Mercurial > repos > slegras > test_bowtie2

comparison bowtie2_wrapper.xml @ 0:5f5b0cb78ff1 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author slegras
date Fri, 27 Feb 2015 05:26:05 -0500
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:5f5b0cb78ff1
1 <tool id="bowtie2" name="Bowtie2" version="2.2.4">
2 <!-- Wrapper compatible with Bowtie version 2.2.4 -->
3 <description>- map reads against reference genome</description>
4 <version_command>bowtie2 --version</version_command>
5 <requirements>
6 <requirement type="package" version="2.2.4">bowtie2</requirement>
7 <requirement type="package" version="0.1.18">samtools</requirement>
8 </requirements>
9 <command>
10
11 ## prepare bowtie2 index
12 #set index_path = ''
13 #if str($reference_genome.source) == "history":
14 bowtie2-build "$reference_genome.own_file" genome &amp;&amp;
15 ln -s "$reference_genome.own_file" genome.fa &amp;&amp;
16 #set index_path = 'genome'
17 #else:
18 #set index_path = $reference_genome.index.fields.path
19 #end if
20
21 ## execute bowtie2
22
23 bowtie2
24
25 ## number of threads
26 -p \${GALAXY_SLOTS:-4}
27
28 ## index file path
29 -x $index_path
30
31
32 ## Fastq inputs
33 #if str( $library.type ) == "single":
34 -U "${input_1}"
35 #if str( $library.unaligned_file ) == "true":
36 --un $output_unaligned_reads_l
37 #end if
38 #elif str( $library.type ) == "paired":
39 -1 "${input_1}"
40 -2 "${input_2}"
41 #if str( $library.paired_options.paired_options_selector ) == "yes":
42 -I "${library.paired_options.I}"
43 -X "${library.paired_options.X}"
44 ${library.paired_options.fr_rf_ff}
45 ${library.paired_options.no_mixed}
46 ${library.paired_options.no_discordant}
47 ${library.paired_options.dovetail}
48 ${library.paired_options.no_contain}
49 ${library.paired_options.no_overlap}
50 #end if
51 #if str( $library.unaligned_file ) == "true":
52 --un-conc $output_unaligned_reads_l
53 #end if
54 #else
55 ## prepare collection
56 -1 $library.input_1.forward
57 -2 $library.input_1.reverse
58 #if str( $library.paired_options.paired_options_selector ) == "yes":
59 -I "${library.paired_options.I}"
60 -X "${library.paired_options.X}"
61 ${library.paired_options.fr_rf_ff}
62 ${library.paired_options.no_mixed}
63 ${library.paired_options.no_discordant}
64 ${library.paired_options.dovetail}
65 ${library.paired_options.no_contain}
66 ${library.paired_options.no_overlap}
67 #end if
68 #if str( $library.unaligned_file ) == "true":
69 --un-conc $output_unaligned_reads_l
70 #end if
71 #end if
72
73 ## Readgroups
74 #if str( $read_group.read_group_selector ) == "yes":
75 --rg-id "${read_group.rgid}"
76 --rg "SM:${read_group.rgsm}"
77 --rg "LB:${read_group.rglb}"
78 --rg "PL:${read_group.rgpl}"
79 #end if
80
81 ## Analysis type
82 #if ( str( $analysis_type.analysis_type_selector ) == "simple" and str( $analysis_type.presets ) != "no_presets" ):
83 $analysis_type.presets
84 #elif str( $analysis_type.analysis_type_selector ) == "full":
85 #if str( $analysis_type.input_options.input_options_selector ) == "yes":
86 --skip "${analysis_type.input_options.skip}"
87 --qupto "${analysis_type.input_options.qupto}"
88 --trim5 "${analysis_type.input_options.trim5}"
89 --trim3 "${analysis_type.input_options.trim3}"
90 ${analysis_type.input_options.qv_encoding}
91 ${analysis_type.input_options.solexa-quals}
92 ${analysis_type.input_options.int-quals}
93 #end if
94
95 #if str( $analysis_type.alignment_options.alignment_options_selector ) == "yes":
96 -N "${$analysis_type.alignment_options.N}"
97 -L "${$analysis_type.alignment_options.L}"
98 -i "${$analysis_type.alignment_options.i}"
99 --n_ceil "${$analysis_type.alignment_options.n_ceil}"
100 --dpad "${$analysis_type.alignment_options.dpad}"
101 --gbar "${$analysis_type.alignment_options.gbar}"
102 ${analysis_type.alignment_options.ignore-quals}
103 ${analysis_type.alignment_options.nofw}
104 ${analysis_type.alignment_options.norc}
105 ${analysis_type.alignment_options.no_1mm_upfront}
106 #if str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "end-to-end":
107 --end-to-end
108 --score-min "${$analysis_type.alignment_options.align_mode.core-min}"
109 #elif str( $analysis_type.alignment_options.align_mode.align_mode_selector ) == "local":
110 --local
111 --score-min "${$analysis_type.alignment_options.align_mode.core-min}"
112 #end if
113 #end if
114
115 #if str( $analysis_type.scoring_options.scoring_options_selector ) == "yes":
116 --ma "${analysis_type.scoring_options.ma}"
117 --mp "${analysis_type.scoring_options.mp}"
118 --np "${analysis_type.scoring_options.np}"
119 --rdg "${analysis_type.scoring_options.rdg_read_open},${analysis_type.scoring_options.rdg_read_extend}"
120 --rfg "${analysis_type.scoring_options.rfg_ref_open},${analysis_type.scoring_options.rfg_ref_extend}"
121 #end if
122
123 #if str( $analysis_type.reporting_options.reporting_options_selector ) == "k":
124 -k "${analysis_type.reporting_options.k}"
125 #elif str( $analysis_type.reporting_options.reporting_options_selector ) == "a":
126 -a
127 #end if
128
129 #if str( $analysis_type.effort_options.effort_options_selector ) == "yes":
130 -D "${analysis_type.effort_options.D}"
131 -R "${analysis_type.effort_options.R}"
132 #end if
133
134 #if str( $analysis_type.sam_options.sam_options_selector ) == "yes":
135 ${analysis_type.sam_options.no-unal}
136 ${analysis_type.sam_options.omit-sec-seq}
137 #end if
138
139 #if str( $analysis_type.other_options.other_options_selector ) == "yes":
140 ${analysis_type.other_options.reorder}
141 ${analysis_type.other_options.non-deterministic}
142 --seed "${analysis_type.other_options.seed}"
143 #end if
144
145 #elif str( $analysis_type.analysis_type_selector ) == "cline":
146 ${analysis_type.cline}
147 #end if
148
149 ## view/sort and output BAM file
150 | samtools view -Su - | samtools sort -o - - > $output
151
152 ## rename unaligned sequence files
153 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r:
154 #set left = str($output_unaligned_reads_l).replace( '.dat', '.1.dat' )
155 #set right = str($output_unaligned_reads_l).replace( '.dat', '.2.dat' )
156
157 ; mv $left $output_unaligned_reads_l;
158 mv $right $output_unaligned_reads_r
159 #end if
160
161 </command>
162
163 <!-- basic error handling -->
164 <stdio>
165 <exit_code range="1:" level="fatal" description="Tool exception" />
166 </stdio>
167
168 <inputs>
169 <!-- single/paired -->
170 <conditional name="library">
171 <param name="type" type="select" label="Is this single or paired library">
172 <option value="single">Single-end</option>
173 <option value="paired">Paired-end</option>
174 </param>
175
176 <when value="single">
177 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/>
178 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
179 </when>
180 <when value="paired">
181 <param name="input_1" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />
182 <param name="input_2" format="fastqsanger" type="data" label="FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />
183 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc; This triggers --un parameter for single reads and --un-conc for paired reads" />
184 <conditional name="paired_options">
185 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information">
186 <option value="no" selected="True">No</option>
187 <option value="yes">Yes</option>
188 </param>
189 <when value="yes">
190 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
191 <param name="X" type="integer" value="500" min="0" lable="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Deafult=500"/>
192 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriatefor Illumina's Paired-end Sequencing Assay)">
193 <option value="--fr" selected="True">--fr</option>
194 <option value="--rf">--fr</option>
195 <option value="--ff">--ff</option>
196 </param>
197 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
198 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
199 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. See also: `Mates can overlap, contain or dovetail each other` in help section below; default=False"/>
200 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Allow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/>
201 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Allow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. See also: `Mates can overlap, contain or dovetail each other` in help section; default=False"/>
202 </when>
203 <when value="no">
204 <!-- do nothing -->
205 </when>
206 </conditional>
207 </when>
208 </conditional>
209
210 <!-- reference genome -->
211 <conditional name="reference_genome">
212 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below">
213 <option value="indexed">Use a built-in genome index</option>
214 <option value="history">Use a genome from the history and build index</option>
215 </param>
216 <when value="indexed">
217 <param name="index" type="select" label="Select reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
218 <options from_data_table="bowtie2_indexes">
219 <filter type="sort_by" column="2"/>
220 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
221 </options>
222 </param>
223 </when>
224 <when value="history">
225 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select reference genome" />
226 </when>
227 </conditional>
228
229 <!-- read group settings -->
230 <conditional name="read_group">
231 <param name="read_group_selector" type="select" label="Specify the read group for this file?" help="Specifying readgroup information can greatly simplify your downstream analyses by allowing combining multiple datasets. See help below for more details">
232 <option value="yes">Yes</option>
233 <option value="no" selected="True">No</option>
234 </param>
235 <when value="yes">
236 <param name="rgid" type="text" size="25" label="Read group identifier (ID). Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section." help="--rg-id; Required if RG specified. Read group IDs may be modified when merging SAM files in order to handle collisions." />
237 <param name="rglb" type="text" size="25" label="Library name (LB)" help="--rg; Required if RG specified" />
238 <param name="rgpl" type="text" size="25" label="Platform/technology used to produce the reads (PL)" help="--rg; Required if RG specified. Valid values : CAPILLARY, LS454, ILLUMINA, SOLID, HELICOS, IONTORRENT and PACBIO" />
239 <param name="rgsm" type="text" size="25" label="Sample (SM)" help="--rg; Required if RG specified. Use pool name where a pool is being sequenced" />
240 </when>
241 <when value="no" />
242 </conditional>
243
244 <conditional name="analysis_type">
245 <param name="analysis_type_selector" type="select" label="Select analysis mode">
246 <option value="simple">1: Default setting only</option>
247 <option value="full">2: Full parameter list</option>
248 </param>
249 <when value="simple">
250 <param name="presets" type="select" display="radio" label="Do you want to use presets?" help="Allow selecting among several preset parameter settings. Choosing between these will result in dramatic changes in runtime. See help below to understand effects of these presets.">
251 <option value="no_presets" selected="True">No, just use defaults</option>
252 <option value="--very-fast">Very fast end-to-end (--very-fast)</option>
253 <option value="--fast">Fast end-to-end (--fast)</option>
