: provide a track description. + Default = 'User_supplied_track' + -c COLOR, --color=COLOR + select the track color. Default = black + -s STRANDS, --colorstrands=STRANDS + select the colors for each strand. Default = + 'red,blue' + +File input options:: + + --gtf=Yourfavoritegtf.gtf + type the path to the gtf file that you want to + convert. Default is standard input + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyGTF2bedGraph.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,38 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "gtf=s","po=s","version","mo=s","count=i","chromfile=s","t=s","iCLIP","track","name=s","description=s","color=s","s=s","id=s"); + +my $cmnd; +my $prefix = "gb_$opt{id}"; +$prefix =~ s/\s/_/g; + + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyGTF2bedGraph.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyGTF2bedGraph.py --gtf $opt{gtf} --chromfile $opt{chromfile} -t $opt{t} --count $opt{count} -o $prefix"; + + if(exists $opt{iCLIP}){ + + $cmnd .= " --iCLIP"; + } + + if(exists $opt{track}){ + $cmnd .= " --track --name \"$opt{name}\" --description \"$opt{description}\""; + + if(exists $opt{color}){$cmnd .= " --color $opt{color}";} + if(exists $opt{s}){$cmnd .= " -s \"$opt{s}\"";} + } +} + +system $cmnd; + +system "mv $prefix"."_plus_strand.bedgraph $opt{po}"; +system "mv $prefix"."_minus_strand.bedgraph $opt{mo}"; +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyGTF2bedGraph.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,162 @@ +<tool id="pyGTF2bedGraph" name="pyGTF2bedGraph"> + <description>converter</description> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl">pyGTF2bedGraph.pl --gtf $input --po $po --mo $mo + --chromfile $addchr.chr + -t $type + --count $count + $iclip + #if $addtrack.track == "--track": + --track + --name $addtrack.name + --description $addtrack.description + #if $addtrack.colorscheme.colorsel == "default": + --color $addtrack.colorscheme.color + #else: + -s '$addtrack.colorscheme.plus,$addtrack.colorscheme.minus' + #end if# + #end if# + --id $po.id + </command> + <version_command>/usr/local/bin/pyGTF2bedGraph.py --version</version_command> + <inputs> + <param name="input" type="data" format="gtf" label="GTF file --gtf"/> + <conditional name="addchr"> + <param name="chrfile" type="select" label="Choose Chromosome length file from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="chr" type="select" label="Chromosome length file -c" help="This file should have two columns: first column is the names of the chromosomes, second column is length of the chromosomes. Use pyCrac utility pyCalculateChromosomeLengths to create."> + <options from_data_table="pycrac_chr"/> + </param> + </when> + <when value="other"> + <param format="tabular" name="chr" type="data" label="Chromosome length file -c" help="This file should have two columns: first column is the names of the chromosomes, second column is length of the chromosomes"/> + </when> + </conditional> + <param name="type" type="select" label="Choose type of data -t"> + <option value="reads" selected="true">Reads</option> + <option value="substitutions">Substitutions</option> + <option value="deletions">Deletions</option> + </param> + <param format="integer" name="count" type="integer" label="Count per feature --count " value="1" size="5" help="Takes the numbers in the 'score' column of the GTF file as the total number of reads for each position" > + <validator type="in_range" min="1" message="Please enter a value >= 1"/> + </param> + <param name="iclip" type="select" label="iCLIP mode --iCLIP"> + <option value="" selected="true">OFF</option> + <option value="--iCLIP">ON</option> + </param> + <conditional name="addtrack"> + <param name="track" type="select" label="Add UCSC track line to output"> + <option value="" selected="true">NO</option> + <option value="--track">YES</option> + </param> + <when value=""/> + <when value="--track"> + <param name="name" format="txt" type="text" value="User_supplied_track" size="80" label="Track name"/> + <param name="description" format="txt" type="text" value="User_supplied_track" size="80" label="Track description"/> + <conditional name="colorscheme"> + <param name="colorsel" type="select" label="Colouring scheme"> + <option value="default" selected="true">One Colour</option> + <option value="strand">By Strand</option> + </param> + <when value="default"> + <param name="color" type="select" label="Choose track colour"> + <option value="black" selected="true">Black</option> + <option value="red">Red</option> + <option value="blue">Blue</option> + <option value="green">Green</option> + <option value="purple">Purple</option> + </param> + </when> + <when value="strand"> + <param name="plus" type="select" label="Choose forward strand track colour"> + <option value="black" selected="true">Black</option> + <option value="red">Red</option> + <option value="blue">Blue</option> + <option value="green">Green</option> + <option value="purple">Purple</option> + </param> + <param name="minus" type="select" label="Choose minus strand track colour"> + <option value="black" selected="true">Black</option> + <option value="red">Red</option> + <option value="blue">Blue</option> + <option value="green">Green</option> + <option value="purple">Purple</option> + </param> + </when> + </conditional> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyGTF2bedGraph" label="Enter output file label -o" /> + </inputs> + <outputs> + <data name="po" format="bedgraph" label="${label.value}_plus_strand.bg"/> + <data name="mo" format="bedgraph" label="${label.value}_minus_strand.bg"/> + </outputs> + <help> + +.. class:: infomark + +**pyGTF2bedGraph** + +pyGTF2bedGraph is part of the pyCRAC_ package. Generates bedgraph files for each chromosome. An homage to bedtools genomecoverage. Takes a pyReadCounters GTF file as input file. Can also output bedGraph files for substitutions and deletions. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +File input options:: + + --gtf=readdata.gtf + type the path to the gtf file data file. Be default it + expects data from the standard input + -o converted + provide a name for an output file. A file extension or + strand information is not necessary. + -c yeast.txt, --chromfile=yeast.txt + Location of the chromosome info file. This file should + have two columns: first column is the names of the + chromosomes, second column is length of the + chromosomes. Default is yeast + -t TYPE, --type=TYPE + this tool can generate bedGraph files for reads, + substitutions or deletions. Please use + 'reads','substitutions' or 'deletions' to indicate the + type of data. Default='reads' + --count + Takes the numbers in the 'score' column of the GTF + file as the total number of reads for each position. + Default is 1 for each interval. + --iCLIP + This turns on the iCLIP mode and the sgr reads or cDNA + files will report cross-linking site frequencies in + iCLIP data + -v, --verbose + to print status messages to a log file + +These options can be used to add a track line for the UCSC genome browser:: + + --track + Use this flag to add a UCSC genome browser track line + to the beginning of your file + -n NAME, --name=NAME + For the USCS track line: provide a track name. Default + = 'User_supplied_track' + -d DESCRIPTION, --description=DESCRIPTION + For the USCS track line: provide a track description. + Default = 'User_supplied_track' + --color=COLOR + select the track color. Default = black + -s STRANDS, --colorstrands=STRANDS + select the colors for each strand. Default = + 'red,blue' + + </help> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyGetGTFSources.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,63 @@ + <tool id ="pyGetGTFSources" name="pyGetGTFSources"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyGetGTFSources.py --gtf $addGTF.gtf --count -o $out + </command> + <version_command>/usr/local/bin/pyGetGTFSources.py --version</version_command> + <inputs> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <param name="count" type="select" label="Count occurences of each annotation --count"> + <option value="" selected="true">No</option> + <option value="--count">Yes</option> + </param> + <param name="label" type="text" format="txt" size="30" value="GTF sources list" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="tabular" name="out" label="${label.value}.txt"/> + </outputs> + <help> +.. class:: infomark + +**pyGetGTFSources** + +pyGetGTFSources is part of the pyCRAC_ package. Extracts source names from the second column in a GTF file. + + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + --gtf=Yourfavoritegtf.gtf + type the path to the gtf file that you want to use. By + default it expects data from the standard input + -o OUTFILE, --outfile=OUTFILE + type the name and path of the file you want to write + the output to. Default is standard output + --count with this flag you the program will count the + occurence for each source/annotation in the gtf file + + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyGetGeneNamesFromGTF.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,71 @@ + <tool id ="pyGetGeneNamesFromGTF" name="pyGetGeneNamesFromGTF"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyGetGeneNamesFromGTF.py --gtf $addGTF.gtf --attribute $attribute $count -o $out + </command> + <version_command>/usr/local/bin/pyGetGeneNamesFromGTF.py --version</version_command> + <inputs> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <param name="attribute" type="select" label="Select the attribute to extract names from --attribute"> + <option value="gene_name" selected="true">gene_name</option> + <option value="gene_id">gene_id</option> + <option value="transcript_name">transcript_name</option> + <option value="transcript_id">transcript_id</option> + </param> + <param name="count" type="select" label="Count occurences of each annotation --count"> + <option value="" selected="true">No</option> + <option value="--count">Yes</option> + </param> + <param name="label" type="text" format="txt" size="30" value="GTF gene list" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="tabular" name="out" label="${label.value}.txt"/> + </outputs> + <help> +.. class:: infomark + +**pyGetGeneNamesFromGTF** + +pyGetGeneNamesFromGTF is part of the pyCRAC_ package. Extracts and counts all gene names from a GTF file. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + --gtf=Yourfavoritegtf.gtf + type the path to the gtf file that you want to use. By + default it expects data from the standard input. + -o OUTFILE, --outfile=OUTFILE + type the name and path of the file you want to write + the output to. Default is standard output + -a ATTRIBUTE, --attribute=ATTRIBUTE + from which attribute do you want to extract names? + Choices: gene_name, gene_id, transcript_name, + transcript_id + --count + with this flag you the program will count the + occurence for each source/annotation in the gtf file + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyMotif.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,41 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "f=s","version","gtf=s","range=i","overlap=i","--annotation=s", "--tab=s","--k_min=i","--k_max=i","--numberofkmers=i","--count=s","--features=s","--zscores=s","--random=s","options","o=s","id=s"); + +my $cmnd; + +my $prefix = "m_$opt{id}"; + + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyMotif.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyMotif.py -f $opt{f} --gtf $opt{gtf} --tab $opt{tab} --annotation $opt{annotation} -o $prefix"; + + if(exists $opt{options}){ + + $cmnd .= " --range=$opt{range} --overlap=$opt{overlap} --k_min=$opt{k_min} --k_max=$opt{k_max} --numberofkmers=$opt{numberofkmers}"; + } +} + +#testing +#open (COUNT, ">$opt{count}") || die ""; +#print COUNT "$cmnd"; + +system $cmnd; + + +system "mv $prefix"."_$opt{annotation}_data_k-mers_count.txt $opt{count}"; +system "mv $prefix"."_$opt{annotation}_top_k-mers_in_features.gtf $opt{features}"; +system "mv $prefix"."_$opt{annotation}_k-mer_Z_scores.txt $opt{zscores}"; +system "mv $prefix"."_$opt{annotation}_random_k-mers_count.txt $opt{random}"; + + + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyMotif.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,222 @@ + <tool id ="pyMotif" name="pyMotif"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + pyMotif.pl + -f $input + --gtf=$addGTF.gtf + + #if $addGTF.gtfFile == "default" and $addGTF.annotate.annotations == "auto": + --annotation $addGTF.annotate.scan.annotation + #else: + --annotation $addGTF.annotate.annotation + #end if# + + --tab=$addTab.tab + + #if $addOpt.options == "edit": + --options + --k_min $addOpt.kmin + --k_max $addOpt.kmax + --numberofkmers=$addOpt.numberofkmers + --overlap $addOpt.overlap + --range $addOpt.range + #end if# + -o "$input.name" + --id $count.id + --count $count + --random $random + --features $features + --zscores $zscores + </command> + <version_command>/usr/local/bin/pyMotif.py --version</version_command> + <inputs> + <param format="gtf" name="input" type="data" label="Input File --input_file" help="File of type .gtf" /> + <conditional name="addTab"> + <param name="tabFile" type="select" label="Choose Genomic Reference Sequence from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="tab" type="select" label="Genomic Reference Sequence --tab" help="Tab file containing genomic reference sequence"> + <options from_data_table="pycrac_tab"/> + </param> + </when> + <when value="other"> + <param format="tabular" name="tab" type="data" label="Genomic Reference Sequence --tab" help="Tab file containing genomic reference sequence"/> + </when> + </conditional> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan pyGetGTFSources file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param format="tabular" name="gtf_annotation" type="data" label="GTF annotation File (pyGetGTFSources output)" help="Tabular file containing unique list of annotations/sources in selected GTF file. Refer to pyGetGTFSources"/> + <conditional name="scan"> + <param name="annotations" type="select" label="Scan this file for annotations" help="Choose the correct GTF file then choose GO"> + <option value="wait" selected="true">Waiting</option> + <option value="scanning">Go</option> + </param> + <when value="wait"> + </when> + <when value="scanning"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf_annotation"> + <column name="name" index="0"/> + <column name="value" index="0"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + </when> + <when value="other"> + <param format="gtf" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + <conditional name="annotate"> + <param name="annotations" type="select" label="Select annotation"> + <option value="all" selected="true">All</option> + <option value="manual">Enter in text box</option> + <option value="auto">Scan selected file</option> + </param> + <when value="all"> + <param name="annotation" type="hidden" format="txt" size="10" value="all"/> + </when> + <when value="manual"> + <param name="annotation" type="text" format="txt" size="100" value="protein_coding" label="Select which annotation to focus search on --annotation" help="To find a list of available annotations please use pyGetGTFSources tool"> + <validator type="empty_field" message="Please enter a value"/> + </param> + </when> + <when value="auto"> + <param name="annotation" type="select" multiple="false" label="Select which annotation to focus search on --annotation"> + <options from_dataset="gtf"> + <column name="name" index="1"/> + <column name="value" index="1"/> + <filter type="unique_value" name="unique" column="1"/> + </options> + </param> + </when> + </conditional> + </when> + </conditional> + <conditional name="addOpt"> + <param name="options" type="select" label="Standard options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param format="integer" name="kmin" type="integer" label="Minimum k-mer Length --k_min " value="4" size="6" help="Set the minimal k-mer length"> + <validator type="in_range" min="1" message="Please enter a value >= 1"/> + </param> + <param format="integer" name="kmax" type="integer" label="Maximum k-mer Length --k_min " value="8" size="6" help="Set the minimal k-mer length"> + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="numberofkmers" type="integer" label="Maximum number of k-mers in output file --numberofkmers" value="1000" size="6" help="Set the maximum number of k-mers in output"> + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + <param format="integer" name="overlap" type="integer" label="Overlap --overlap" value="1" size="5" help="Sets the number of nucleotides a read has to overlap with a gene before it is considered a hit. "> + <validator type="in_range" min="1" message="Please enter a positive integer"/> + </param> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyMotif" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="tabular" name="zscores" label="${label.value}_k-mer_Z_scores.txt"/> + <data format="tabular" name="count" label="${label.value}_data_k-mers_count.txt"/> + <data format="gtf" name="features" label="${label.value}_top_k-mers_in_features.gtf"/> + <data format="tabular" name="random" label="${label.value}_random_k-mers_count.txt"/> + </outputs> + <help> + +.. class:: infomark + +**pyMotif** + +pyMotif is part of the pyCRAC_ package. Looks for enriched sequence motifs in high-throughput sequencing data. Produces a GTF type output file +with coordinates and Z-scores for enriched motifs. The GTF file can be visualised in genome browsers. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +File input options:: + + -f intervals.gtf, --input_file=intervals.gtf + Provide the path to an interval gtf file. By default + it expects data from the standard input. + -o OUTPUT_FILE, --output_file=OUTPUT_FILE + Use this flag to override the standard file names. Do + NOT add an extension. + --gtf=annotation_file.gtf + type the path to the gtf annotation file that you want + to use + --tab=tab_file.tab + type the path to the tab file that contains the + genomic reference sequence + +pyMotif specific options:: + + --k_min=4 + this option allows you to set the shortest k-mer + length. Default = 4. + --k_max=6 + this option allows you to set the longest k-mer + length. Default = 8. + -n 100, --numberofkmers=100 + choose the maximum number of enriched k-mer sequences + you want to have reported in output files. Default = + 1000 + +pyCRAC common options:: + + -a protein_coding, --annotation=protein_coding + select which annotation (i.e. protein_coding, ncRNA, + sRNA, rRNA,snoRNA,snRNA, depending on the source of + your GTF file) you would like to focus your search on. + Default = all annotations + -r 100, --range=100 + allows you to add regions flanking the genomic + feature. If you set '-r 50' or '--range=50', then the + program will add 50 nucleotides to each feature on + each side regardless of whether the GTF file has genes + with annotated UTRs. + --overlap=1 + sets the number of nucleotides a motif has to overlap + with a genomic feature before it is considered a hit. + Default = 1 nucleotide + + + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyPileup.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,384 @@ +<?xml version="1.0" encoding="utf-8"?> + <tool id ="pyPileup" name="pyPileup"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyPileup.py + -f $ftype.input + --file_type $ftype.file_type + #if $geneOpt.alignGene == "gene": + -g $geneOpt.genes + #end if# + #if $geneOpt.alignGene == "chr": + --chr $geneOpt.chr + #end if# + #if ($ftype.file_type == "novo" or $ftype.file_type == "sam") and $ftype.disc.discard == "discard": + --discarded $discarded + #end if# + --gtf=$addGTF.gtf + --tab=$addTab.tab + #if ($ftype.file_type == "novo" or $ftype.file_type == "sam") and $ftype.addAlignOpt.alignoptions == "edit": + --align_quality=$ftype.addAlignOpt.align_quality + --align_score=$ftype.addAlignOpt.align_score + --distance=$ftype.addAlignOpt.d + --length=$ftype.addAlignOpt.length + #if int($ftype.addAlignOpt.max) > 0: + --max=$ftype.addAlignOpt.max + #end if# + $ftype.addAlignOpt.unique + $ftype.addAlignOpt.blocks + $ftype.addAlignOpt.mutations + #if $ftype.disc.discard == "--discarded": + --discarded $discarded + #end if# + #end if# + #if $addOpt.options == "edit": + --range=$addOpt.range + --overlap=$addOpt.overlap + $addOpt.iclip + $addOpt.ignore + -s $addOpt.sequence + #if int($addOpt.limit) > 0: + --limit=$addOpt.limit + #end if# + #end if# + -o $output + </command> + <version_command>/usr/local/bin/pyPileup.py --version</version_command> + <inputs> + + + <conditional name="geneOpt"> + <param name="alignGene" type="select" label="Do you want to align reads to genes or chromosome co-ordinates?"> + <option value="gene" selected="true">Genes</option> + <option value="chr">Chromosome Co-ordinates</option> + </param> + <when value="chr"> + <param format="interval" name="chr" type="data" label="Choose a Chromosome Coordinate File" help="Tab delimited text file containing an identifier, chromosome name, start position, end position and strand ('-' or '+')"/> + </when> + <when value="gene"> + <param format="txt" name="genes" type="data" label="Choose a Gene List -g" help="Single column gene ID file"/> + </when> + </conditional> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <conditional name="addTab"> + <param name="tabFile" type="select" label="Choose Genomic Reference Sequence from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="tab" type="select" label="Genomic Reference Sequence --tab" help="Tab file containing genomic reference sequence"> + <options from_data_table="pycrac_tab"/> + </param> + </when> + <when value="other"> + <param format="tabular" name="tab" type="data" label="Genomic Reference Sequence --tab" help="Tab file containing genomic reference sequence"/> + </when> + </conditional> + + + <conditional name="ftype"> + <param name="file_type" type="select" label="Input File Type --file_type"> + <option value="novo" selected="true">Novo</option> + <option value="sam">Sam/BAM</option> + <option value="gtf">GTF</option> + </param> + <when value="sam"> + <param format="sam,bam" name="input" type="data" label="Input File -f" help="Alignment file of type .sam or .bam" /> + <conditional name="disc"> + <param name="discard" type="select" label="Print discarded reads to a separate file"> + <option value="" selected="true">OFF</option> + <option value="discard">ON</option> + </param> + <when value="discard"> + </when> + <when value=""> + </when> + </conditional> + <conditional name="addAlignOpt"> + <param name="alignoptions" type="select" label="Alignment Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="mutations" type="select" label="Filter reads by mutations --mutations" help="cross-linking sites are often highlighted by deletions and/or substitutions in the reads. You can use this option to filter reads based on whether they have mutations or not."> + <option value="" selected="true">Off</option> + <option value="--mutations=delsonly">deletions</option> + <option value="--mutations=subsonly">substitutions</option> + <option value="--mutations=TC">T->C mutations</option> + <option value="--mutations=allmuts">all mutations</option> + <option value="--mutations=nomuts">no mutations</option> + </param> + <param format="integer" name="align_quality" type="integer" label="Align Quality --align_quality " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="align_score" type="integer" label="Align Score --align_score " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="max" type="integer" label="Mapped reads to read from input file --max" help="Set to 0 to align all reads." value="0" size="10" > + <validator type="in_range" min="0" max="100000000" message="Please enter a value between 1 and 100000000 or 0 to align all reads"/> + </param> + <param format="integer" name="d" type="integer" label="Distance --distance " value="1000" size="6" help="Set the maximum number of bp allowed between two non-overlapping paired reads"> + <validator type="in_range" min="1" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="length" type="integer" label="Set the maximum length of reads --length" value="1000" size="7" help="Set the read length threshold between 15 and 1000"> + <validator type="in_range" min="15" max="1000" message="Please enter a value between 15 and 1000"/> + </param> + <param name="unique" type="select" label="Remove reads with multiple alignment locations --unique"> + <option value="" selected="true">OFF</option> + <option value="--unique">ON</option> + </param> + <param name="blocks" type="select" label="Only count reads with same start and end coords once --blocks"> + <option value="" selected="true">OFF</option> + <option value="--blocks">ON</option> + </param> + </when> + <when value="default"> + </when> + </conditional> + </when> + <when value="novo"> + <param format="tabular" name="input" type="data" label="Input File -f" help="Alignment file of type .novo" /> + <conditional name="disc"> + <param name="discard" type="select" label="Print discarded reads to a separate file"> + <option value="" selected="true">OFF</option> + <option value="discard">ON</option> + </param> + <when value="discard"> + </when> + <when value=""> + </when> + </conditional> + <conditional name="addAlignOpt"> + <param name="alignoptions" type="select" label="Alignment Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="mutations" type="select" label="Filter reads by mutations --mutations" help="cross-linking sites are often + highlighted by deletions and/or substitutions in the reads. You can use this option to filter reads based on whether they have mutations or not."> + <option value="" selected="true">Off</option> + <option value="--mutations=delsonly">deletions</option> + <option value="--mutations=subsonly">substitutions</option> + <option value="--mutations=TC">T->C mutations</option> + <option value="--mutations=allmuts">all mutations</option> + <option value="--mutations=nomuts">no mutations</option> + </param> + <param format="integer" name="align_quality" type="integer" label="Align Quality --align_quality " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="align_score" type="integer" label="Align Score --align_score " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="max" type="integer" label="Mapped reads to read from input file --max" help="Set to 0 to align all reads." value="0" size="10" > + <validator type="in_range" min="0" max="100000000" message="Please enter a value between 1 and 100000000 or 0 to align all reads"/> + </param> + <param format="integer" name="d" type="integer" label="Distance --distance " value="1000" size="6" help="Set the maximum number of bp allowed between two non-overlapping paired reads"> + <validator type="in_range" min="1" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="length" type="integer" label="Set the maximum length of reads --length" value="1000" size="7" help="Set the read length threshold between 15 and 1000"> + <validator type="in_range" min="15" max="1000" message="Please enter a value between 15 and 1000"/> + </param> + <param name="unique" type="select" label="Remove reads with multiple alignment locations --unique"> + <option value="" selected="true">OFF</option> + <option value="--unique">ON</option> + </param> + <param name="blocks" type="select" label="Only count reads with same start and end coords once --blocks"> + <option value="" selected="true">OFF</option> + <option value="--blocks">ON</option> + </param> + </when> + <when value="default"> + </when> + </conditional> + </when> + <when value="gtf"> + <param format="gtf" name="input" type="data" label="Input File -f" help="File of type .gtf" /> + </when> + </conditional> + + <conditional name="addOpt"> + <param name="options" type="select" label="Standard Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + <param name="ignore" type="select" label="Ignore strand information? --ignorestrand"> + <option value="" selected="true">No</option> + <option value="--ignorestrand">Yes</option> + </param> + <param format="integer" name="overlap" type="integer" label="Overlap --overlap" value="1" size="5" help="Sets the number of nucleotides a read has to overlap with a gene before it is considered a hit. "> + <validator type="in_range" min="1" message="Please enter a positive integer"/> + </param> + <param name="sequence" type="select" label="Align reads to --sequence"> + <option value="genomic" selected="true">Genomic Sequence</option> + <option value="coding">Coding Sequence</option> + </param> + <param name="iclip" type="select" label="iCLIP mode --iCLIP"> + <option value="" selected="true">OFF</option> + <option value="--iCLIP">ON</option> + </param> + <param format="integer" name="limit" type="integer" label="Limit number of reads to count that map to a particular region --limit" value="0" size="15" help="Set to 0 for unlimited reads" > + <validator type="in_range" min="0" message="Please enter a value greater than 1 or set to 0 for unlimited reads"/> + </param> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyPileup" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="tabular" name="output" label="${label.value}.pileup"/> + <data format="txt" name="discarded" label="${label.value}_discarded.txt"> + <filter>(ftype['file_type'] == "novo" or ftype['file_type'] == "sam") and ftype['disc']['discard'] == "discard"</filter> + </data> + </outputs> + <help> + + +.. class:: infomark + +**pyPileup** + +pyPileup is part of the pyCRAC_ package. Produces pileups containing the number of hits, substitutions and deletions for each nucleotide covered by +reads in specific genes or genomic regions + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +File input options:: + + -f FILE, --input_file=FILE + As input files you can use Novoalign native output, + SAM, pyMotif or pyReadCounters GTF files as input + file. By default it expects data from the standard + input. Make sure to specify the file type of the file + you want to have analyzed using the --file_type + option! + -o OUTPUT_FILE, --output_file=OUTPUT_FILE + Use this flag to override the standard output file + names. All pileups will be written to one output file. + -g FILE, --genes_file=FILE + here you need to type in the name of your gene list + file (1 column) or the hittable file + --chr=FILE + if you simply would like to align reads against a + genomic sequence you should generate a tab delimited + file containing an identifyer, chromosome name, start + position, end position and strand + --gtf=annotation_file.gtf + type the path to the gtf annotation file that you want + to use + --tab=tab_file.tab + type the path to the tab file that contains the + genomic reference sequence + --file_type=FILE_TYPE + use this option to specify the file type (i.e. 'novo', + 'sam', 'gtf'). This will tell the program which + parsers to use for processing the files. Default = + 'novo' + +pyPileup specific options:: + + --limit=500 + with this option you can select how many reads mapped + to a particular gene/ORF/region you want to count. + Default = All + --iCLIP + This turns on the iCLIP mode and the pileups will + report cross-linking site frequencies in iCLIP data in + reference sequences + +Common options:: + + -v, --verbose + prints all the status messages to a file rather than + the standard output + --ignorestrand + this flag tells the program to ignore strand + information and all overlapping reads will considered + sense reads. Useful for analysing ChIP or RIP data + --zip=FILE + use this option to compress all the output files in a + single zip file + --overlap=1 + sets the number of nucleotides a read has to overlap + with a gene before it is considered a hit. Default = + 1 nucleotide + -s genomic, --sequence=genomic + with this option you can select whether you want the + reads aligned to the genomic or the coding sequence. + Default = genomic + -r 100, --range=100 + allows you to set the length of the UTR regions. If + you set '-r 50' or '--range=50', then the program will + set a fixed length (50 bp) regardless of whether the + GTF file has genes with annotated UTRs. + +Options for novo, SAM and BAM files:: + + --align_quality=100, --mapping_quality=100 + with these options you can set the alignment quality + (Novoalign) or mapping quality (SAM) threshold. Reads + with qualities lower than the threshold will be + ignored. Default = 0 + --align_score=100 + with this option you can set the alignment score + threshold. Reads with alignment scores lower than the + threshold will be ignored. Default = 0 + -l 100, --length=100 + to set read length threshold. Default = 1000 + -m 100000, --max=100000 + maximum number of mapped reads that will be analyzed. + Default = All + --unique + with this option reads with multiple alignment + locations will be removed. Default = Off + --blocks + with this option reads with the same start and end + coordinates on a chromosome will only be counted once. + Default = Off + --discarded=FILE + prints the lines from the alignments file that were + discarded by the parsers. This file contains reads + that were unmapped (NM), of poor quality (i.e. QC) or + paired reads that were mapped to different chromosomal + locations or were too far apart on the same + chromosome. Useful for debugging purposes + -d 1000, --distance=1000 + this option allows you to set the maximum number of + base-pairs allowed between two non-overlapping paired + reads. Default = 1000 + --mutations=delsonly + Use this option to only track mutations that are of + interest. For CRAC data this is usually deletions + (--mutations=delsonly). For PAR-CLIP data this is + usually T-C mutations (--mutations=TC). Other options + are: do not report any mutations: --mutations=nomuts. + Only report specific base mutations, for example only + in T's, C's and G's :--mutations=[TCG]. The brackets + are essential. Other nucleotide combinations are also + possible + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyReadAligner.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,368 @@ + <tool id ="pyReadAligner" name="pyReadAligner"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pyReadAligner.py + -f $ftype.input + --file_type $ftype.file_type + #if $geneOpt.alignGene == "gene": + -g $geneOpt.genes + #end if# + #if $geneOpt.alignGene == "chr": + --chr $geneOpt.chr + #end if# + #if ($ftype.file_type == "novo" or $ftype.file_type == "sam") and $ftype.disc.discard == "discard": + --discarded $discarded + #end if# + --gtf=$addGTF.gtf + --tab=$addTab.tab + #if ($ftype.file_type == "novo" or $ftype.file_type == "sam") and $ftype.addAlignOpt.alignoptions == "edit": + --align_quality=$ftype.addAlignOpt.align_quality + --align_score=$ftype.addAlignOpt.align_score + --distance=$ftype.addAlignOpt.d + --length=$ftype.addAlignOpt.length + #if int($ftype.addAlignOpt.max) > 0: + --max=$ftype.addAlignOpt.max + #end if# + $ftype.addAlignOpt.unique + $ftype.addAlignOpt.blocks + $ftype.addAlignOpt.mutations + #end if# + #if $addOpt.options == "edit": + --range=$addOpt.range + --overlap=$addOpt.overlap + $addOpt.ignore + -s $addOpt.sequence + #if int($addOpt.limit) > 0: + --limit=$addOpt.limit + #end if# + #end if# + -o $output + </command> + <version_command>/usr/local/bin/pyReadAligner.py --version</version_command> + <inputs> + + + <conditional name="geneOpt"> + <param name="alignGene" type="select" label="Do you want to align reads to genes or chromosome co-ordinates?"