# HG changeset patch
# User rnateam
# Date 1424969689 18000
# Node ID f334718d8063aa81de5a757524d79ba7a7bf4b6c
Uploaded
diff -r 000000000000 -r f334718d8063 kinwalker.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/kinwalker.xml Thu Feb 26 11:54:49 2015 -0500
@@ -0,0 +1,145 @@
+
+
+
+
+
+ kinwalker
+ gnu_coreutils
+ vienna_rna
+
+
+ seq.ident
+ &&
+ sed '1d' $input_sequence > input.seq
+ &&
+ kinwalker
+ $init_structure
+ $interrupt
+ ##$printfront
+
+ --barrier_heuristic $barrier_heuristic.used
+
+ #if $barrier_heuristic.used == "M"
+ --grouping $barrier_heuristic.grouping
+ --lookahead $barrier_heuristic.lookahead
+ #else if $barrier_heuristic.used == "B"
+ --maxkeep $barrier_heuristic.maxkeep
+ #end if
+
+ --dangle $dangle
+ --noLonelyPairs $noLonelyPairs
+ --transcribed $transcribed
+ --transcription_rate $transcription_rate
+ --windowsize $windowsize
+
+ < input.seq
+
+ > blah
+
+ &&
+ sed -n '2s/[\.\(\)]\+\s\+\(.\+\)$/ mfe: \1/p' blah > energy
+
+ &&
+ cat seq.ident energy > $mfe_struct
+
+ &&
+ sed -e '2s/^\([\.\(\)]\+\).*$/\1/' -ne '1,2p' blah >> $mfe_struct
+
+ &&
+ sed -e 's/[ \t]*$//' -ne '/TRAJ/,/Kinwal/ {/TRAJ/n;/Kinwal/!{s/\s/\t/gp}}' blah > $trajectory
+]]>
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+100), heuristic approaches have to be employed which explicitly
+construct a (re)folding path between the two structures. The saddle height is then estimated as the highest point along the path.
+The best known algorithm for approximating saddle heights between RNA conformations is the Morgan-Higgs heuristic,
+which tries to find a folding path from an origin secondary structure to a target secondary structure where the maximum height
+along the path is minimal. The heuristic models state transitions at base pair resolution.
+]]>
+
+
+ 10.1016/j.jmb.2008.02.064
+
+
diff -r 000000000000 -r f334718d8063 test-data/mfe_struct.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mfe_struct.fasta Thu Feb 26 11:54:49 2015 -0500
@@ -0,0 +1,3 @@
+>test_seq mfe: -13.6
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
+.(((((((((.......)))))))))........
diff -r 000000000000 -r f334718d8063 test-data/test_sequence.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_sequence.fasta Thu Feb 26 11:54:49 2015 -0500
@@ -0,0 +1,2 @@
+>test_seq
+ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
diff -r 000000000000 -r f334718d8063 test-data/trajectory.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trajectory.tabular Thu Feb 26 11:54:49 2015 -0500
@@ -0,0 +1,10 @@
+..(((....))) -0.4 0.0550686 3.9 6.46108 12
+.((((....)))) -3 0.0600001 5.96046e-09 6.46108 13
+(((((....))))) -4.7 0.065 0 6.46108 14
+(((((....)))))..((((....)))) -5.3 0.135069 3.9 6.46108 28
+(((((....))))).(((((....))))) -5.8 0.14 1.90735e-07 6.46108 29
+(((((....))))).......(((....)))... -6.9 0.17246 6.7 7.46108 34
+(((((....)))))......((((....)))).. -7.8 0.17246 9.53674e-08 7.46108 34
+(((((....))))).....(((((....))))). -10.7 0.17246 1.90735e-07 7.46108 34
+(((((....)))))....((((((....)))))) -13.1 0.17246 -1.90735e-07 7.46108 34
+.(((((((((.......)))))))))........ -13.6 123.457 12.5 13 34
diff -r 000000000000 -r f334718d8063 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Thu Feb 26 11:54:49 2015 -0500
@@ -0,0 +1,38 @@
+
+
+
+
+
+
+
+
+
+
+
+ https://raw.githubusercontent.com/bgruening/download_store/master/kinwalker/kinwalker-patched.tar.gz
+
+
+
+
+
+ make VRNA_INC="-I$ROOT_VIENNA_RNA_DIR/include/ViennaRNA" VRNA_LIB="-L$ROOT_VIENNA_RNA_DIR/lib -lRNA" LDFLAGS="-fopenmp"
+
+ kinwalker
+ $INSTALL_DIR/bin
+
+
+ $INSTALL_DIR/bin
+
+
+
+
+
+The Kinwalker algorithm performs cotranscriptional folding of RNAs,
+starting at a user a specified structure (default: open chain) and
+ending at the minimum free energy structure. Folding events are
+performed between transcription of additional bases and are regulated
+by barrier heights between the source and target structure.
+
+
+
+