254 <option value="--sensitive">Sensitive end-to-end (--sensitive)</option>
255 <option value="--very-sensitive">Very sensitive end-to-end (--very-sensitive)</option>
256 <option value="--very-fast-local">Very fast local (--very-fast-local)</option>
257 <option value="--fast-local">Fast local (--fast-local)</option>
258 <option value="--sensitive-local">Sensitive local (--sensitive-local)</option>
259 <option value="--very-sensitive-local">Very sensitive local (--very-sensitive-local)</option>
260 </param>
261 </when>
262 <when value="full">
263 <conditional name="input_options">
264 <param name="input_options_selector" type="select" label="Do you want to tweak input options?" help="See &quot;Input Options&quot; section of Help below for information">
265 <option value="yes">Yes</option>
266 <option value="no" selected="true">No</option>
267 </param>
268 <when value="yes">
269 <param name="skip" type="integer" min="0" value="0" lable="Skip (i.e. do not align) the first that many reads or pairs in the input" help="-s/--skip; default=0"/>
270 <param name="qupto" type="integer" min="-1" value="-1" label="Align the first that many reads or read pairs from the input (after the -s/--skip reads or pairs have been skipped), then stop" help="-u/--qupto; default=-1 (no limit)"/>
271 <param name="trim5" type="integer" min="0" value="0" label="Trim that many bases from 5' (left) end of each read before alignment" help="-5/--trim5; default=0"/>
272 <param name="trim3" type="integer" min="0" value="0" label="Trim that many bases from 3' (right) end of each read before alignment" help="-3/--trim3; default=0"/>
273 <param name="qv_encoding" type="select" display="radio" label="Select quality score encoding" help="See help below for more details">
274 <option value="--phred33">Input qualities are ASCII chars equal to the Phred quality plus 33. This is also called the "Phred+33" encoding, which is used by the very latest Illumina pipelines (--phred33)</option>
275 <option value="--phred64" selected="True">Input qualities are ASCII chars equal to the Phred quality plus 64. This is also called the "Phred+64" encoding (--phred64)</option>
276 </param>
277 <param name="solexa-quals" type="boolean" truevalue="--solexa-quals" falsevalue="" checked="False" label="Convert input qualities from Solexa (which can be negative) to Phred (which can't). This scheme was used in older Illumina GA Pipeline versions (prior to 1.3)" help="--solexa-quals; default=False"/>
278 <param name="int-quals" type="boolean" truevalue="--int-quals" falsevalue="" checked="False" label="Quality values are represented in the read input file as space-separated ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters, e.g., II?I.... Integers are treated as being on the Phred quality scale unless --solexa-quals is also specified" help="--int-quals; default=False"/>
279 </when>
280 <when value="no">
281 <!-- do nothing -->
282 </when>
283 </conditional>
284 <conditional name="alignment_options">
285 <param name="alignment_options_selector" type="select" label="Do you want to tweak alignment options?" help="See &quot;Alignment Options&quot; section of Help below for information">
286 <option value="yes">Yes</option>
287 <option value="no" selected="true">No</option>
288 </param>
289 <when value="yes">
290 <param name="N" type="integer" min="0" max="1" value="0" label="Set the number of mismatches to be allowed in a seed alignment during multiseed alignment (see `Multiseed alignment` section of help below)" help="-N; Can be set to 0 or 1. Setting this higher makes alignment slower (often much slower) but increases sensitivity; default=0"/>
291 <param name="L" type="integer" min="0" value="20" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more senstive. Default: the `--sensitive` preset is used by default, which sets `-L` to 20 both in `--end-to-end` mode and in `--local` mode"/>
292 <param name="i" type="text" value="S,1,1.15" size="10" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. See also `Setting function options` below in help section. If the function returns a result less than 1, it is rounded up to 1. Default: the `--sensitive` preset is used by default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` in `--local` mode"/>
293 <param name="n_ceil" type="text" value="`L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. See also: [setting function options]. Reads exceeding this ceiling are [filtered out]. Default=`L,0,0.15`"/>
294 <param name="dpad" type="integer" min="0" value="15" lable="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/>
295 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/>
296 <param name="ignore-quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/>
297 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
298 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/>
299 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help baelow)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the [multiseed heuristic], like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the [multiseed heuristic], which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/>
300 <conditional name="align_mode">
301 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end">
302 <option value="end-to-end" selected="True">End to End (--end-to-end)</option>
303 <option value="local">Local (--local)</option>
304 </param>
305 <when value="end-to-end">
306 <param name="score-min" type="text" value="G,20,8" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
307 </when>
308 <when value="local">
