comparison test-data/2.cluster.top5.alirna.ps @ 10:a9965909555e draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/GraphClust/CollectResults commit 4406735e44aba20859c252be39f4e99df28c7a92
author rnateam
date Sat, 27 Oct 2018 13:13:33 -0400
parents
children
comparison
equal deleted inserted replaced
9:08a3e826ccd7 10:a9965909555e
1 %!PS-Adobe-3.0 EPSF-3.0
2 %%Creator: ViennaRNA-2.3.1
3 %%CreationDate: Tue May 30 20:24:21 2017
4 %%Title: RNA Secondary Structure Plot
5 %%BoundingBox: 0 0 700 700
6 %%DocumentFonts: Helvetica
7 %%Pages: 1
8 %%EndComments
9
10 %Options: --noLP
11 % to switch off outline pairs of sequence comment or
12 % delete the appropriate line near the end of the file
13
14 %%BeginProlog
15 /RNAplot 100 dict def
16 RNAplot begin
17 /fsize 14 def
18 /outlinecolor {0.2 setgray} bind def
19 /paircolor {0.2 setgray} bind def
20 /seqcolor {0 setgray} bind def
21 /cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
22 /min { 2 copy gt { exch } if pop } bind def
23 /max { 2 copy lt { exch } if pop } bind def
24 /arccoords { % i j arccoords
25 % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
26 % onto the stack
27 dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
28 dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
29 4 -2 roll 5 -1 roll {exch} if 4 2 roll
30 sequence length dup 2 div exch 3 1 roll lt
31 {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
32 { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
33 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
34 exch add 4 -1 roll dup 5 1 roll sub 1 sub
35 5 -1 roll not {4 -2 roll exch 4 2 roll} if
36 }ifelse
37 % compute the scalingfactor and prepare (1-sf) and sf*r
38 2 mul exch cpr 3 1 roll div dup
39 3 -1 roll mul exch 1 exch sub exch
40 % compute the coordinates
41 3 -1 roll 1 sub coor exch get aload pop % get coord for i
42 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
43 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
44 5 -1 roll 1 sub coor exch get aload pop % get coord for j
45 % duplicate j coord
46 dup 3 -1 roll dup 4 1 roll exch 8 2 roll
47 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
48 6 -1 roll mul 5 -1 roll add exch % calculate x2
49 6 -2 roll % reorder
50 } bind def
51 /drawoutline {
52 gsave outlinecolor newpath
53 coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
54 currentdict /cutpoint known % check if cutpoint is defined
55 {coor 0 cutpoint getinterval
56 {aload pop lineto} forall % draw outline of 1st sequence
57 coor cutpoint 1 add get aload pop
58 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence
59 coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
60 {aload pop lineto} forall} % draw outline of 2nd sequence
61 {coor {aload pop lineto} forall} % draw outline as a whole
62 ifelse
63 stroke grestore
64 } bind def
65 /drawpairs {
66 paircolor
67 0.7 setlinewidth
68 [9 3.01] 9 setdash
69 newpath
70 pairs {aload pop
71 currentdict (cpr) known
72 { exch dup
73 coor exch 1 sub get aload pop moveto
74 exch arccoords curveto
75 }
76 { coor exch 1 sub get aload pop moveto
77 coor exch 1 sub get aload pop lineto
78 }ifelse
79 } forall
80 stroke
81 } bind def
82 % draw bases
83 /drawbases {
84 [] 0 setdash
85 seqcolor
86 0
87 coor {
88 aload pop moveto
89 dup sequence exch 1 getinterval cshow
90 1 add
91 } forall
92 pop
93 } bind def
94
95 /init {
96 /Helvetica findfont fsize scalefont setfont
97 1 setlinejoin
98 1 setlinecap
99 0.8 setlinewidth
100 % find the coordinate range
101 /xmax -1000 def /xmin 10000 def
102 /ymax -1000 def /ymin 10000 def
103 coor {
104 aload pop
105 dup ymin lt {dup /ymin exch def} if
106 dup ymax gt {/ymax exch def} {pop} ifelse
107 dup xmin lt {dup /xmin exch def} if
108 dup xmax gt {/xmax exch def} {pop} ifelse
109 } forall
110 /size {xmax xmin sub ymax ymin sub max} bind def
111 /width {xmax xmin sub} bind def
112 /height {ymax ymin sub} bind def
113 10 10 translate
114 680 size 10 add div dup scale
115 size width sub width xmin sub xmax sub add 2 div 5 add
116 size height sub height ymin sub ymax sub add 2 div 5 add
117 translate
118 } bind def
119 end
120 RNAplot begin
121 % extra definitions for standard anotations
122 /min { 2 copy gt { exch } if pop } bind def
123 /BLACK { 0 0 0 } def
124 /RED { 1 0 0 } def
125 /GREEN { 0 1 0 } def
126 /BLUE { 0 0 1 } def
127 /WHITE { 1 1 1 } def
128 /LabelFont { % font size LabelFont
129 exch findfont exch fsize mul scalefont setfont
130 } bind def
131 /Label { % i dx dy (text) Label
132 % write text at base i plus offset dx, dy
133 4 3 roll 1 sub coor exch get aload pop moveto
134 3 1 roll fsize mul exch fsize mul exch rmoveto
135 show
136 } bind def
137 /cmark { % i cmark draw circle around base i
138 newpath 1 sub coor exch get aload pop
139 fsize 2 div 0 360 arc stroke
140 } bind def
141 /gmark { % i j c gmark
142 % draw basepair i,j with c counter examples in gray
143 gsave
144 3 min [0 0.33 0.66 0.9] exch get setgray
145 1 sub dup coor exch get aload pop moveto
146 sequence exch 1 getinterval cshow
147 1 sub dup coor exch get aload pop moveto
148 sequence exch 1 getinterval cshow
149 grestore
150 } bind def
151 /segmark { % f i j lw r g b segmark
152 % mark segment [i,j] with outline width lw and color rgb
153 % use omark and Fomark instead
154 gsave
155 setrgbcolor setlinewidth
156 newpath
157 1 sub exch 1 sub dup
158 coor exch get aload pop moveto
159 currentdict (cpr) known
160 {
161 3 -1 roll dup 4 1 roll dup
162 {
163 3 1 roll dup 3 -1 roll dup
164 4 1 roll exch 5 2 roll exch
165 }
166 {
167 3 1 roll exch
168 } ifelse
169 1 exch { coor exch get aload pop lineto } for
170 {
171 dup 3 1 roll 1 add exch 1 add arccoords pop pop
172 4 2 roll 5 -1 roll coor exch get aload pop curveto
173 } if
174 }
175 {
176 exch 1 exch {
177 coor exch get aload pop lineto
178 } for
179 } ifelse
180 { closepath fill } if stroke
181 grestore
182 } bind def
183 /omark { % i j lw r g b omark
184 % stroke segment [i..j] with linewidth lw, color rgb
185 false 7 1 roll segmark
186 } bind def
187 /Fomark { % i j r g b Fomark
188 % fill segment [i..j] with color rgb
189 % should precede drawbases
190 1 4 1 roll true 7 1 roll segmark
191 } bind def
192 /BFmark{ % i j k l r g b BFmark
193 % fill block between pairs (i,j) and (k,l) with color rgb
194 % should precede drawbases
195 gsave
196 setrgbcolor
197 newpath
198 currentdict (cpr) known
199 {
200 dup 1 sub coor exch get aload pop moveto % move to l
201 dup 1 sub 4 -1 roll dup 5 1 roll 1 sub 1 exch
202 { coor exch get aload pop lineto } for % lines from l to j
203 3 -1 roll 4 -1 roll dup 5 1 roll arccoords curveto % curve from j to i
204 exch dup 4 -1 roll 1 sub exch 1 sub 1 exch
205 { coor exch get aload pop lineto } for % lines from i to k
206 exch arccoords curveto% curve from k to l
207 }
208 { exch 4 3 roll exch 1 sub exch 1 sub dup
209 coor exch get aload pop moveto
210 exch 1 exch { coor exch get aload pop lineto } for
211 exch 1 sub exch 1 sub dup
212 coor exch get aload pop lineto
213 exch 1 exch { coor exch get aload pop lineto } for
214 } ifelse
215 closepath fill stroke
216 grestore
217 } bind def
218 /hsb {
219 dup 0.3 mul 1 exch sub sethsbcolor
220 } bind def
221 /colorpair { % i j hue sat colorpair
222 % draw basepair i,j in color
223 % 1 index 0.00 ne {
224 gsave
225 newpath
226 hsb
227 fsize setlinewidth
228 currentdict (cpr) known
229 {
230 exch dup
231 coor exch 1 sub get aload pop moveto
232 exch arccoords curveto
233 }
234 { 1 sub coor exch get aload pop moveto
235 1 sub coor exch get aload pop lineto
236 } ifelse
237 stroke
238 grestore
239 % } if
240 } bind def
241 end
242
243 %%EndProlog
244 RNAplot begin
245 % data start here
246 /sequence (\
247 ACCAUCCUUUUCUUGGGGUUGCACUACUGUCCAAUGAGCACAUAGUGAGGGCAGUACUGCUAACGCCUACACAACACACCCACAUCAACUAGAGCUUUGC\
248 ) def
249 /coor [
250 [102.77672577 319.04476929]
251 [90.46199799 310.08557129]
252 [82.86160278 296.88882446]
253 [81.29235077 281.74096680]
254 [86.02611542 267.26647949]
255 [96.24275970 255.97311401]
256 [110.17218018 249.81752014]
257 [110.17218018 234.81752014]
258 [110.17218018 219.81752014]
259 [110.17218018 204.81752014]
260 [99.49130249 194.49984741]
261 [99.27762604 179.28770447]
262 [110.17218018 168.15458679]
263 [110.17218018 153.15458679]
264 [110.17218018 138.15458679]
265 [106.02764893 123.73851776]
266 [98.06128693 111.02880096]
267 [89.89822388 98.44451141]
268 [81.54043579 85.98868561]
269 [73.18265533 73.53286743]
270 [64.63217163 61.20853424]
271 [55.89105606 49.01866531]
272 [47.14994049 36.82879639]
273 [32.82023239 30.12281990]
274 [31.69130898 15.27105904]
275 [22.95019341 3.08119035]
276 [14.20907784 -9.10867786]
277 [5.46796179 -21.29854774]
278 [-3.27315354 -33.48841476]
279 [-12.01426888 -45.67828369]
280 [-20.75538445 -57.86815262]
281 [-29.49650002 -70.05802155]
282 [-40.43203354 -69.10051727]
283 [-50.66823959 -72.83345032]
284 [-58.30468369 -80.49013519]
285 [-61.95487976 -90.58245850]
286 [-60.99773407 -101.18975830]
287 [-55.68206024 -110.32431030]
288 [-63.24930573 -123.27563477]
289 [-78.33963013 -128.72189331]
290 [-83.35356903 -143.96131897]
291 [-74.44485474 -157.30351257]
292 [-58.44750214 -158.51351929]
293 [-47.63329697 -146.66308594]
294 [-50.29797745 -130.84288025]
295 [-42.73073578 -117.89155579]
296 [-23.69388771 -114.56418610]
297 [-12.84335899 -98.21372986]
298 [-17.30663109 -78.79914093]
299 [-8.56551647 -66.60926819]
300 [0.17559953 -54.41939926]
301 [8.91671467 -42.22953033]
302 [17.65783119 -30.03966331]
303 [26.39894676 -17.84979439]
304 [35.14006042 -5.65992498]
305 [43.88117599 6.52994347]
306 [57.58565903 12.36401939]
307 [59.33980942 28.08768082]
308 [68.08092499 40.27754974]
309 [76.82203674 52.46741867]
310 [83.39369965 56.13331604]
311 [85.63847351 65.17508698]
312 [93.99625397 77.63090515]
313 [102.35404205 90.08672333]
314 [109.22463226 94.59117126]
315 [110.77100372 103.06243134]
316 [118.73737335 115.77215576]
317 [120.40499115 100.86514282]
318 [126.48009491 87.15043640]
319 [136.39979553 75.89878845]
320 [149.24496460 68.15272522]
321 [163.82543945 64.62996674]
322 [178.79025269 65.65692139]
323 [192.75280762 71.13842010]
324 [204.41941833 80.56658936]
325 [212.70909119 93.06784058]
326 [216.85374451 107.48386383]
327 [216.46936035 122.47894287]
328 [211.59153748 136.66368103]
329 [202.67224121 148.72378540]
330 [190.53790283 157.54182434]
331 [176.31283569 162.30076599]
332 [161.31506348 162.55963135]
333 [146.93423462 158.29446411]
334 [134.50280762 149.90045166]
335 [125.17218018 138.15458679]
336 [125.17218018 153.15458679]
337 [125.17218018 168.15458679]
338 [136.06672668 179.28770447]
339 [135.85304260 194.49984741]
340 [125.17218018 204.81752014]
341 [125.17218018 219.81752014]
342 [125.17218018 234.81752014]
343 [125.17218018 249.81752014]
344 [139.10159302 255.97311401]
345 [149.31823730 267.26647949]
346 [154.05200195 281.74096680]
347 [152.48275757 296.88882446]
348 [144.88235474 310.08557129]
349 [132.56762695 319.04476929]
350 ] def
351 /pairs [
352 [7 94]
353 [8 93]
354 [9 92]
355 [10 91]
356 [13 88]
357 [14 87]
358 [15 86]
359 [16 67]
360 [17 66]
361 [18 64]
362 [19 63]
363 [20 62]
364 [21 60]
365 [22 59]
366 [23 58]
367 [25 56]
368 [26 55]
369 [27 54]
370 [28 53]
371 [29 52]
372 [30 51]
373 [31 50]
374 [32 49]
375 [38 46]
376 [39 45]
377 ] def
378
379 init
380
381 % Start Annotations
382 7 94 0.0 0.6 colorpair
383 8 93 0.0 1 colorpair
384 9 92 0.0 1 colorpair
385 10 91 0.0 1 colorpair
386 13 88 0.0 1 colorpair
387 14 87 0.0 1 colorpair
388 15 86 0.0 1 colorpair
389 16 67 0.0 1 colorpair
390 17 66 0.16 1 colorpair
391 18 64 0.0 1 colorpair
392 19 63 0.0 1 colorpair
393 20 62 0.0 1 colorpair
394 21 60 0.0 1 colorpair
395 22 59 0.0 1 colorpair
396 23 58 0.16 1 colorpair
397 25 56 0.0 1 colorpair
398 26 55 0.0 1 colorpair
399 27 54 0.0 1 colorpair
400 28 53 0.0 1 colorpair
401 29 52 0.0 1 colorpair
402 30 51 0.0 1 colorpair
403 31 50 0.0 1 colorpair
404 32 49 0.16 1 colorpair
405 38 46 0.0 1 colorpair
406 39 45 0.32 1 colorpair
407
408 % End Annotations
409 % switch off outline pairs or bases by removing these lines
410 drawoutline
411 drawpairs
412 drawbases
413 % Start Annotations
414 7 94 1 gmark
415 66 cmark
416 23 cmark
417 32 cmark
418 39 cmark
419 45 cmark
420
421 % End Annotations
422 % show it
423 showpage
424 end
425 %%EOF