comparison TargetFinder.xml @ 1:c69fbd1f8c69 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/targetfinder/ commit fe9dd99a14770b6c5f26e24893599acb577e304f"

0:48aeeeff1977

<tool id="targetfinder" name="Plant small RNA target prediction tool" version="1.7.0">
    <requirements>
        <requirement type="package" version="1.7">targetfinder</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:" />
    </stdio>
    <command><![CDATA[
        targetfinder_threads.pl
            -f $f
            -d $d
            -c $c
            -t "\${GALAXY_SLOTS:-12}"
            $r
            -o $output1
    ]]></command>
    <inputs>
        <param label="Input small RNA sequences file" help="(-f) FASTA-format" name="f" type="data" format="fasta" />
        <param label="Target sequence database file" help="(-d) FASTA-format" name="d" type="data" format="fasta" />
        <param label="Prediction score cutoff value" help="(-c) DEFAULT = 4" name="c" type="float" value="4.0" />
        <param label="Search reverse strand for targets?" help="(-r) Use this option if the database is genomic DNA." name="r" type="boolean" falsevalue="" truevalue="-r" checked="false" />
    </inputs>
    <outputs>
        <data name="output1" format="data"/>
    </outputs>
    <tests>
        <test>
            <param name="f" value="ath_miRNAs_test.fa"/>
            <param name="d" value="Antirrhinum_majus.mRNA.EST.fasta"/>
            <param name="r" value=""/>
            <param name="c" value="4.0"/>
            <param name="t" value="1"/>
            <output name="output1" file="ath_miRNAs_predicted_targets.txt" compare="contains"/>
        </test>
    </tests>
    <help><![CDATA[
**What it does**

TargetFinder will computationally predict small RNA binding sites on target transcripts from a sequence database.

This is done by aligning the input small RNA sequence against all transcripts,
followed by site scoring using a position-weighted scoring matrix.

**Input**

-f Input small RNA sequences file (FASTA-format).

-d Target sequence database file (FASTA-format)

**Output**

Each predicted target site is printed out separately.
The output consists of two parts.

The first is a description line and the second is a base-pairing diagram of the target and small RNA (query) sequence.

The description line contains the query name, the description line from the target sequence database, and the target prediction score.

The base-pairing diagram has the target site sequence on top in 5'-3' orientation and the query sequence on the bottom in 3'-5' orientation.

Between the target site sequece and the query sequence are base pair symbols.

A ":" (colon) symbol represents an ordinary Watson-Crick base pair, a "." (period) represents a G:U base pair, and a " " (space) represents a mismatch.

If a small RNA is predicted to target a sequence more than once, each target site will be output as separate output.
]]></help>
    <citations>
        <citation type="doi">10.1016/j.cell.2005.04.004</citation>
        <citation type="doi">10.1371/journal.pone.0000219</citation>
        <citation type="doi">10.1007/978-1-60327-005-2_4</citation>
    </citations>
</tool>

1:c69fbd1f8c69

<tool id='targetfinder' name='TargetFinder' version='1.7.0+galaxy1' profile='20.01'>
    <description>plant small RNA target prediction tool</description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro='edam' />
    <expand macro='requirements' />
    <stdio>
        <exit_code range='1:' />
    </stdio>
    <command><![CDATA[
        targetfinder_threads.pl
            -f '$f'
            -d '$d'
            -c $c
            -p $output_format
            -t "\${GALAXY_SLOTS:-12}"
            $r
            -o '$output_file'
     
    ]]></command>
    <inputs>
        <param argument='-f' type='data' format='fasta' label='Input small RNA sequences file' help='FASTA-format' />
        <param argument='-d' type='data' format='fasta' label='Target sequence database file' help='FASTA-format' />
        <param argument='-c' type='float' value='4.0' label='Prediction score cutoff value' help='Predicted targets are printed out if they are equal to or lower than the cutoff score specified. DEFAULT = 4' />
        <param argument='-c' type='float' value='4.0' label='Prediction score cutoff value' help='Predicted targets are printed out if they are equal to or lower than the cutoff score specified. DEFAULT = 4' />
        <param argument='-r' type='boolean' falsevalue='' truevalue='-r' checked='false' label='Search reverse strand for targets?' help='Use this option if the database is genomic DNA.'  />
        <param name='output_format' argument='-p' type='select' label='Output format' help='Output format for small RNA-target pairs (Default = classic).' >
                <option value='classic'>Original TargetFinder base-pair format</option>
                <option value='gff'>GFF</option>
                <option value='json'>JavaScript Object Notation (JSON)</option>
                <option value='table'>Tab-delimited format</option>
        </param>
    </inputs>
    <outputs>
        <data name='output_file' format='txt'>
            <change_format>
                <when input="output_format" value="gff" format="gff" />
                <when input="output_format" value="json" format="json" />
                <when input="output_format" value="table" format="tabular" />
            </change_format>
        </data>
    </outputs>
    <tests>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='false'/>
            <param name='c' value='4.0'/>
            <param name='output_format' value='classic'/>
            <output name='output_file' file='targetfinder_test_01.txt' compare='contains'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='true'/>
            <param name='c' value='4.0'/>
            <param name='output_format' value='classic'/>
            <output name='output_file' file='targetfinder_test_02.txt' compare='contains'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='false'/>
            <param name='c' value='6.0'/>
            <param name='output_format' value='classic'/>
            <output name='output_file' file='targetfinder_test_03.txt' compare='contains'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='false'/>
            <param name='c' value='4.0'/>
            <param name='output_format' value='classic'/>
            <output name='output_file' file='targetfinder_test_04.txt' compare='contains'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='false'/>
            <param name='c' value='4.0'/>
            <param name='output_format' value='gff'/>
            <output name='output_file' file='targetfinder_test_05.gff' compare='contains'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='false'/>
            <param name='c' value='4.0'/>
            <param name='output_format' value='table'/>
            <output name='output_file' file='targetfinder_test_06.tab' compare='contains'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='false'/>
            <param name='c' value='4.0'/>
            <param name='output_format' value='json'/>
            <output name='output_file' file='targetfinder_test_07.json' compare='contains' lines_diff='1'/>
        </test>
        <test>
            <param name='f' value='arabidopsis_thaliana_miRNA.fasta'/>
            <param name='d' value='arabidopsis_thaliana_mRNA.fasta'/>
            <param name='r' value='true'/>
            <param name='c' value='6.5'/>
            <param name='output_format' value='table'/>
            <output name='output_file' file='targetfinder_test_08.tab' compare='contains'/>
        </test>
    </tests>
    <help><![CDATA[
.. class:: infomark

