Mercurial > repos > saskia-hiltemann > mothur_align_check

view test-data/sample2.fa @ 4:876b0d452a88 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 568023f8019f928a6f335951806c0c4a03f21320-dirty
author saskia-hiltemann
date Tue, 07 Jun 2016 06:06:45 -0400
parents 48b3a755bd02
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC