# HG changeset patch
# User stephenshank
# Date 1543340227 18000
# Node ID efed2740c775773ed759764705bf809e296ef2e7

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/shorah commit a998ff1518bf917b15b861c9104ae9db1830a3fb-dirty

diff -r 000000000000 -r efed2740c775 shorah.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/shorah.xml	Tue Nov 27 12:37:07 2018 -0500
@@ -0,0 +1,60 @@
+<?xml version="1.0"?>
+<tool id="shorah_amplicon" version="@VERSION@+galaxy0" name="Reconstruct haplotypes">
+    <description>with ShoRAH in amplicon mode</description>
+    <macros>
+        <token name="@VERSION@">1.1.3</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@VERSION@">shorah</requirement>
+    </requirements>
+    <command detect_errors="exit_code">
+    <![CDATA[
+    ## amplian.py -b  ~/git/shorah/examples/amplicon_test/ampli_sorted.bam -f ~/git/shorah/examples/amplicon_test/reference.fasta -m 0.95
+    ln -s '$bam' input.bam &&
+    ln -s '$fasta' input.fa &&
+    amplian.py
+        --bam input.bam
+        --fasta input.fa
+        #if $region:
+            --region $region
+        #end if
+        $diversity
+        --min_overlap $min_overlap
+        --alpha $alpha
+        --maxcov $maxcov
+        --sigma $sigma
+
+    ]]>
+    </command>
+    <inputs>
+        <param argument="--bam" type="data" format="bam" label="Aligned reads in .bam format" />
+        <param argument="--fasta" type="data" format="fasta" label="Reference genome in fasta format" />
+        <param argument="--region" type="text" value="" optional="true" label="Limit to a specific region" help="e.g. 'ch3:1000-1300'" />
+        <param argument="--diversity" type="boolean" truevalue="--diversity" falsevalue="" label="Run on the highest entropy region" />
+        <param argument="--min_overlap" type="float" value="0.95" min="0" max="1" optional="true" label="Fraction of read overlap to be included" />
+        <param argument="--alpha" type="float" value="0.5" optional="true" label="Alpha in dpm sampling" />
+        <param argument="--maxcov" type="integer" value="50000" optional="true" label="Approximate max coverage allowed" />
+        <param argument="--sigma" type="float" value="0.01" optional="true" label="Sigma value to use when calling SNVs" />
+    </inputs>
+    <outputs>
+        <data name="haplotypes" format="csv" from_work_dir="SNVs_0.010000_final.csv" label="${tool.name} on ${on_string}: Haplotypes" />
+        <data name="log" format="txt" from_work_dir="SNV.txt" label="${tool.name} on ${on_string}: Log" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="bam" ftype="bam" value="shorah-amplicon-in1.bam" />
+            <param name="fasta" ftype="fasta" value="shorah-amplicon-in1.fa" />
+            <param name="min_overlap" value="0.95" />
+            <output name="haplotypes" file="shorah-amplicon-out1.csv" compare="re_match" />
+            <output name="log" file="shorah-amplicon-out1.txt" compare="re_match" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+ShoRAH is an open source project for the analysis of next generation sequencing data. It is designed to analyse genetically heterogeneous samples. Its tools are written in different programming languages and provide error correction, haplotype reconstruction and estimation of the frequency of the different genetic variants present in a mixed sample.
+]]>
+    </help>
+    <citations>
+        <citation type="doi">10.1186/1471-2105-12-119</citation>
+    </citations>
+</tool>
\ No newline at end of file
diff -r 000000000000 -r efed2740c775 test-data/shorah-amplicon-in1.bam
Binary file test-data/shorah-amplicon-in1.bam has changed
diff -r 000000000000 -r efed2740c775 test-data/shorah-amplicon-in1.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shorah-amplicon-in1.fa	Tue Nov 27 12:37:07 2018 -0500
@@ -0,0 +1,3 @@
+>reference
+CTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGG
+AAGCTCTATTAGA
diff -r 000000000000 -r efed2740c775 test-data/shorah-amplicon-out1.csv
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shorah-amplicon-out1.csv	Tue Nov 27 12:37:07 2018 -0500
@@ -0,0 +1,4 @@
+Chromosome,Pos,Ref,Var,Freq,Post,Fvar,Rvar,Ftot,Rtot,Pval,Qval
+reference,8,C,A,0.35..,1.0000,147,144,511,489,0.942186,1
+reference,28,T,A,0.35..,1.0000,147,145,511,489,0.918406,1
+reference,35,A,C,0.35..,1.0000,146,144,511,489,0.91896,1
diff -r 000000000000 -r efed2740c775 test-data/shorah-amplicon-out1.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/shorah-amplicon-out1.txt	Tue Nov 27 12:37:07 2018 -0500
@@ -0,0 +1,4 @@
+Chromosome	Pos	Ref	Var	Freq	Post
+reference	8	C	A	0.35..	1.0000
+reference	28	T	A	0.35..	1.0000
+reference	35	A	C	0.35..	1.0000