**What it does**

TargetFinder will computationally predict small RNA binding sites on target transcripts from a sequence database.

This is done by aligning the input small RNA sequence against all transcripts, followed by site scoring using a position-weighted scoring matrix.

----

.. class:: infomark

**Input**

This tool requires two fasta files:

    ::

        -f Input small RNA sequences file (FASTA-format).
        -d Target sequence database file (FASTA-format)

----

.. class:: infomark

**Original TargetFinder Output**


Each predicted target site is printed out separately. 

The output consists of two parts. The first is a description line and the second is a base-pairing diagram of the target and small RNA (query) sequence. The description line contains the query name, the description line from the target sequence database, and the target prediction score.

    ::

            query=miR399a, target=AT2G33770.1 | Symbol: None |  ubiquitin-conjugating enzyme family protein, low similarity to u, score=1.5


The base-pairing diagram has the target site sequence on top in 5'-3' orientation and the query sequence on the bottom in 3'-5' orientation. Between the target site sequece and the query sequence are base pair symbols. A ':' (colon) symbol represents an ordinary Watson-Crick base pair, a '.' (period) represents a G:U base pair, and a ' ' (space) represents a mismatch.

    ::
        
        target  5' UAGGGCAAAUCUUCUUUGGCA 3'  
                   .:::::::::::.::::::::  
        query   3' GUCCCGUUUAGAGGAAACCGU 5'


If a small RNA is predicted to target a sequence more than once, each target site will be output as separate output.


----

.. class:: infomark

**Additional output formats**

In addition to the output described above ('classic' output), three new output format options were added to TargetFinder.

Generic Feature Format (GFF3):

    ::

        AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN  targetfinder  rna_target  607 627 1.5 + . smallRNA=miR399a;target_seq=UAGGGCAAAUCUUCUUUGGCA;base_pairs=.:::::::::::.::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU
        AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN  targetfinder  rna_target  740 760 1.5 + . smallRNA=miR399a;target_seq=UAGGGCAUAUCUCCUUUGGCA;base_pairs=.:::::: :::::::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU
        AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN  targetfinder  rna_target  829 849 1.5 + . smallRNA=miR399a;target_seq=UUGGGCAAAUCUCCUUUGGCA;base_pairs=. :::::::::::::::::::;miR_seq=GUCCCGUUUAGAGGAAACCGU


Tab-deliminated Format:

    ::

        miR399a	AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN	607	627	+	1.5	UAGGGCAAAUCUUCUUUGGCA	.:::::::::::.::::::::	GUCCCGUUUAGAGGAAACCGU
        miR399a	AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN	740	760	+	1.5	UAGGGCAUAUCUCCUUUGGCA	.:::::: :::::::::::::	GUCCCGUUUAGAGGAAACCGU
        miR399a	AT2G33770.1 | Symbols: UBC24 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN	829	849	+	1.5	UUGGGCAAAUCUCCUUUGGCA	. :::::::::::::::::::	GUCCCGUUUAGAGGAAACCGU

JavaScript Object Notation Format (JSON):

    ::

        {
            'miR399a': {
                'hits' : [
                    {
                        'Target accession': 'AT2G33770.1 | Symbols: UBC24, ATUBC24, PHO2 | phosphate 2 | chr2:14277558-14283040 REVERSE LEN',
                        'Score': '1.5',
                        'Coordinates': '607-627',
                        'Strand': '+',
                        'Target sequence': 'UAGGGCAAAUCUUCUUUGGCA',
                        'Base pairing': '.:::::::::::.::::::::',
                        'amiRNA sequence': 'GUCCCGUUUAGAGGAAACCGU'
                    }
                ]
            }
        }


----

.. class:: infomark

**Method**

TargetFinder searches for potential miRNA target sites in a FASTA-formated sequence database using three main steps.


        1. The small RNA query sequence is aligned to every sequence in the FASTA-formated sequence database using `Smith-Waterman (SW) alignments <https://en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm>`_ implemented in the FASTA package (ssearch35_t).
        2. The SW alignments are converted into RNA duplexes.
        3. Each duplex is scored using a position-dependent scoring matrix.

SW alignments are used to identify the best complementary regions between the small RNA query sequence and every sequence in the FASTA-formated sequence database.

]]></help>
    <expand macro='citations' />
</tool>