309 <param name="score-min" type="text" value="L,-0.6,-0.6" label="Set a function governing the minimum alignment score needed for an alignment to be considered `valid` (i.e. good enough to report)" help="--score-min; This is a function of read length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and the default in `--local` mode is `G,20,8`"/>
310 </when>
311 </conditional>
312 </when>
313 <when value="no">
314 <!-- do nothing -->
315 </when>
316 </conditional>
317 <conditional name="scoring_options">
318 <param name="scoring_options_selector" type="select" label="Do you want to tweak scoring options?" help="See &quot;Scoring Options&quot; section of Help below for information">
319 <option value="yes">Yes</option>
320 <option value="no" selected="true">No</option>
321 </param>
322 <when value="yes">
323 <param name="ma" type="integer" value="2" label="Set the match bonus" help="--ma; In `--local` mode match bonus is added to the alignment score for each position where a read character aligns to a reference character and the characters match. Not used in `--end-to-end` mode; Default=2"/>
324 <param name="mp" type="text" size="10" value="6,2" label="Set the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers" help="--mp; A number less than or equal to `MX` and greater than or equal to `MN` is subtracted from the alignment score for each position where a read character aligns to a reference character, the characters do not match, and neither is an `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` where Q is the Phred quality value; Default=6,2"/>
325 <param name="np" type="integer" value="1" label="Sets penalty for positions where the read, reference, or both, contain an ambiguous character such as `N`" help="--np; Default=1"/>
326 <param name="rdg_read_open" type="integer" value="5" label="Set the read gap opening penalty" help="--rdg; this is the first component of --rdg flag - opening penalty; Default=5"/>
327 <param name="rdg_read_extend" type="integer" value="3" label="Set the read gap extension penalty" help="--rdg; this is the second component of --rdg flag - extension penalty; Default=3"/>
328 <param name="rfg_ref_open" type="integer" value="5" label="Set the reference gap opening penalty" help="--rfg; this is the first component of --rfg flag - opening penalty; Default=5"/>
329 <param name="rfg_ref_extend" type="integer" value="3" label="Set the reference gap extension penalty" help="--rfg; this is the second component of --rfg flag - extension penalty; Default=3"/>
330 </when>
331 <when value="no">
332 <!-- do nothing -->
333 </when>
334 </conditional>
335 <conditional name="reporting_options">
336 <param name="reporting_options_selector" type="select" label="Do you want to use -a or -k options" help="Make sure you understand implications of setting -k and -a. See &quot;Reporting Options&quot; section of Help below for information on -k and -a options">
337 <option value="no" selected="true">No, do not set</option>
338 <option value="k">Set -k option and enter -k value</option>
339 <option value="a">Set -a option</option>
340 </param>
341 <when value="no">
342 <!-- do nothing -->
343 </when>
344 <when value="-k">
345 <param name="k" type="integer" min="0" value="1" label="Searches for at most that many distinct, valid alignments for each read" help="-k; see detalied description of this option in the help section below. Note: Bowtie 2 is not designed with large values for `-k` in mind, and when aligning reads to long, repetitive genomes large `-k` can be very, very slow"/>
346 </when>
347 <when value="-a">
348 <!-- do nothing here; set -a flag on the command line-->
349 </when>
350 </conditional>
351 <conditional name="effort_options">
352 <param name="effort_options_selector" type="select" label="Do you want to tweak effort options?" help="See &quot;Effort Options&quot; section of Help below for information">
353 <option value="yes">Yes</option>
354 <option value="no" selected="true">No</option>
355 </param>
356 <when value="yes">
357 <param name="D" type="integer" value="15" min="0" label="Attemp that many consecutive seed extension attempts to `fail` before Bowtie 2 moves on, using the alignments found so far" help="-D; A seed extension `fails` if it does not yield a new best or a new second-best alignment. This limit is automatically adjusted up when -k or -a are specified. Default=15"/>
358 <param name="R" type="integer" value="2" min="0" label="Set the maximum number of times Bowtie 2 will `re-seed` reads with repetitive seeds" help="When `re-seeding`, Bowtie 2 simply chooses a new set of reads (same length, same number of mismatches allowed) at different offsets and searches for more alignments. A read is considered to have repetitive seeds if the total number of seed hits divided by the number of seeds that aligned at least once is greater than 300. Default=2"/>
359 </when>
360 <when value="no">
361 <!-- do nothing -->
362 </when>
363 </conditional>
364
365 <conditional name="sam_options">
366 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See &quot;Output Options&quot; section of Help below for information">
367 <option value="yes">Yes</option>
368 <option value="no" selected="true">No</option>
369 </param>
370 <when value="yes">
371 <param name="no-unal" type="boolean" truevalue="--no-unal" falsevalue="" label="Suppress SAM records for reads that failed to align" help="--no-unal; Default=False"/>
372 <param name="omit-sec-seq" type="boolean" truevalue="--omit-sec-seq" falsevalue="" label="Suppress SEQ and QUAL strings for secondary alignments" help="--omit-sec-seq; Default=False"/>
373 </when>
374 <when value="no">
375 <!-- do nothing -->
376 </when>
377 </conditional>