> + <option value="gene" selected="true">Genes</option> + <option value="chr">Chromosome Co-ordinates</option> + </param> + <when value="chr"> + <param format="interval" name="chr" type="data" label="Choose a Chromosome Coordinate File" help="Tab delimited text file contai\ +ning an identifier, chromosome name, start position, end position and strand ('-' or '+')"/> + </when> + <when value="gene"> + <param format="txt" name="genes" type="data" label="Choose a Gene List -g" help="Single column gene ID file"/> + </when> + </conditional> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <conditional name="addTab"> + <param name="tabFile" type="select" label="Choose Genomic Reference Sequence from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="tab" type="select" label="Genomic Reference Sequence --tab" help="Tab file containing genomic reference sequence"> + <options from_data_table="pycrac_tab"/> + </param> + </when> + <when value="other"> + <param format="tabular" name="tab" type="data" label="Genomic Reference Sequence --tab" help="Tab file containing genomic reference sequence"/> + </when> + </conditional> + + + <conditional name="ftype"> + <param name="file_type" type="select" label="Input File Type --file_type"> + <option value="sam">Sam/BAM</option> + <option value="novo">Novo</option> + <option value="gtf">GTF</option> + </param> + <when value="sam"> + <param format="sam,bam" name="input" type="data" label="Input File -f" help="Alignment file of type .sam or .bam"/> + <conditional name="disc"> + <param name="discard" type="select" label="Print discarded reads to a separate file"> + <option value="" selected="true">OFF</option> + <option value="discard">ON</option> + </param> + <when value="discard"> + </when> + <when value=""> + </when> + </conditional> + <conditional name="addAlignOpt"> + <param name="alignoptions" type="select" label="Alignment Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="mutations" type="select" label="Filter reads by mutations --mutations" help="cross-linking sites are often highlighted by deletions and/or substitutions in the reads. You can use this option to filter reads based on whether they have mutations or not."> + <option value="" selected="true">Off</option> + <option value="--mutations=delsonly">deletions</option> + <option value="--mutations=subsonly">substitutions</option> + <option value="--mutations=TC">T->C mutations</option> + <option value="--mutations=allmuts">all mutations</option> + <option value="--mutations=nomuts">no mutations</option> + </param> + <param format="integer" name="align_quality" type="integer" label="Align Quality --align_quality " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="align_score" type="integer" label="Align Score --align_score " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="max" type="integer" label="Mapped reads to read from input file --max" help="Set to 0 to align all reads." value="0" size="10" > + <validator type="in_range" min="0" max="100000000" message="Please enter a value between 1 and 100000000 or 0 to align all reads"/> + </param> + <param format="integer" name="d" type="integer" label="Distance --distance " value="1000" size="6" help="Set the maximum number of bp allowed between two non-overlapping paired reads"> + <validator type="in_range" min="1" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="length" type="integer" label="Set the maximum length of reads --length" value="1000" size="7" help="Set the read length threshold between 15 and 1000"> + <validator type="in_range" min="15" max="1000" message="Please enter a value between 15 and 1000"/> + </param> + <param name="unique" type="select" label="Remove reads with multiple alignment locations --unique"> + <option value="" selected="true">OFF</option> + <option value="--unique">ON</option> + </param> + <param name="blocks" type="select" label="Only count reads with same start and end coords once --blocks"> + <option value="" selected="true">OFF</option> + <option value="--blocks">ON</option> + </param> + </when> + <when value="default"> + </when> + </conditional> + </when> + <when value="novo"> + <param format="tabular" name="input" type="data" label="Input File -f" help="Alignment file of type .novo" /> + <conditional name="disc"> + <param name="discard" type="select" label="Print discarded reads to a separate file"> + <option value="" selected="true">OFF</option> + <option value="discard">ON</option> + </param> + <when value="discard"> + </when> + <when value=""> + </when> + </conditional> + <conditional name="addAlignOpt"> + <param name="alignoptions" type="select" label="Alignment Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="mutations" type="select" label="Filter reads by mutations --mutations" help="cross-linking sites are often + highlighted by deletions and/or substitutions in the reads. You can use this option to filter reads based on whether they have mutations or not."> + <option value="" selected="true">Off</option> + <option value="--mutations=delsonly">deletions</option> + <option value="--mutations=subsonly">substitutions</option> + <option value="--mutations=TC">T->C mutations</option> + <option value="--mutations=allmuts">all mutations</option> + <option value="--mutations=nomuts">no mutations</option> + </param> + <param format="integer" name="align_quality" type="integer" label="Align Quality --align_quality " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="align_score" type="integer" label="Align Score --align_score " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="max" type="integer" label="Mapped reads to read from input file --max" help="Set to 0 to align all reads." value="0" size="10" > + <validator type="in_range" min="0" max="100000000" message="Please enter a value between 1 and 100000000 or 0 to align all reads"/> + </param> + <param format="integer" name="d" type="integer" label="Distance --distance " value="1000" size="6" help="Set the maximum number of bp allowed between two non-overlapping paired reads"> + <validator type="in_range" min="1" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="length" type="integer" label="Set the maximum length of reads --length" value="1000" size="7" help="Set the read length threshold between 15 and 1000"> + <validator type="in_range" min="15" max="1000" message="Please enter a value between 15 and 1000"/> + </param> + <param name="unique" type="select" label="Remove reads with multiple alignment locations --unique"> + <option value="" selected="true">OFF</option> + <option value="--unique">ON</option> + </param> + <param name="blocks" type="select" label="Only count reads with same start and end coords once --blocks"> + <option value="" selected="true">OFF</option> + <option value="--blocks">ON</option> + </param> + </when> + <when value="default"> + </when> + </conditional> + </when> + <when value="gtf"> + <param format="gtf" name="input" type="data" label="Input File -f" help="File of type .gtf" /> + </when> + </conditional> + + <conditional name="addOpt"> + <param name="options" type="select" label="Standard Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + <param name="ignore" type="select" label="Ignore strand information? --ignorestrand"> + <option value="" selected="true">No</option> + <option value="--ignorestrand">Yes</option> + </param> + <param format="integer" name="overlap" type="integer" label="Overlap --overlap" value="1" size="5" help="Sets the number of nucleotides a read has to overlap with a gene before it is considered a hit. "> + <validator type="in_range" min="1" message="Please enter a positive integer"/> + </param> + <param name="sequence" type="select" label="Align reads to --sequence"> + <option value="genomic" selected="true">Genomic Sequence</option> + <option value="coding">Coding Sequence</option> + </param> + <param format="integer" name="limit" type="integer" label="Limit number of reads to count that map to a particular region --limit" value="0" size="15" help="Set to 0 for unlimited reads" > + <validator type="in_range" min="0" message="Please enter a value greater than 1 or set to 0 for unlimited reads"/> + </param> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyReadAligner" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="fasta" name="output" label="${label.value}.aligned.fasta"/> + <data format="txt" name="discarded" label="${label.value}_discarded.txt"> + <filter>(ftype['file_type'] == "novo" or ftype['file_type'] == "sam") and ftype['disc']['discard'] == "discard"</filter> + </data> + </outputs> + <help> + + +.. class:: infomark + +**pyReadAligner** + +pyReadAligner is part of the pyCRAC_ package. Generates multiple sequence alignments for reads mapped to individual genes or genomic regions. +Produces a fasta output file. + + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +File input options:: + + -f FILE, --input_file=FILE + As input files you can use Novoalign native output or + SAM files as input file. By default it expects data + from the standard input. Make sure to specify the file + type of the file you want to have analyzed using the + --file_type option! + -o OUTPUT_FILE, --output_file=OUTPUT_FILE + Use this flag to override the standard output file + names. All alignments will be written to one output + file. + -g FILE, --genes_file=FILE + here you need to type in the name of your gene list + file (1 column) or the hittable file + --chr=FILE + if you simply would like to align reads against a + genomic sequence you should generate a tab delimited + file containing an identifyer, chromosome name, start + position, end position and strand + --gtf=annotation_file.gtf + type the path to the gtf annotation file that you want + to use + --tab=tab_file.tab + type the path to the tab file that contains the + genomic reference sequence + --file_type=FILE_TYPE + use this option to specify the file type (i.e. 'novo', + 'sam', 'gtf'). This will tell the program which + parsers to use for processing the files. Default = + 'novo' + +pyReadAligner specific options:: + + --limit=500 + with this option you can select how many reads mapped + to a particular gene/ORF/region you want to count. + Default = All + +Common options:: + + --ignorestrand + this flag tells the program to ignore strand + information and all overlapping reads will considered + sense reads. Useful for analysing ChIP or RIP data + --overlap=1 + sets the number of nucleotides a read has to overlap + with a gene before it is considered a hit. Default = + 1 nucleotide + -s genomic, --sequence=genomic + with this option you can select whether you want the + reads aligned to the genomic or the coding sequence. + Default = genomic + -r 100, --range=100 + allows you to set the length of the UTR regions. If + you set '-r 50' or '--range=50', then the program will + set a fixed length (50 bp) regardless of whether the + GTF file has genes with annotated UTRs. + +Options for novo, SAM and BAM files:: + + --align_quality=100, --mapping_quality=100 + with these options you can set the alignment quality + (Novoalign) or mapping quality (SAM) threshold. Reads + with qualities lower than the threshold will be + ignored. Default = 0 + --align_score=100 + with this option you can set the alignment score + threshold. Reads with alignment scores lower than the + threshold will be ignored. Default = 0 + -l 100, --length=100 + to set read length threshold. Default = 1000 + -m 100000, --max=100000 + maximum number of mapped reads that will be analyzed. + Default = All + --unique + with this option reads with multiple alignment + locations will be removed. Default = Off + --blocks + with this option reads with the same start and end + coordinates on a chromosome will only be counted once. + Default = Off + --discarded=FILE + prints the lines from the alignments file that were + discarded by the parsers. This file contains reads + that were unmapped (NM), of poor quality (i.e. QC) or + paired reads that were mapped to different chromosomal + locations or were too far apart on the same + chromosome. Useful for debugging purposes + -d 1000, --distance=1000 + this option allows you to set the maximum number of + base-pairs allowed between two non-overlapping paired + reads. Default = 1000 + --mutations=delsonly + Use this option to only track mutations that are of + interest. For CRAC data this is usually deletions + (--mutations=delsonly). For PAR-CLIP data this is + usually T-C mutations (--mutations=TC). Other options + are: do not report any mutations: --mutations=nomuts. + Only report specific base mutations, for example only + in T's, C's and G's :--mutations=[TCG]. The brackets + are essential. Other nucleotide combinations are also + possible + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyReadCounters.pl Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,60 @@ +#!/usr/bin/perl -w +use strict; +use Getopt::Long; + +my %opt; + + +GetOptions(\%opt, "f=s","file_type=s","version","gtf=s","align_quality=i","align_score=i","range=i","length=i","max=i","distance=i","ignorestrand","overlap=i","unique","blocks","mutations=s","countoutput=s","stats=s","hittable=s","intronUTRoverlap=s","discarded=s","options","alignOpt","id=s"); + +my $cmnd; +my $prefix = "rc_$opt{id}"; + + +if (exists $opt{version}){ + $cmnd = "python /usr/local/bin/pyReadCounters.py --version"; +} +else{ + $cmnd = "python /usr/local/bin/pyReadCounters.py -f $opt{f} --file_type $opt{file_type} --gtf $opt{gtf} -o $prefix"; + + if(exists $opt{options}){ + + $cmnd .= " --range=$opt{range} --overlap=$opt{overlap}"; + + if(exists $opt{ignorestrand}){ $cmnd .= " --ignorestrand";} + } + + if(exists $opt{alignOpt}){ + $cmnd .= " --align_quality=$opt{align_quality} --align_score=$opt{align_score} --length=$opt{length} --distance=$opt{distance}"; + if(exists $opt{max}){$cmnd .= " --max=$opt{max}";} + if(exists $opt{unique}){$cmnd .= " --unique";} + if(exists $opt{blocks}){$cmnd .= " --blocks";} + if(exists $opt{mutations}){$cmnd .= " --mutations=$opt{mutations}";} + if(exists $opt{discarded}){$cmnd .= " --discarded=$opt{discarded}";} + + } +} + + +system $cmnd; +print STDOUT $cmnd; + + +if(exists $opt{blocks}){ + system "mv $prefix"."_hittable_cDNAs.txt $opt{hittable}"; + system "mv $prefix"."_file_statistics_cDNAs.txt $opt{stats}"; + system "mv $prefix"."_intron_and_UTR_overlap_cDNAs.gtf $opt{intronUTRoverlap}"; + + if($opt{file_type} ne "gtf"){ + system "mv $prefix"."_count_output_cDNAs.gtf $opt{countoutput}"; + } +} +else{ + system "mv $prefix"."_hittable_reads.txt $opt{hittable}"; + system "mv $prefix"."_file_statistics_reads.txt $opt{stats}"; + system "mv $prefix"."_intron_and_UTR_overlap_reads.gtf $opt{intronUTRoverlap}"; + + if($opt{file_type} ne "gtf"){ + system "mv $prefix"."_count_output_reads.gtf $opt{countoutput}"; + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pyReadCounters.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,359 @@ +<tool id ="pyReadCounters" name="pyReadCounters" force_history_refresh="True"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="perl"> + pyReadCounters.pl + -f $ftype.input + --file_type $ftype.file_type + --gtf $addGTF.gtf + #if ($ftype.file_type == "novo" or $ftype.file_type == "sam") and $ftype.disc.discard == "discard": + --discarded $discarded + #end if# + #if ($ftype.file_type == "novo" or $ftype.file_type == "sam") and $ftype.addAlignOpt.alignoptions == "edit": + --alignOpt + --align_quality $ftype.addAlignOpt.align_quality + --align_score $ftype.addAlignOpt.align_score + #if int($ftype.addAlignOpt.max) > 0: + --max $ftype.addAlignOpt.max + #end if# + --distance $ftype.addAlignOpt.d + --length $ftype.addAlignOpt.length + $ftype.addAlignOpt.unique + $ftype.addAlignOpt.blocks + $ftype.addAlignOpt.mutations + #end if# + #if $addOpt.options == "edit": + --options + --range $addOpt.range + $addOpt.ignore + --overlap $addOpt.overlap + #end if# + + --stats $stats + --hittable $hittable + --intronUTRoverlap $intronUTRoverlap + + #if $ftype.file_type == "novo" or $ftype.file_type == "sam": + --countoutput $countoutput + #end if# + + --id $stats.id + </command> + <version_command>/usr/local/bin/pyReadCounters.py --version</version_command> + <inputs> + <conditional name="addGTF"> + <param name="gtfFile" type="select" label="Choose GTF File from"> + <option value="default" selected="true">Defaults</option> + <option value="other">History</option> + </param> + <when value="default"> + <param name="gtf" type="select" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"> + <options from_data_table="pycrac_gtf"/> + </param> + </when> + <when value="other"> + <param format="GTF" name="gtf" type="data" label="GTF File --gtf" help="GTF file containing gene ID co-ordinates"/> + </when> + </conditional> + <conditional name="ftype"> + <param name="file_type" type="select" label="Input File Type --file_type" help="Use .novo or .sam input files"> + <option value="novo" selected="true">Novo</option> + <option value="sam">Sam/Bam</option> + <option value="gtf">GTF</option> + </param> + <when value="novo"> + <param format="tabular" name="input" type="data" label="Input File --input_file" help="Alignment file of type .novo" /> + <conditional name="disc"> + <param name="discard" type="select" label="Print discarded reads to a separate file"> + <option value="" selected="true">OFF</option> + <option value="discard">ON</option> + </param> + <when value="discard"> + </when> + <when value=""> + </when> + </conditional> + <conditional name="addAlignOpt"> + <param name="alignoptions" type="select" label="Alignment Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="mutations" type="select" label="Option for selecting type of mutations to report --mutations" help="cross-linking sites are often highlighted by deletions and/or substitutions in the reads. You can use this option to select specific mutations that you want to have reported in the GTF output file."> + <option value="" selected="true">Off</option> + <option value="--mutations delsonly">deletions</option> + <option value="--mutations subsonly">substitutions</option> + <option value="--mutations TC">T->C substitutions</option> + <option value="--mutations nomuts">no mutations</option> + </param> + <param format="integer" name="align_quality" type="integer" label="Align Quality --align_quality " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="align_score" type="integer" label="Align Score --align_score " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="max" type="integer" label="Mapped reads to read from input file --max" help="Set to 0 to align all reads." value="0" size="10" > + <validator type="in_range" min="0" max="100000000" message="Please enter a value between 1 and 100000000 or 0 to align all reads"/> + </param> + <param format="integer" name="d" type="integer" label="Distance --distance " value="1000" size="6" help="Set the maximum number of bp allowed between two non-overlapping paired reads"> + <validator type="in_range" min="1" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="length" type="integer" label="Set the maximum length of reads --length" value="1000" size="7" help="Set the read length threshold between 15 and 1000"> + <validator type="in_range" min="15" max="1000" message="Please enter a value between 15 and 1000"/> + </param> + <param name="unique" type="select" label="Remove reads with multiple alignment locations --unique"> + <option value="" selected="true">OFF</option> + <option value="--unique">ON</option> + </param> + <param name="blocks" type="select" label="Only count reads with same start and end coords once --blocks"> + <option value="" selected="true">OFF</option> + <option value="--blocks">ON</option> + </param> + </when> + <when value="default"> + </when> + </conditional> + </when> + <when value="sam"> + <param format="sam,bam" name="input" type="data" label="Input File --input_file" help="Alignment file of type .sam or .bam" /> + <conditional name="disc"> + <param name="discard" type="select" label="Print discarded reads to a separate file"> + <option value="" selected="true">OFF</option> + <option value="discard">ON</option> + </param> + <when value="discard"> + </when> + <when value=""> + </when> + </conditional> + <conditional name="addAlignOpt"> + <param name="alignoptions" type="select" label="Alignment Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param name="mutations" type="select" label="Option for selecting type of mutations to report --mutations" help="cross-linking sites are often highlighted by deletions and/or substitutions in the reads. You can use this option to select specific mutations that you want to have reported in the GTF output file."> + <option value="" selected="true">Off</option> + <option value="--mutations delsonly">deletions</option> + <option value="--mutations subsonly">substitutions</option> + <option value="--mutations TC">T->C mutations</option> + <option value="--mutations nomuts">no mutations</option> + </param> + <param format="integer" name="align_quality" type="integer" label="Align Quality --align_quality " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="align_score" type="integer" label="Align Score --align_score " value="0" size="5" > + <validator type="in_range" min="0" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="max" type="integer" label="Mapped reads to read from input file --max" help="Set to 0 to align all reads." value="0" size="10" > + <validator type="in_range" min="0" max="100000000" message="Please enter a value between 1 and 100000000 or 0 to align all reads"/> + </param> + <param format="integer" name="d" type="integer" label="Distance --distance " value="1000" size="6" help="Set the maximum number of bp allowed between two non-overlapping paired reads"> + <validator type="in_range" min="1" message="Please enter a value >= 0"/> + </param> + <param format="integer" name="length" type="integer" label="Set the maximum length of reads --length" value="1000" size="7" help="Set the read length threshold between 15 and 1000"> + <validator type="in_range" min="15" max="1000" message="Please enter a value between 15 and 1000"/> + </param> + <param name="unique" type="select" label="Remove reads with multiple alignment locations --unique"> + <option value="" selected="true">OFF</option> + <option value="--unique">ON</option> + </param> + <param name="blocks" type="select" label="Only count reads with same start and end coords once --blocks"> + <option value="" selected="true">OFF</option> + <option value="--blocks">ON</option> + </param> + </when> + <when value="default"> + </when> + </conditional> + </when> + <when value="gtf"> + <param format="gtf" name="input" type="data" label="Input File --input_file" help="File of type .gtf" /> + </when> + </conditional> + <conditional name="addOpt"> + <param name="options" type="select" label="Standard Options"> + <option value="default" selected="true">Default</option> + <option value="edit">Edit</option> + </param> + <when value="edit"> + <param format="integer" name="range" type="integer" label="Range --range" value="0" size="5" help="Manually set the length of the 5' and 3' UTRs 0>50000"> + <validator type="in_range" min="0" max="50000" message="Please enter a value between 0 and 50000"/> + </param> + <param name="ignore" type="select" label="Ignore strand information? --ignorestrand"> + <option value="" selected="true">No</option> + <option value="--ignorestrand">Yes</option> + </param> + <param format="integer" name="overlap" type="integer" label="Overlap --overlap" value="1" size="5" help="Sets the number of nucleotides a read has to overlap with a gene before it is considered a hit. "> + <validator type="in_range" min="1" message="Please enter a positive integer"/> + </param> + </when> + <when value="default"> + </when> + </conditional> + <param name="label" type="text" format="txt" size="30" value="pyReadCounters" label="Enter output file label -o" /> + </inputs> + <outputs> + <data format="tabular" name="stats" label="${label.value}_file_statistics.txt"/> + <data format="tabular" name="hittable" label="${label.value}_hittable.txt"/> + <data format="gtf" name="intronUTRoverlap" label="${label.value}_intron_and_UTR_overlap.txt"/> + <data format="gtf" name="countoutput" label="${label.value}_count_output.gtf"> + <filter>ftype['file_type'] == "novo" or ftype['file_type'] == "sam"</filter> + </data> + <data format="txt" name="discarded" label="${label.value}_discarded.txt"> + <filter>(ftype['file_type'] == "novo" or ftype['file_type'] == "sam") and ftype['disc']['discard'] == "discard"</filter> + </data> + </outputs> + <help> + +.. class:: infomark + +**pyReadCounters** + +pyReadCounters is part of the pyCRAC_ package. Produces a gene hittable file, two GTF output files showing to which genomic features the reads overlap. +Finally the tool produces a read statistics file that provides information about the complexity of your dataset. + +**Output file examples** + +A hittable file:: + + # generated by pyReadCounters version 1.1.0, Mon Apr 16 20:34:22 2012 + # /usr/local/bin/pyReadCounters.py -f RNAseq_data.novo -c 1 --unique + # total number of reads 12534556 + # total number of paired reads 10947376 + # total number of single reads 483095 + # total number of mapped reads: 11430471 + # total number of overlapping genomic features 7019550 + # sense 5960669 + # anti-sense 1058881 + # feature sense_overlap anti-sense_overlap number of reads + + ## protein_coding 3190701 + YEF3 49930 3629 24221 + PMA1 32621 2650 21776 + COX1 24559 1037 15174 + TFP1 21539 1689 13506 + HSC82 21177 1458 12729 + ADH1 20245 1467 11351 + AI5_ALPHA 20022 918 13101 + AI4 19390 886 12638 + AI3 17823 798 11473 + AI2 17590 790 11297 + RPL10 16822 1113 8797 + ENO2 16336 1125 8913 + TEF1 15578 1333 5450 + +An example of a GTF 'count_output' file:: + + ##gff-version 2 + # generated by Counters version 1.2.0, Tue Jan 8 22:47:29 2013 + # pyReadCounters.py -f PAR_CLIP_unique.novo --mutations=TC -v + # total number of reads: 2455251 + # total number of paired reads: 0 + # total number of single reads: 2455251 + # total number of mapped reads: 2455251 + # total number of overlapping genomic features: 5153943 + # sense: 2640600 + # anti-sense: 2513343 + chrXIV reads exon 661572 661605 2 + . gene_id "INT_0_6716,YNR016C"; gene_name "INT_0_6716,ACC1"; # 661596S; + chrXIV reads exon 661720 661738 1 + . gene_id "INT_0_6716,YNR016C"; gene_name "INT_0_6716,ACC1"; # 661726S; + chrXIV reads exon 661839 661878 4 + . gene_id "INT_0_6716,YNR016C"; gene_name "INT_0_6716,ACC1"; # 661875S; + +This output file also reports whether a read contains a mutation. + +For example:: + + # 661596S + +Indicates that the read had a nucleotide substitution ("S") at genomic coordinate 661596. The chromosome name can be found in the first column. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +File input options:: + + -f FILE, --input_file=FILE + provide the path to your novo, SAM/BAM or gtf data + file. Default is standard input. Make sure to specify + the file type of the file you want to have analyzed + using the --file_type option! + -o OUTPUT_FILE, --output_file=OUTPUT_FILE + Use this flag to override the standard file names. Do + NOT add an extension. + --file_type=FILE_TYPE + use this option to specify the file type (i.e. + 'novo','sam' or 'gtf'). This will tell the program + which parsers to use for processing the files. Default + = 'novo' + --gtf=annotation_file.gtf + type the path to the gtf annotation file that you want + to use + +Common pyCRAC options:: + + --ignorestrand + To ignore strand information and all reads overlapping + with genomic features will be considered sense reads. + Useful for analysing ChIP or RIP data + --overlap=1 + sets the number of nucleotides a read has to overlap + with a gene before it is considered a hit. Default = + 1 nucleotide + -r 100, --range=100 + allows you to add regions flanking the genomic + feature. If you set '-r 50' or '--range=50', then the + program will add 50 nucleotides to each feature on + each side regardless of whether the GTF file has genes + with annotated UTRs + +Options for SAM/BAM and Novo files:: + + --mutations=delsonly + Use this option to only track mutations that are of + interest. For CRAC data this is usually deletions + (--mutations=delsonly). For PAR-CLIP data this is + usually T-C mutations (--mutations=TC). Other options + are\: do not report any mutations: --mutations=nomuts. + Only report specific base mutations, for example only + in T's, C's and G's :--mutations=[TCG]. The brackets + are essential. Other nucleotide combinations are also + possible + --align_quality=100, --mapping_quality=100 + with these options you can set the alignment quality + (Novoalign) or mapping quality (SAM) threshold. Reads + with qualities lower than the threshold will be + ignored. Default = 0 + --align_score=100 + with this option you can set the alignment score + threshold. Reads with alignment scores lower than the + threshold will be ignored. Default = 0 + --unique + with this option reads with multiple alignment + locations will be removed. Default = Off + --blocks + with this option reads with the same start and end + coordinates on a chromosome will be counted as one + cDNA. Default = Off + -m 100000, --max=100000 + maximum number of mapped reads that will be analyzed. + Default = All + -d 1000, --distance=1000 + this option allows you to set the maximum number of + base-pairs allowed between two non-overlapping paired + reads. Default = 1000 + --discarded=FILE + prints the lines from the alignments file that were + discarded by the parsers. This file contains reads + that were unmapped (NM), of poor quality (i.e. QC) or + paired reads that were mapped to different chromosomal + locations or were too far apart on the same + chromosome. Useful for debugging purposes + -l 100, --length=1000 + to set read length threshold. Default = 1000 + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pySelectMotifsFromGTF.xml Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,75 @@ + <tool id ="pySelectMotifsFromGTF" name="pySelectMotifsFromGTF"> + <requirements> + <requirement type="package">pyCRAC</requirement> + </requirements> + <command interpreter="python"> + /usr/local/bin/pySelectMotifsFromGTF.py + --gtf $input + -m $motif + -o $out + -l $length + -z $zscore + </command> + <version_command>/usr/local/bin/pySelectMotifsFromGTF.py --version</version_command> + <inputs> + <param format="gtf" name="input" type="data" label="Input File -f" help="pyMotif gtf output files" /> + <param format="txt" name="motif" type="text" size="200" value="KBCTTG" label="motif string" help="Enter motif (all uppercase) you want to extract from the pyMotif gtf output file"> + <validator type="empty_field" /> + </param> + <param format="integer" type="integer" value="6" size="5" name="length" label="Length --length" help="Set a Kmer Length. Note that the length has to be at least as long as your k-mer sequence, otherwise the program will not run correctly" /> + <param format="float" type="float" value="0" size="5" name="zscore" label="Z Score --Z_score" help="Set a minimum Kmer Z_score" /> + <param name="label" type="text" format="txt" size="30" value="pySelectMotifsFromGTF" label="Enter output file label -o" /> + </inputs> + + <outputs> + <data format="gtf" name="out" label="${label.value}_${motif.value}.gtf"/> + </outputs> + <help> + + +.. class:: infomark + +**pySelectMotifsFromGTF** + +pySelectMotifsFromGTF is part of the pyCRAC_ package. Extracts your favourite k-mer sequence from pyMotif GTF output files. +Note that you can include degenerate nucleotides in your motif string:: + + N = A, G, C or T + R = A or G = puRine + Y = C or T = pYrimidine + M = A or C = aroMatic + S = G or C + W = A or T + K = G or T = Keto + V = A, C or G = Not T (letter after) + D = A, G or T = Not C + H = A, C or T = Not G + B = C, G or T = Not A + +So if you enter KBCTTG as search string and length=6, then the program will extract a large number of six-mers from your data. +If you set length = 8, it will look for this pattern in a stretch of 8 nucleotides. + +.. _pyCRAC: http://sandergranneman.bio.ed.ac.uk/Granneman_Lab/pyCRAC_software.html + +------ + +**Parameter list** + +Options:: + + --gtf=Yourfavoritegtf.gtf + type the path to the gtf file that you want to use. By + default it expects data from the standard input + -o FILE, --output=FILE + Optional.Specify the name of the output file. Default + is standard output. Make sure it has the .gtf + extension! + -m KBCTTG, --motif=KBCTTG + Specify the motif you want extract from the GTF file. + -z 15.0, --Z_score=15.0 + Set a minimum k-mer Z-score. Default=0 + -l 4, --length=4 + Set a k-mer length. Default is no length filtering + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pycrac.chr.loc.sample Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,1 @@ +s.cerevisiae EF2 /usr/local/pyCRAC/db/Saccharomyces_cerevisiae.EF2.59.1.0_chr_lengths.txt
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pycrac.fasta.loc.sample Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,1 @@ +s.cerevisiae EF2 /usr/local/pyCRAC/db/Saccharomyces_cerevisiae.EF2.59.1.0.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pycrac.gtf.loc.sample Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,1 @@ +s.cerevisiae EF2 /usr/local/pyCRAC/db/Saccharomyces_cerevisiae.EF2.59.1.2.gtf
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/pycrac.tab.loc.sample Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,1 @@ +s.cerevisiae EF2 /usr/local/pyCRAC/db/Saccharomyces_cerevisiae.EF2.59.1.0.fa.tab
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/pyCrac_galaxy/tool_data_table_conf.xml.sample Thu Jun 06 09:39:32 2013 -0400 @@ -0,0 +1,23 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Locations of default fasta files for pycrac --> + <table name="pycrac_fasta"> + <columns>name, value</columns> + <file path="tool-data/pyCRAC/pycrac.fasta.loc" /> + </table> + <!-- Locations of default gtf files for pycrac --> + <table name="pycrac_gtf"> + <columns>name, value</columns> + <file path="tool-data/pyCRAC/pycrac.gtf.loc" /> + </table> + <!-- Locations of default tab files for pycrac --> + <table name="pycrac_tab"> + <columns>name, value</columns> + <file path="tool-data/pyCRAC/pycrac.tab.loc" /> + </table> + <!-- Locations of default chrom length files for pycrac --> + <table name="pycrac_chr"> + <columns>name, value</columns> + <file path="tool-data/pyCRAC/pycrac.chr.loc" /> + </table> +</tables>