# HG changeset patch
# User serranop
# Date 1379178952 14400
# Node ID bb844274de30f66f64fba90b999f11db5631d6a0
# Parent  790c5a9be6fceaf17cc8657be79023d7947c584c
Uploaded

diff -r 790c5a9be6fc -r bb844274de30 test-data/fastq_mergepairs_output.fq
--- a/test-data/fastq_mergepairs_output.fq	Sat Sep 14 12:42:37 2013 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,8 +0,0 @@
-@IRIS:7:1:29:952#0/1
-TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC
-+
-aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa
-@IRIS:7:14:818:1331#0/1
-TTGGTTAGTGTTTTGGAGTCAAATATGACTTGATGTCATGTGTACG
-+
-aabb^a`a\`JJJJJJJJJJJJJJJJJJJJJJJJJJbababababa
diff -r 790c5a9be6fc -r bb844274de30 test-data/fastq_mergepairs_output1.fastq
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_mergepairs_output1.fastq	Sat Sep 14 13:15:52 2013 -0400
@@ -0,0 +1,8 @@
+@IRIS:7:1:29:952#0/1
+TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC
++
+aaJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJaa
+@IRIS:7:14:818:1331#0/1
+TTGGTTAGTGTTTTGGAGTCAAATATGACTTGATGTCATGTGTACG
++
+aabb^a`a\`JJJJJJJJJJJJJJJJJJJJJJJJJJbababababa
diff -r 790c5a9be6fc -r bb844274de30 test-data/fastq_mergepairs_output2.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_mergepairs_output2.fasta	Sat Sep 14 13:15:52 2013 -0400
@@ -0,0 +1,2 @@
+>IRIS:7:1:29:952#0/1
+TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAGTC
diff -r 790c5a9be6fc -r bb844274de30 usearch_fastq_mergepairs.xml
--- a/usearch_fastq_mergepairs.xml	Sat Sep 14 12:42:37 2013 -0400
+++ b/usearch_fastq_mergepairs.xml	Sat Sep 14 13:15:52 2013 -0400
@@ -36,45 +36,48 @@
 #end if
     </command>
     <inputs>
-        <!-- INPUT OPTIONS -->
-        <param name="input_forward"		type="data" format="fastq,fastqsanger,fastqcssanger" label="1. File with forward reads" />
-        <param name="input_reverse" 	type="data" format="fastq,fastqsanger,fastqcssanger" label="2. File with reverse reads" />
-        <param name="minovlen" 			type="integer" value="0" label="3. Minimum length of the overlap" help="'0' means no minimum." />
-        <param name="minmergelen" 		type="integer" value="0" label="4. Minimum length of the merged read" help="'0' means no minimum." />
-        <param name="maxmergelen" 		type="integer" value="0" label="5. Maximum length of the merged read" help="'0' means no maximum." />
-        <param name="maxdiffs" 			type="integer" value="0" label="6. Maximum number of mismatches allowed in the overlap region" help="'0' means any number of mismatches allowed." />
-        <param name="truncqual" 		type="integer" value="0" label="7. Truncate the forward and reverse reads at the first Q that is equal or less than this value, if present"
-			   help="'0' means no quality truncation. This truncation is performed before aligning the pair. With Illumina paired reads, it is recommended to set this to 2 or higher, as low-quality tails will otherwise often cause alignment of the pair to fail." />
-        <param name="minlen" 			type="integer" value="0" label="8. Minimum length of the forward and reverse read, after truncating per option 7 if applicable" help="'0' means no minimum." />
+        <param name="input_forward"     type="data" format="fastq,fastqsanger,fastqcssanger" label="1. File with forward reads" />
+        <param name="input_reverse"     type="data" format="fastq,fastqsanger,fastqcssanger" label="2. File with reverse reads" />
+        <param name="minovlen"          type="integer" value="0" label="3. Minimum length of the overlap" help="'0' means no minimum." />
+        <param name="minmergelen"       type="integer" value="0" label="4. Minimum length of the merged read" help="'0' means no minimum." />
+        <param name="maxmergelen"       type="integer" value="0" label="5. Maximum length of the merged read" help="'0' means no maximum." />
+        <param name="maxdiffs"          type="integer" value="0" label="6. Maximum number of mismatches allowed in the overlap region" help="'0' means any number of mismatches allowed." />
+        <param name="truncqual"         type="integer" value="0" label="7. Truncate the forward and reverse reads at the first Q that is equal or less than this value, if present"
+               help="'0' means no quality truncation. This truncation is performed before aligning the pair. With Illumina paired reads, it is recommended to set this to 2 or higher, as low-quality tails will otherwise often cause alignment of the pair to fail." />
+        <param name="minlen"            type="integer" value="0" label="8. Minimum length of the forward and reverse read, after truncating per option 7 if applicable" help="'0' means no minimum." />
         <param name="allowmergestagger" type="boolean" truevalue="-fastq_allowmergestagger" falsevalue="" checked="false" label="9. Allow merge of a pair where the alignment is staggered" help="By default, pairs with staggered alignments are discarded." />
-        <param name="ascii"	 			type="integer" value="33" label="10. ASCII_BASE constant" help="See http://drive5.com/usearch/manual/fastq_params.html" />
-        <param name="qmin" 				type="integer" value="0" label="11. Minimum Q score" />
-        <param name="qmax" 				type="integer" value="41" label="12. Maximum Q score for input files" />
-        <param name="qmaxout" 			type="integer" value="41" label="13. Maximum Q score for output files" />
-        <conditional name="cond_format">
-            <param name="out_format" type="select" label="Output format">
-                <option value="fastq" selected="true">FASTQ</option>
-                <option value="fasta">FASTA</option>
-            </param>
-            <when value="fastq"></when>
-            <when value="fasta"></when>
-        </conditional>
+        <param name="ascii"             type="integer" value="33" label="10. ASCII_BASE constant" help="See http://drive5.com/usearch/manual/fastq_params.html" />
+        <param name="qmin"              type="integer" value="0" label="11. Minimum Q score" />
+        <param name="qmax"              type="integer" value="41" label="12. Maximum Q score for input files" />
+        <param name="qmaxout"           type="integer" value="41" label="13. Maximum Q score for output files" />
+        <param name="out_format" type="select" label="Output format">
+            <option value="fastq">FASTQ</option>
+            <option value="fasta">FASTA</option>
+        </param>
    </inputs>
     <outputs>
-		<data format="fastq" name="output" label="Merge output">
-			<change_format>
-				<when input="out_format" value="fasta" format="fasta" />
-			</change_format>
-		</data>
+        <data format="fastq" name="output" label="Merge output">
+            <change_format>
+                <when input="out_format" value="fasta" format="fasta" />
+            </change_format>
+        </data>
     </outputs>
     <tests>
         <test>
-          <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastqsanger" />
-          <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastqsanger" />
+          <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastq" />
+          <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastq" />
           <param name="qmax" value="65" />
-          <output name="output" file="fastq_mergepairs_output.fq" />
+          <output name="output" file="fastq_mergepairs_output1.fastq" />
         </test>
-    </tests>
+        <test>
+          <param name="input_forward" value="fastq_mergepairs_input1.fq" ftype="fastq" />
+          <param name="input_reverse" value="fastq_mergepairs_input2.fq" ftype="fastq" />
+          <param name="minovlen" value="30" />
+          <param name="qmax" value="65" />
+          <param name="out_format" value="fasta" />
+          <output name="output" file="fastq_mergepairs_output2.fasta" />
+        </test>
+   </tests>
     <help>
 **What it Does**
 
@@ -89,14 +92,14 @@
 
 **Input formats**
 
-Forward read::
+Forward reads::
 
     @IRIS:7:1:29:952#0/1
     TGAGAAGCAAGAAGAAGGTTGGTTAGTGTTTTGGAG
     +IRIS:7:1:29:952#0/1
     aaabaaaaaaaaaaa`aaY`aa^aaa^a_a_`aa``
 
-Reverse read::
+Reverse reads::
 
     @IRIS:7:1:29:952#0/2
     GACTCCAAAACACTAACCAACCTTCTTCTTGCTTCT
@@ -118,7 +121,7 @@
 
 **Manual**
 
-* USEARCH fastq_mergepairs command options: http://drive5.com/usearch/manual/fastq_mergepairs.html
+* USEARCH fastq_mergepairs options: http://drive5.com/usearch/manual/fastq_mergepairs.html
 * FASTQ format options: http://drive5.com/usearch/manual/fastq_params.html
 
 **Citation**