Mercurial > repos > sanbi-uwc > mothur_test
diff tools/mothur/test-data/sample1.fa @ 0:ee4fee239fe7 draft default tip
planemo upload commit 68a4fd4cc5332c57ac39bef73db224425af0706c-dirty
author | sanbi-uwc |
---|---|
date | Fri, 03 Jun 2016 09:32:47 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/mothur/test-data/sample1.fa Fri Jun 03 09:32:47 2016 -0400 @@ -0,0 +1,4 @@ +> seq1 This is the description of my first sequence in sample 1. +AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC +> seq2 This is a description of my second sequence in sample 1. +CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG