# HG changeset patch
# User serranop
# Date 1379091885 14400
# Node ID fff15877fea719fa01e27a456515996f6090830d
# Parent  7005f3eb8b68a51ca9e91f11328d13de401c78b5
Uploaded tool XML and test data

diff -r 7005f3eb8b68 -r fff15877fea7 INSTALL
diff -r 7005f3eb8b68 -r fff15877fea7 README
diff -r 7005f3eb8b68 -r fff15877fea7 test-data/fastq_mergepairs_input1.fq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_mergepairs_input1.fq	Fri Sep 13 13:04:45 2013 -0400
@@ -0,0 +1,12 @@
+@IRIS:7:1:29:952#0/1
+TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG
++IRIS:7:1:29:952#0/1
+aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa``
+@IRIS:7:14:818:1331#0/1
+TTGGTTAGTGTTTTGGAGTCAAATATGACTTGATGT
++IRIS:7:14:818:1331#0/1
+aabb^a`a\`^aaa`_]_]]`aa`a_`\[__[]`[[
+@IRIS:7:1:17:394#0/1
+GTCAGGACAAGAAAGACAANTCCAATTNACATTATG
++IRIS:7:1:17:394#0/1
+aaabaa`]baaaaa_aab]D^^`b`aYDW]abaa`^
diff -r 7005f3eb8b68 -r fff15877fea7 test-data/fastq_mergepairs_input2.fq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_mergepairs_input2.fq	Fri Sep 13 13:04:45 2013 -0400
@@ -0,0 +1,12 @@
+@IRIS:7:1:29:952#0/2
+GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT
++IRIS:7:1:29:952#0/2
+aaaabaaaabaaaabbaaaa````__`__^__``__
+@IRIS:7:14:818:1331#0/2
+CGTACACATGACATCAAGTCATATTTGACTCCAAAA
++IRIS:7:14:818:1331#0/2
+abababababbabaabba_`aabaaaa`````aaaa
+@IRIS:7:1:17:394#0/2
+NTTTTCTATTAATACTCNCGNTTTGNGNNANAATCC
++IRIS:7:1:17:394#0/2
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
diff -r 7005f3eb8b68 -r fff15877fea7 test-data/fastq_mergepairs_output.fq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_mergepairs_output.fq	Fri Sep 13 13:04:45 2013 -0400
@@ -0,0 +1,8 @@
+@IRIS:7:1:29:952#0/1
+TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC
++
+aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa
+@IRIS:7:14:818:1331#0/1
+TTGGTTAGTGTTTTGGAGTCAAATATGACTTGATGTCATGTGTACG
++
+aabb^a`a\`JJJJJJJJJJJJJJJJJJJJJJJJJJbababababa
diff -r 7005f3eb8b68 -r fff15877fea7 usearch_fastq_mergepairs.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/usearch_fastq_mergepairs.xml	Fri Sep 13 13:04:45 2013 -0400
@@ -0,0 +1,81 @@
+<tool id="usearch_fastq_mergepairs" name="usearch fastq_mergepairs" version="0.0.1">
+    <description>merging of paired reads</description>
+    <version_command>usearch -version</version_command>
+    <command interpreter='bash'>usearch
+        -fastq_mergepairs '$input_forward'
+        -reverse '$input_reverse'
+        -fastq_qmaxout $qmaxout
+        -fastqout '$output'
+    </command>
+    <inputs>
+        <param name='input_forward' type='data' format='fastq,fastqsanger,fastqcssanger' label='The FASTQ filename for the forward reads' />
+        <param name='input_reverse' type='data' format='fastq,fastqsanger,fastqcssanger' label='The FASTQ filename for the reverse reads' />
+        <param name='qmaxout' type='integer' value='41' label='Maximum Q score (input files).' />
+    </inputs>
+    <outputs>
+        <data name='output' format='fastq' label="Merge result" />
+    </outputs>
+    <tests>
+        <test>
+          <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastqsanger" />
+          <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastqsanger" />
+          <param name="qmaxout" value="65" />
+          <output name="output" file="fastq_mergepairs_output.fq" />
+        </test>
+    </tests>
+    <help>
+**What it Does**
+
+Performs merging of paired reads.
+
+The FASTQ filename for the forward reads is specified by the -fastq_mergepairs option, and the reverse read filename is specified by the -reverse option. Output files are specified by -fastqout (for FASTQ) and / or -fastaout (for FASTA).
+
+Forward and reverse must be in 1:1 correspondence and must appear in the same order in both files. The labels for the forward and reverse read in a given pair must be identical except for a single position where a '1' appears in the forward read label and a '2' appears in the reverse read label.
+
+-----
+
+**Input formats**
+
+Forward read::
+
+    @IRIS:7:1:29:952#0/1
+    TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG
+    +IRIS:7:1:29:952#0/1
+    aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa``
+
+Reverse read::
+
+    @IRIS:7:1:29:952#0/2
+    GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT
+    +IRIS:7:1:29:952#0/2
+    aaaabaaaabaaaabbaaaa````__`__^__``__
+
+-----
+
+**Output**
+
+A multiple-fastq file, for example::
+
+    @IRIS:7:1:29:952#0/1
+    TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC
+    +
+    aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa
+
+------
+
+**Author**
+
+Robert C. Edgar (robert@drive5.com)
+
+**Manual**
+
+http://drive5.com/usearch/manual/fastq_mergepairs.html
+
+**Citation**
+
+Please cite one of these papers if you use USEARCH in published work.
+
+Edgar,RC (2010) Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26(19), 2460-2461.
+doi: 10.1093/bioinformatics/btq461
+    </help>
+</tool>