changeset 0:01f42efba177 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/remurna commit 6e51a331dbeab2786d8df5fd379ae3a63eb61d83
author rnateam
date Tue, 13 Dec 2016 11:47:56 -0500
parents
children
files create_input_file.py remurna.xml test-data/generated_input_file_example.fa test-data/output.tabular test-data/seq.fa test-data/snp.txt
diffstat 6 files changed, 145 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/create_input_file.py	Tue Dec 13 11:47:56 2016 -0500
@@ -0,0 +1,13 @@
+import sys
+import os
+wild_fa = sys.argv[1]
+snp_tags = sys.argv[2]
+outfile = sys.argv[3]
+# Write RNA sequence and SNP tags to a outfile
+out = open(outfile,'w')
+with open (wild_fa) as in_fa_handle:
+    for line in in_fa_handle:
+        out.write(line)
+with open (snp_tags) as in_snp_handle:
+    out.write('*'+in_snp_handle.readline())
+out.close()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/remurna.xml	Tue Dec 13 11:47:56 2016 -0500
@@ -0,0 +1,124 @@
+<tool id="remurna" name="remuRNA" version="1.0.0">
+    <description>Measurement of Single Nucleotide Polymorphism induced Changes of RNA Conformation</description>
+    <requirements>
+        <requirement type="package" version="1.0">remurna</requirement>
+    </requirements>
+    <stdio>
+        <exit_code range="1:" />
+    </stdio>
+    <command><![CDATA[
+    touch input.fa &&
+    python $__tool_directory__/create_input_file.py '$seq' '$snp' input.fa &&
+    \$(which remuRNA)
+            --proc="\${GALAXY_SLOTS}" ## number of CPUs
+            --window=$window
+            #if $advanced.advanced_selector =="advanced"
+                --NA=$advanced.NA
+                #if $advanced.energy == "abs_sig"
+                    --energy='|sig|'
+                #else
+                    --energy='sig'
+                #end if
+                --tmin=$advanced.tmin
+                --tinc=$advanced.tinc
+                --tmax=$advanced.tmax
+                #if $advanced.suffix
+                    --suffix='$advanced.suffix'
+                #end if
+                --log=$advanced.log
+                #if $advanced.sodium
+                    --sodium=$advanced.sodium
+                #end if
+                #if $advanced.magnesium
+                    --magnesium=$advanced.magnesium
+                #end if
+                $advanced.polymer
+                $advanced.zip
+                $advanced.mutations
+                $advanced.nodangle
+            #end if
+            input.fa
+        > '$outfile'
+    ]]></command>
+    <inputs>
+        <param argument="--seq" type="data" format="fasta" label="Input Alignment File" />
+        <param argument="--snp" type="data" format="txt"  label="SNP"  help="remuRNA accepts only a single tag in each call."/>
+        <param argument="--window" type="integer"  value="200" min="1" label="Windows size" help="Compute average distance over windows of size winsize."/>
+
+        <conditional name="advanced">
+            <param name="advanced_selector" type="select" label="Advanced Options">
+                <option value="basic">Basic options</option>
+                <option value="advanced">Advanced options</option>
+            </param>
+            <when value="basic"></when>
+            <when value="advanced">
+                <param argument="--NA" type="select" label="RNA or DNA">
+                    <option value="RNA" selected="true">RNA sequence</option>
+                    <option value="DNA">DNA sequence</option>
+                </param>
+                <param argument="--energy" type="select" label="Energy">
+                    <option value="abs_sig" selected="true">|sig|</option>
+                    <option value="sig">sig</option>
+                </param>
+
+                <param argument="--tmin" type="float" value="37.0" label="Min temperature [°C]" help=""/>
+                <param argument="--tmax" type="float" value="37.0" label="Max temperature [°C]" help=""/>
+                <param argument="--tinc" type="float" value="1.0" label="Temperature increment [°C]" help=""/>
+
+                <param argument="--suffix" type="text" optional="true" label="Suffix" />
+
+
+                <param argument="--sodium" type="float" optional="true" label="Salt concentration" help=""/>
+                <param argument="--magnesium" type="float" optional="true" label="Magnesium concentration" help=""/>
+                <param argument="--mutations" type="boolean" truevalue="--mutations" falsevalue="" checked="false"  label="Compute relative entropy for all ppossible point mutations" help=""/>
+                <param argument="--nodangle" type="boolean" truevalue="" falsevalue="--nodangle" checked="true"  label="Include dangling energies" help="default, dangling energies will be added for the bases adjacent to a helix on both sides in any case"/>
+                <param argument="--polymer" type="boolean" truevalue="--polymer" falsevalue="" checked="false"  label="Polymer" help=""/>
+                <param argument="--zip" type="boolean" truevalue="--zip" falsevalue="" checked="false"  label="Zip" help=""/>
+                <param argument="--log" type="select" label="Log level">
+                    <option value="0">0: OFF</option>
+                    <option value="1" selected="true">1: Errors</option>
+                    <option value="2">2: Warnings</option>
+                    <option value="3">3: Info</option>
+                    <option value="4">4: Debug</option>
+                    <option value="5">5: All</option>
+                </param>
+            </when>
+        </conditional>
+
+    </inputs>
+
+    <outputs>
+         <data name="outfile" format="tabular" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="seq" value="seq.fa"/>
+            <param name="snp" value="snp.txt"/>
+            <output name="outfile" file="output.tabular"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+**What it does**
+
+ Measurement of Single-Nucleotide Polymorphism-induced Changes of RNA Conformation
+
+Single-nucleotide polymorphisms (SNPs) are often linked to critical phenotypes such as diseases or responses to vaccines, medications and environmental factors. However, the specific molecular mechanisms by which a causal SNP acts is usually not obvious. Changes in RNA secondary structure emerge as a possible explanation necessitating the development of methods to measure the impact of single-nucleotide variation on RNA structure. To answer this need, remuRNA commutes the relative entropy between the Boltzmann ensembles of the native and a mutant structure.
+
+**Input**
+
+1.  Sequence file: must contain one sequence in Fasta format.
+
+2.  SNP file: must contain only one tag
+
+
+**Output**.
+
+SNP	MFE(wt)	MFE(mu)	dMFE	H(wt||mu)	GCratio
+
+A23G	-15.600	-16.000	0.400	0.877	0.336066
+    ]]></help>
+
+    <citations>
+        <citation type="doi">10.1093/nar/gks1009</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/generated_input_file_example.fa	Tue Dec 13 11:47:56 2016 -0500
@@ -0,0 +1,3 @@
+>TEST
+ccactttcacaatctgctagcaaaggttatgcagctaactaatcactttcccatcttttgttagatttgaatatatacattctatgatcattgctttttctctttacaggggagaatttcat
+*a23g
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output.tabular	Tue Dec 13 11:47:56 2016 -0500
@@ -0,0 +1,2 @@
+SNP	MFE(wt)	MFE(mu)	dMFE	H(wt||mu)	GCratio
+A23G	-15.600	-16.000	0.400	0.877	0.336066
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seq.fa	Tue Dec 13 11:47:56 2016 -0500
@@ -0,0 +1,2 @@
+>TEST
+ccactttcacaatctgctagcaaaggttatgcagctaactaatcactttcccatcttttgttagatttgaatatatacattctatgatcattgctttttctctttacaggggagaatttcat
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/snp.txt	Tue Dec 13 11:47:56 2016 -0500
@@ -0,0 +1,1 @@
+a23g