378 <conditional name="other_options">
379 <param name="other_options_selector" type="select" label="Do you want to tweak Other Options?" help="See &quot;Other Options&quot; section of Help below for information">
380 <option value="yes">Yes</option>
381 <option value="no" selected="true">No</option>
382 </param>
383 <when value="yes">
384 <param name="reorder" type="boolean" truevalue="--reorder" falsevalue="" label="Guarantee that output SAM records are printed in an order corresponding to the order of the reads in the original input file" help="--reorder; Default=False"/>
385 <param name="seed" type="integer" value="0" min="0" label="Use this number as the seed for pseudo-random number generator" help="--seed; Default=0"/>
386 <param name="non-deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" label="Re-initialize the pseudo-random generator for each read using the current time" help="--non-deterministic; see Help below for explanation of this option; default=False"/>
387 </when>
388 <when value="no">
389 <!-- do nothing -->
390 </when>
391 </conditional>
392 </when>
393 </conditional>
394 </inputs>
395
396 <!-- define outputs -->
397
398 <outputs>
399
400 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" >
401 <filter>library['unaligned_file'] is True</filter>
402 <actions>
403 <action type="format">
404 <option type="from_param" name="library.input_1" param_attribute="ext" />
405 </action>
406 </actions>
407 </data>
408 <data format="fastqsanger" name="output_unaligned_reads_r" label="${tool.name} on ${on_string}: unaligned reads (R)">
409 <filter>( library['type'] == "paired" or library['type'] == "paired_collection" ) and library['unaligned_file'] is True</filter>
410 <actions>
411 <action type="format">
412 <option type="from_param" name="library.input_1" param_attribute="ext" />
413 </action>
414 </actions>
415 </data>
416
417 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads in BAM format">
418 <actions>
419 <conditional name="reference_genome.source">
420 <when value="indexed">
421 <action type="metadata" name="dbkey">
422 <option type="from_data_table" name="bowtie2_indexes" column="1" offset="0">
423 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
424 <filter type="param_value" ref="reference_genome.index" column="0"/>
425 </option>
426 </action>
427 </when>
428 <when value="history">
429 <action type="metadata" name="dbkey">
430 <option type="from_param" name="reference_genome.own_file" param_attribute="dbkey" />
431 </action>
432 </when>
433 </conditional>
434 </actions>
435 </data>
436 </outputs>
437
438 <tests>
439 <test>
440 <!-- basic test on single paired default run -->
441 <param name="type" value="paired"/>
442 <param name="selection" value="no"/>
443 <param name="paired_options_selector" value="no"/>
444 <param name="unaligned_file" value="false"/>
445 <param name="analysis_type_selector" value="simple"/>
446 <param name="source" value="history" />
447 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
448 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
449 <param name="own_file" value="bowtie2-ref.fasta" />
450 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
451 </test>
452 </tests>
453
454 <help>
455
456 **Bowtie2 Overview**
457
458 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site.
459 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead.
460
461 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/
462 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml
463 .. _`BAM format`: http://samtools.github.io/hts-specs/SAMv1.pdf
464
465 -----
466
467 **Selecting reference genomes for Bowtie2**
468
469 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using **Will you select a reference genome from your history or use a built-in index?** flag. This flag has two options:
470
471 1. **Use a built-in genome index** - when selected (this is default), Galaxy provides the user with **Select reference genome index** dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against.
472 2. **Use a genome from the history and build index** - when selected, Galaxy provides the user with **Select reference genome sequence** dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2.
473
474 If your genome of interest is not listed here you have two choices:
475
476 1. Contact galaxy team using **Help->Support** link at the top of the interface and let us know that an index needs to be added
477 2. Upload your genome of interest as a FASTA file to Galaxy history and selected **Use a genome from the history and build index** option.
478
479 ------
480
481 .. class:: infomark
482
483 **Bowtie2 options**
484
485 Galaxy wrapper for Bowtie2 implements most but not all options available through the command line. Supported options are described below.
486
487 -----
488
489 **Inputs**
490
491 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files.
492
493 ------
494
495 **Input options**::
496
497 -s/--skip &lt;int&gt;
498 Skip (i.e. do not align) the first `&lt;int&gt;` reads or pairs in the input.
499
500 -u/--qupto &lt;int&gt;
501 Align the first `&lt;int&gt;` reads or read pairs from the input (after the
502 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit.
503
504 -5/--trim5 &lt;int&gt;
505 Trim `&lt;int&gt;` bases from 5' (left) end of each read before alignment (default: 0).
506
507 -3/--trim3 &lt;int&gt;
508 Trim `&lt;int&gt;` bases from 3' (right) end of each read before alignment (default: 0).
509
510 --phred33
511 Input qualities are ASCII chars equal to the Phred quality plus 33. This is
512 also called the "Phred+33" encoding, which is used by the very latest Illumina
513 pipelines.
514
515 --phred64
516 Input qualities are ASCII chars equal to the [Phred quality] plus 64. This is
517 also called the "Phred+64" encoding.
518
519 --solexa-quals
520 Convert input qualities from Solexa Phred quality (which can be negative) to
521 Phred Phred quality (which can't). This scheme was used in older Illumina GA
522 Pipeline versions (prior to 1.3). Default: off.
523
524 --int-quals
525 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`....
526 Integers are treated as being on the [Phred quality] scale unless
527 `--solexa-quals` is also specified. Default: off.
528
529 ------
530
531 **Presets in `--end-to-end` mode**::
532
533 --very-fast
534 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50`
535
536 --fast
537 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50`
538
539 --sensitive
540 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode)
541
542 --very-sensitive
543 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
544
545 ------
546
547 **Presets options in `--local` mode**::
548
549 --very-fast-local
550 Same as: `-D 5 -R 1 -N 0 -L 25 -i S,1,2.00`
551
552 --fast-local
553 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,1,1.75`
554
555 --sensitive-local
556 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode)
557
558 --very-sensitive-local
559 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50`
560
561 ------
562
563 **Alignment options**::
564
565 -N &lt;int&gt;
566 Sets the number of mismatches to allowed in a seed alignment during [multiseed
567 alignment]. Can be set to 0 or 1. Setting this higher makes alignment slower
568 (often much slower) but increases sensitivity. Default: 0.
569
570 -L &lt;int&gt;
571 Sets the length of the seed substrings to align during [multiseed alignment].
572 Smaller values make alignment slower but more senstive. Default: the
573 `--sensitive` preset is used by default, which sets `-L` to 20 both in
574 `--end-to-end` mode and in `--local` mode.
575
576 -i &lt;func&gt;
577 Sets a function governing the interval between seed substrings to use during
578 [multiseed alignment]. For instance, if the read has 30 characers, and seed
579 length is 10, and the seed interval is 6, the seeds extracted will be:
580
581 Read: TAGCTACGCTCTACGCTATCATGCATAAAC
582 Seed 1 fw: TAGCTACGCT
583 Seed 1 rc: AGCGTAGCTA
584 Seed 2 fw: CGCTCTACGC
585 Seed 2 rc: GCGTAGAGCG
586 Seed 3 fw: ACGCTATCAT
587 Seed 3 rc: ATGATAGCGT
588 Seed 4 fw: TCATGCATAA
589 Seed 4 rc: TTATGCATGA
590
591 Since it's best to use longer intervals for longer reads, this parameter sets
592 the interval as a function of the read length, rather than a single
593 one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the
594 interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length.
595 See also: [setting function options]. If the function returns a result less than
596 1, it is rounded up to 1. Default: the `--sensitive` preset is used by
597 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75`
598 in `--local` mode.
599
600 --n-ceil &lt;func&gt;
601 Sets a function governing the maximum number of ambiguous characters (usually
602 `N`s and/or `.`s) allowed in a read as a function of read length. For instance,
603 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`,
604 where x is the read length. See also: [setting function options]. Reads
605 exceeding this ceiling are [filtered out]. Default: `L,0,0.15`.
606
607 --dpad &lt;int&gt;
608 "Pads" dynamic programming problems by `&lt;int&gt;` columns on either side to allow
609 gaps. Default: 15.
610
611 --gbar &lt;int&gt;
612 Disallow gaps within `&lt;int&gt;` positions of the beginning or end of the read.
613 Default: 4.
614
615 --ignore-quals
616 When calculating a mismatch penalty, always consider the quality value at the
617 mismatched position to be the highest possible, regardless of the actual value.
618 I.e. input is treated as though all quality values are high. This is also the
619 default behavior when the input doesn't specify quality values (e.g. in `-f`,
620 `-r`, or `-c` modes).
621
622 --nofw/--norc
623 If `--nofw` is specified, `bowtie2` will not attempt to align unpaired reads to
624 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will
625 not attempt to align unpaired reads against the reverse-complement (Crick)
626 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the
627 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those
628 paired-end configurations corresponding to fragments from the reverse-complement
629 (Crick) strand. Default: both strands enabled.
630
631 --no-1mm-upfront
632 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch
633 end-to-end alignment for the read *before* trying the [multiseed heuristic]. Such
634 alignments can be found very quickly, and many short read alignments have exact or
635 near-exact end-to-end alignments. However, this can lead to unexpected
636 alignments when the user also sets options governing the [multiseed heuristic],
637 like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal
638 to the length of the read, the user will be surprised to find 1-mismatch alignments
639 reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end
640 alignments before using the [multiseed heuristic], which leads to the expected
641 behavior when combined with options such as `-L` and `-N`. This comes at the
642 expense of speed.
643
644 --end-to-end
645 In this mode, Bowtie 2 requires that the entire read align from one end to the
646 other, without any trimming (or "soft clipping") of characters from either end.
647 The match bonus `--ma` always equals 0 in this mode, so all alignment scores
648 are less than or equal to 0, and the greatest possible alignment score is 0.
649 This is mutually exclusive with `--local`. `--end-to-end` is the default mode.
650
651 --local
652 In this mode, Bowtie 2 does not require that the entire read align from one end
653 to the other. Rather, some characters may be omitted ("soft clipped") from the
654 ends in order to achieve the greatest possible alignment score. The match bonus
655 `--ma` is used in this mode, and the best possible alignment score is equal to
656 the match bonus (`--ma`) times the length of the read. Specifying `--local`
657 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying
658 the local version of the preset (`--very-fast-local`). This is mutually
659 exclusive with `--end-to-end`. `--end-to-end` is the default mode.
660
661 -----
662
663 **Scoring options**::
664
665 --ma &lt;int&gt;
666 Sets the match bonus. In `--local` mode `&lt;int&gt;` is added to the alignment
667 score for each position where a read character aligns to a reference character
668 and the characters match. Not used in `--end-to-end` mode. Default: 2.
669
670 --mp MX,MN
671 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A
672 number less than or equal to `MX` and greater than or equal to `MN` is
673 subtracted from the alignment score for each position where a read character
674 aligns to a reference character, the characters do not match, and neither is an
675 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`.
676 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )`
677 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2.
678
679 --np &lt;int&gt;
680 Sets penalty for positions where the read, reference, or both, contain an
681 ambiguous character such as `N`. Default: 1.
682
683 --rdg &lt;int1&gt;,&lt;int2&gt;
684 Sets the read gap open (`&lt;int1&gt;`) and extend (`&lt;int2&gt;`) penalties. A read gap of
685 length N gets a penalty of `&lt;int1&gt;` + N * `&lt;int2&gt;`. Default: 5, 3.
686
687 --rfg &lt;int1&gt;,&lt;int2&gt;
688 Sets the reference gap open (`&lt;int1&gt;`) and extend (`&lt;int2&gt;`) penalties. A
689 reference gap of length N gets a penalty of `&lt;int1&gt;` + N * `&lt;int2&gt;`. Default:
690 5, 3.
691
692 --score-min &lt;func&gt;
693 Sets a function governing the minimum alignment score needed for an alignment to
694 be considered "valid" (i.e. good enough to report). This is a function of read
695 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f`
696 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. See also: [setting
697 function options]. The default in `--end-to-end` mode is `L,-0.6,-0.6` and
698 the default in `--local` mode is `G,20,8`.
699
700 -----
701
702 **Reporting options**::
703
704 -k &lt;int&gt;
705 By default, `bowtie2` searches for distinct, valid alignments for each read.
706 When it finds a valid alignment, it continues looking for alignments that are
707 nearly as good or better. The best alignment found is reported (randomly
708 selected from among best if tied). Information about the best alignments is
709 used to estimate mapping quality and to set SAM optional fields, such as
710 `AS:i` and `XS:i`.
711
712 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it
713 searches for at most `&lt;int&gt;` distinct, valid alignments for each read. The
714 search terminates when it can't find more distinct valid alignments, or when it
715 finds `&lt;int&gt;`, whichever happens first. All alignments found are reported in
716 descending order by alignment score. The alignment score for a paired-end
717 alignment equals the sum of the alignment scores of the individual mates. Each
718 reported read or pair alignment beyond the first has the SAM 'secondary' bit
719 (which equals 256) set in its FLAGS field. For reads that have more than
720 `&lt;int&gt;` distinct, valid alignments, `bowtie2` does not guarantee that the
721 `&lt;int&gt;` alignments reported are the best possible in terms of alignment score.
722 `-k` is mutually exclusive with `-a`.
723
724 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when
725 aligning reads to long, repetitive genomes large `-k` can be very, very slow.
726
727 -a
728 Like `-k` but with no upper limit on number of alignments to search for. `-a`
729 is mutually exclusive with `-k`.
730
731 Note: Bowtie 2 is not designed with `-a` mode in mind, and when
732 aligning reads to long, repetitive genomes this mode can be very, very slow.
733
734 -----
735
736 **Effort options**::
737
738 -D &lt;int&gt;
739 Up to `&lt;int&gt;` consecutive seed extension attempts can "fail" before Bowtie 2
740 moves on, using the alignments found so far. A seed extension "fails" if it
741 does not yield a new best or a new second-best alignment. This limit is
742 automatically adjusted up when -k or -a are specified. Default: 15.
743
744 -R &lt;int&gt;
745 `&lt;int&gt;` is the maximum number of times Bowtie 2 will "re-seed" reads with
746 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads
747 (same length, same number of mismatches allowed) at different offsets and
748 searches for more alignments. A read is considered to have repetitive seeds if
749 the total number of seed hits divided by the number of seeds that aligned at
750 least once is greater than 300. Default: 2.
751
752 -----
753
754 **Paired-end options**::
755
756 -I/--minins &lt;int&gt;
757 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is
758 specified and a paired-end alignment consists of two 20-bp alignments in the
759 appropriate orientation with a 20-bp gap between them, that alignment is
760 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not
761 be valid in that case. If trimming options `-3` or `-5` are also used, the
762 `-I` constraint is applied with respect to the untrimmed mates.
763
764 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
765 run. This is because larger differences bewteen `-I` and `-X` require that
766 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
767 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
768 efficient.
769
770 Default: 0 (essentially imposing no minimum)
771
772 -X/--maxins &lt;int&gt;
773 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100`
774 is specified and a paired-end alignment consists of two 20-bp alignments in the
775 proper orientation with a 60-bp gap between them, that alignment is considered
776 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in
777 that case. If trimming options `-3` or `-5` are also used, the `-X`
778 constraint is applied with respect to the untrimmed mates, not the trimmed
779 mates.
780
781 The larger the difference between `-I` and `-X`, the slower Bowtie 2 will
782 run. This is because larger differences bewteen `-I` and `-X` require that
783 Bowtie 2 scan a larger window to determine if a concordant alignment exists.
784 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very
785 efficient.
786
787 Default: 500.
788
789 --fr/--rf/--ff
790 The upstream/downstream mate orientations for a valid paired-end alignment
791 against the forward reference strand. E.g., if `--fr` is specified and there is
792 a candidate paired-end alignment where mate 1 appears upstream of the reverse
793 complement of mate 2 and the fragment length constraints (`-I` and `-X`) are
794 met, that alignment is valid. Also, if mate 2 appears upstream of the reverse
795 complement of mate 1 and all other constraints are met, that too is valid.
796 `--rf` likewise requires that an upstream mate1 be reverse-complemented and a
797 downstream mate2 be forward-oriented. ` --ff` requires both an upstream mate 1
798 and a downstream mate 2 to be forward-oriented. Default: `--fr` (appropriate
799 for Illumina's Paired-end Sequencing Assay).
800
801 --no-mixed
802 By default, when `bowtie2` cannot find a concordant or discordant alignment for
803 a pair, it then tries to find alignments for the individual mates. This option
804 disables that behavior.
805
806 --no-discordant
807 By default, `bowtie2` looks for discordant alignments if it cannot find any
808 concordant alignments. A discordant alignment is an alignment where both mates
809 align uniquely, but that does not satisfy the paired-end constraints
810 (`--fr`/`--rf`/`--ff`, `-I`, `-X`). This option disables that behavior.
811
812 --dovetail
813 If the mates "dovetail", that is if one mate alignment extends past the
814 beginning of the other such that the wrong mate begins upstream, consider that
815 to be concordant. See also: [Mates can overlap, contain or dovetail each
816 other]. Default: mates cannot dovetail in a concordant alignment.
817
818 --no-contain
819 If one mate alignment contains the other, consider that to be non-concordant.
820 See also: [Mates can overlap, contain or dovetail each other]. Default: a mate
821 can contain the other in a concordant alignment.
822
823 --no-overlap
824 If one mate alignment overlaps the other at all, consider that to be
825 non-concordant. See also: [Mates can overlap, contain or dovetail each other].
826 Default: mates can overlap in a concordant alignment.
827
828 ------
829
830 **SAM options**::
831
832 --rg-id &lt;text&gt;
833 Set the read group ID to `&lt;text&gt;`. This causes the SAM `@RG` header line to be
834 printed, with `&lt;text&gt;` as the value associated with the `ID:` tag. It also
835 causes the `RG:Z:` extra field to be attached to each SAM output record, with
836 value set to `&lt;text&gt;`.
837
838 --rg &lt;text&gt;
839 Add `&lt;text&gt;` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the
840 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id`
841 must also be specified. This is because the `ID` tag is required by the [SAM
842 Spec][SAM]. Specify `--rg` multiple times to set multiple fields. See the
843 [SAM Spec][SAM] for details about what fields are legal.
844
845 --omit-sec-seq
846 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ`
847 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix
848 in those fields instead.
849
850 -----
851
852 **Other options**::
853
854 --reorder
855 Guarantees that output SAM records are printed in an order corresponding to the
856 order of the reads in the original input file, even when `-p` is set greater
857 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie
858 2 to run somewhat slower and use somewhat more memory then if `--reorder` were
859 not specified. Has no effect if `-p` is set to 1, since output order will
860 naturally correspond to input order in that case.
861
862 --seed &lt;int&gt;
863 Use `&lt;int&gt;` as the seed for pseudo-random number generator. Default: 0.
864
865 --non-deterministic
866 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It
867 seeds the generator with a number derived from (a) the read name, (b) the
868 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed`
869 option. This means that if two reads are identical (same name, same
870 nucleotides, same qualities) Bowtie 2 will find and report the same alignment(s)
871 for both, even if there was ambiguity. When `--non-deterministic` is specified,
872 Bowtie 2 re-initializes its pseudo-random generator for each read using the
873 current time. This means that Bowtie 2 will not necessarily report the same
874 alignment for two identical reads. This is counter-intuitive for some users,
875 but might be more appropriate in situations where the input consists of many
876 identical reads.
877
878 </help>
879 <citations>
880 <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
881 <citation type="doi">10.1038/nmeth.1923</citation>
882 </citations>
883 </tool>