Mercurial > repos > sanbi-uwc > mothur_test

diff tools/mothur/test-data/sample3.fa @ 0:ee4fee239fe7 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit 68a4fd4cc5332c57ac39bef73db224425af0706c-dirty
author sanbi-uwc
date Fri, 03 Jun 2016 09:32:47 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tools/mothur/test-data/sample3.fa	Fri Jun 03 09:32:47 2016 -0400
@@ -0,0 +1,6 @@
+> seq1 This is the description of my first sequence in sample 3.
+AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
+> seq2 This is a description of my second sequence in sample 3.
+CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
+> seq3 This is a description of my third sequence in sample 3.
+CGATCGATCGTACGTCGACTAGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGCGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG