comparison test-data/example1_ss.ps @ 0:65fff071414e draft

Uploaded

0:65fff071414e

%!PS-Adobe-3.0 EPSF-3.0
%%Creator: PS_dot.c,v 1.38 2007/02/02 15:18:13 ivo Exp $, ViennaRNA-2.0.4
%%CreationDate: Mon Jan 12 21:39:30 2015
%%Title: RNA Secondary Structure Plot
%%BoundingBox: 66 210 518 662
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: -d2 
% to switch off outline pairs of sequence comment or
% delete the appropriate line near the end of the file

%%BeginProlog
/RNAplot 100 dict def
RNAplot begin
/fsize  14 def
/outlinecolor {0.2 setgray} bind def
/paircolor    {0.2 setgray} bind def
/seqcolor     {0   setgray} bind def
/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
/min { 2 copy gt { exch } if pop } bind def
/max { 2 copy lt { exch } if pop } bind def
/arccoords { % i j arccoords
  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
  % onto the stack
  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
  4 -2 roll 5 -1 roll {exch} if 4 2 roll
  sequence length dup 2 div exch 3 1 roll lt 
  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
    exch add 4 -1 roll dup 5 1 roll sub 1 sub
    5 -1 roll not {4 -2 roll exch 4 2 roll} if
  }ifelse
   % compute the scalingfactor and prepare (1-sf) and sf*r
  2 mul exch cpr 3 1 roll div dup
  3 -1 roll mul exch 1 exch sub exch
   % compute the coordinates
  3 -1 roll 1 sub coor exch get aload pop % get coord for i
  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
  5 -1 roll 1 sub coor exch get aload pop % get coord for j
  % duplicate j coord
  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
  6 -1 roll mul 5 -1 roll add exch % calculate x2
  6 -2 roll % reorder
} bind def
/drawoutline {
  gsave outlinecolor newpath
  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
  currentdict /cutpoint known        % check if cutpoint is defined
  {coor 0 cutpoint getinterval
   {aload pop lineto} forall         % draw outline of 1st sequence
   coor cutpoint 1 add get aload pop
   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
   {aload pop lineto} forall}        % draw outline of 2nd sequence
  {coor {aload pop lineto} forall}   % draw outline as a whole
  ifelse
  stroke grestore
} bind def
/drawpairs {
  paircolor
  0.7 setlinewidth
  [9 3.01] 9 setdash
  newpath
  pairs {aload pop
      currentdict (cpr) known
      { exch dup
        coor  exch 1 sub get aload pop moveto
        exch arccoords curveto
      }
      { coor exch 1 sub get aload pop moveto
        coor exch 1 sub get aload pop lineto
      }ifelse
  } forall
  stroke
} bind def
% draw bases
/drawbases {
  [] 0 setdash
  seqcolor
  0
  coor {
    aload pop moveto
    dup sequence exch 1 getinterval cshow
    1 add
  } forall
  pop
} bind def

/init {
  /Helvetica findfont fsize scalefont setfont
  1 setlinejoin
  1 setlinecap
  0.8 setlinewidth
  72 216 translate
  % find the coordinate range
  /xmax -1000 def /xmin 10000 def
  /ymax -1000 def /ymin 10000 def
  coor {
      aload pop
      dup ymin lt {dup /ymin exch def} if
      dup ymax gt {/ymax exch def} {pop} ifelse
      dup xmin lt {dup /xmin exch def} if
      dup xmax gt {/xmax exch def} {pop} ifelse
  } forall
  /size {xmax xmin sub ymax ymin sub max} bind def
  72 6 mul size div dup scale
  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
  translate
} bind def
end
%%EndProlog
RNAplot begin
% data start here
/sequence (\
AUGCAGGAAAUGCGGGUAGCCGCUGCCGCAAUCGUCUCGGCGAUUGGCGGUAGAGGAAAGUCCAGGCUCGCCCAAGCUGAGAUGCUUGGAGUGUUCGUACCUGGCGCAAGCCAGGGCAAGUGAGGCGCAAGCCUCGCUGACGGCGUGGAAAGGGCUCUCUCUGAGGCCCGAGUACGCUGAAAGUGCCACAGAAACGUAGCUUUUCUGGCGACAGAAAAGAUGGAACGCGGUAAACCCUGCGAGCGAGAAACCCAA\
AUUUGGUAGGGGAACCGUCCUGAAGGAAUCAAACGGAAGGGACGGAUGGUAUCUUCGGAUGCCAUAGAUAGAUGGCUACCGCUCUUGGUGCGAGGGAUACGUCCCGCUUGCAGCACGGGAGAGACAGAACCUGGCUUAUAGCAUUUCCUGCUGGAU\
) def
/coor [
[42.06064606 297.00585938]
[46.61352158 282.17175293]
[59.03635025 272.87374878]
[58.69324493 257.87765503]
[58.35013962 242.88159180]
[58.00703430 227.88551331]
[57.66392899 212.88943481]
[57.32082748 197.89335632]
[56.97772217 182.89727783]
[56.63461685 167.90121460]
[56.29151154 152.90513611]
[55.94840622 137.90905762]
[55.60530090 122.91297913]
[46.82557678 110.75089264]
[32.70000839 105.70427704]
[18.57444000 100.65766144]
[4.44887257 95.61104584]
[-9.94205666 99.84201813]
[-19.08859444 111.73070526]
[-28.23513222 123.61939240]
[-37.38166809 135.50807190]
[-29.15162849 152.90130615]
[-41.59085464 175.22094727]
[-49.80515671 187.77185059]
[-58.01945496 200.32276917]
[-66.23375702 212.87367249]
[-74.44805145 225.42457581]
[-82.66235352 237.97549438]
[-90.82874298 250.55761719]
[-98.94709778 263.17080688]
[-107.06545258 275.78396606]
[-115.18381500 288.39715576]
[-123.30216980 301.01034546]
[-131.42053223 313.62350464]
[-139.53887939 326.23669434]
[-139.78965759 342.63391113]
[-154.24520874 350.37789917]
[-168.03489685 341.50228882]
[-166.97308350 325.13757324]
[-152.15206909 318.11834717]
[-144.03370667 305.50515747]
[-135.91534424 292.89196777]
[-127.79698944 280.27880859]
[-119.67863464 267.66561890]
[-111.56027222 255.05244446]
[-103.44191742 242.43927002]
[-102.47118378 235.17279053]
[-95.21325684 229.76118469]
[-86.99896240 217.21028137]
[-78.78466034 204.65937805]
[-70.57036591 192.10845947]
[-62.35606384 179.55755615]
[-54.14176559 167.00665283]
[-59.68206406 161.95144653]
[-76.30296326 146.78584290]
[-88.05078125 156.11260986]
[-91.30287170 171.82260132]
[-105.67762756 178.94621277]
[-120.14797974 172.01882935]
[-123.61350250 156.35453796]
[-113.41574860 143.96966553]
[-97.37755585 144.36479187]
[-85.62973785 135.03802490]
[-66.41344452 121.66181946]
[-49.27035522 126.36154175]
[-40.12381744 114.47285461]
[-30.97727966 102.58416748]
[-21.83074188 90.69548035]
[-26.24375725 84.63121796]
[-41.16038132 86.21054840]
[-35.06978607 72.50268555]
[-39.48280334 66.43842316]
[-53.60836792 71.48503876]
[-67.73394012 76.53165436]
[-81.85950470 81.57826996]
[-95.98506927 86.62489319]
[-110.11064148 91.67150879]
[-116.64728546 106.06066132]
[-131.47320557 111.53492737]
[-145.79244995 104.84651947]
[-151.10966492 89.96355438]
[-144.27023315 75.71582031]
[-129.33187866 70.55625916]
[-115.15725708 77.54593658]
[-101.03168488 72.49932098]
[-86.90612030 67.45270538]
[-72.78055573 62.40608978]
[-58.65498734 57.35947418]
[-44.52941895 52.31285477]
[-37.56217957 38.52346039]
[-26.96384048 30.84691238]
[-36.73162842 19.46313858]
[-46.49941635 8.07936382]
[-56.26720428 -3.30441141]
[-66.03498840 -14.68818665]
[-75.80278015 -26.07196045]
[-98.98574066 -31.25790787]
[-103.97647858 -53.77650833]
[-115.58070374 -63.28135300]
[-127.18492889 -72.78619385]
[-141.12904358 -78.31444550]
[-156.09373474 -79.34304047]
[-171.05842590 -80.37163544]
[-186.02311707 -81.40023804]
[-200.98780823 -82.42883301]
[-215.47293091 -74.74032593]
[-229.22850037 -83.66873169]
[-228.10395813 -100.02927399]
[-213.25614929 -106.99163055]
[-199.95921326 -97.39352417]
[-184.99452209 -96.36492920]
[-170.02983093 -95.33632660]
[-155.06513977 -94.30773163]
[-140.10044861 -93.27913666]
[-134.25469971 -107.09315491]
[-145.41206360 -117.11877441]
[-156.56942749 -127.14439392]
[-167.72680664 -137.17001343]
[-180.43200684 -145.14358521]
[-194.31199646 -150.83094788]
[-208.19197083 -156.51832581]
[-222.07194519 -162.20570374]
[-235.95191956 -167.89308167]
[-249.83189392 -173.58044434]
[-263.71188354 -179.26782227]
[-277.59185791 -184.95520020]
[-293.76089478 -182.21772766]
[-304.00628662 -195.02258301]
[-297.78839111 -210.19723511]
[-281.50369263 -212.13130188]
[-271.90447998 -198.83517456]
[-258.02450562 -193.14779663]
[-244.14453125 -187.46043396]
[-230.26455688 -181.77305603]
[-216.38456726 -176.08567810]
[-202.50459290 -170.39830017]
[-188.62461853 -164.71093750]
[-174.74464417 -159.02355957]
[-170.33161926 -165.08781433]
[-161.50559998 -177.21635437]
[-157.09257507 -183.28060913]
[-166.77328491 -194.73854065]
[-176.45397949 -206.19645691]
[-186.13467407 -217.65438843]
[-195.81538391 -229.11230469]
[-205.49607849 -240.57023621]
[-215.17678833 -252.02816772]
[-228.76481628 -249.99882507]
[-241.48760986 -254.89045715]
[-250.07904053 -265.33328247]
[-252.38992310 -278.54754639]
[-247.92489624 -291.08288574]
[-257.51794434 -302.61428833]
[-267.11099243 -314.14569092]
[-276.70404053 -325.67709351]
[-284.53216553 -330.22500610]
[-286.32586670 -337.33322144]
[-295.83071899 -348.93743896]
[-305.33557129 -360.54165649]
[-320.04965210 -368.96374512]
[-316.02999878 -385.43426514]
[-299.09036255 -386.13119507]
[-293.73135376 -370.04650879]
[-284.22650146 -358.44229126]
[-274.72164917 -346.83804321]
[-265.17263794 -335.27017212]
[-255.57958984 -323.73873901]
[-245.98654175 -312.20733643]
[-236.39349365 -300.67593384]
[-220.01821899 -302.26220703]
[-205.79644775 -293.66452026]
[-199.46578979 -278.11874390]
[-203.71885681 -261.70886230]
[-194.03816223 -250.25093079]
[-184.35745239 -238.79301453]
[-174.67675781 -227.33508301]
[-164.99606323 -215.87716675]
[-155.31535339 -204.41923523]
[-145.63465881 -192.96131897]
[-141.63436890 -180.67662048]
[-141.60919189 -169.09901428]
[-144.92291260 -159.34556580]
[-150.65541077 -152.25607300]
[-157.70118713 -148.32739258]
[-146.54380798 -138.30177307]
[-135.38644409 -128.27615356]
[-124.22907257 -118.25052643]
[-113.94187164 -129.16719055]
[-99.47093964 -133.11585999]
[-85.06471252 -128.93724060]
[-74.95267487 -117.85813141]
[-72.10356140 -103.13119507]
[-77.35384369 -89.08005524]
[-89.16210175 -79.82991791]
[-104.06160736 -78.09649658]
[-117.68008423 -84.39041901]
[-106.07585907 -74.88557434]
[-94.47164154 -65.38072968]
[-92.45198059 -66.40425110]
[-90.33458710 -67.20630646]
[-89.53431702 -82.18494415]
[-88.73405457 -97.16358185]
[-87.93378448 -112.14221954]
[-87.13351440 -127.12085724]
[-86.33324432 -142.09948730]
[-85.53297424 -157.07812500]
[-84.73271179 -172.05676270]
[-92.64122009 -186.42295837]
[-83.92362213 -200.31307983]
[-67.54782867 -199.43817139]
[-60.35985565 -184.69825745]
[-69.75407410 -171.25650024]
[-70.55434418 -156.27786255]
[-71.35460663 -141.29922485]
[-72.15487671 -126.32058716]
[-72.95514679 -111.34194946]
[-73.75541687 -96.36331177]
[-74.55567932 -81.38467407]
[-75.35594940 -66.40604401]
[-67.97018433 -61.46640778]
[-63.16696167 -53.83242416]
[-61.87234116 -44.77110291]
[-64.41900635 -35.83974838]
[-54.65121460 -24.45597458]
[-44.88342667 -13.07219887]
[-35.11563873 -1.68842399]
[-25.34785271 9.69535065]
[-15.58006573 21.07912636]
[-2.12498283 16.75079727]
[12.84111309 20.26181984]
[24.76665306 31.82793236]
[29.40202522 49.07128906]
[24.23037720 67.45729828]
[9.49548912 81.48547363]
[23.62105751 86.53208923]
[37.74662399 91.57870483]
[51.87219238 96.62532043]
[118.20749664 79.33209991]
[133.13385010 77.84761047]
[148.06022644 76.36312866]
[162.98658752 74.87864685]
[177.91294861 73.39415741]
[192.83930969 71.90967560]
[207.76567078 70.42518616]
[206.81819153 65.40071869]
[207.11807251 59.85226059]
[208.82124329 54.08790207]
[212.00886536 48.45391846]
[216.67895508 43.31697083]
[222.74208069 39.04468155]
[230.02160645 35.98537064]
[238.25845337 34.44812012]
[253.02836609 31.83088112]
[267.79827881 29.21364403]
[282.56817627 26.59640694]
[289.42739868 12.80303001]
[302.93545532 5.77555704]
[317.81539917 8.02305317]
[328.39208984 18.47637749]
[343.16198730 15.85914040]
[357.93188477 13.24190331]
[372.70178223 10.62466621]
[387.47171021 8.00742912]
[402.24160767 5.39019156]
[405.42944336 -14.38106346]
[416.64169312 -31.34718895]
[434.10409546 -42.36170959]
[454.85861206 -45.25786591]
[475.26364136 -39.27045441]
[491.63278198 -25.21584892]
[505.63922119 -30.58424950]
[519.64562988 -35.95264816]
[533.65209961 -41.32104874]
[547.65850830 -46.68944931]
[561.66497803 -52.05784988]
[575.67138672 -57.42624664]
[579.85992432 -73.85271454]
[592.90319824 -84.41780853]
[609.50823975 -85.09050751]
[623.08813477 -75.80330658]
[626.86700439 -90.85321808]
[638.79187012 -100.78182983]
[654.27734375 -101.77139282]
[667.36901855 -93.44140625]
[673.03277588 -78.99491119]
[669.09088135 -63.98688126]
[657.05902100 -54.18821335]
[641.56365967 -53.36669159]
[628.56317139 -61.83821106]
[626.42895508 -48.70367050]
[618.03155518 -38.24233246]
[605.46887207 -33.23781967]
[591.96435547 -35.08874130]
[581.03979492 -43.41981125]
[567.03338623 -38.05141068]
[553.02691650 -32.68301010]
[539.02050781 -27.31461143]
[525.01403809 -21.94621086]
[511.00759888 -16.57781219]
[497.00115967 -11.20941162]
[499.56207275 3.57036328]
[514.55816650 3.91346860]
[529.55426025 4.25657368]
[544.55029297 4.59967899]
[559.54638672 4.94278431]
[574.54248047 5.28588915]
[589.53851318 5.62899446]
[604.53460693 5.97209978]
[618.65295410 -2.37084746]
[632.80242920 5.91910172]
[632.42736816 22.31395912]
[617.91351318 29.94809914]
[604.19152832 20.96817589]
[589.19543457 20.62507057]
[574.19934082 20.28196526]
[559.20324707 19.93885994]
[544.20721436 19.59575462]
[529.21112061 19.25264931]
[514.21502686 18.90954399]
[499.21896362 18.56643867]
[494.37283325 29.36221313]
[487.24349976 38.69115067]
[478.24191284 46.08493042]
[467.87142944 51.18465424]
[456.69982910 53.75814056]
[445.32806396 53.71020508]
[434.35815430 51.08555603]
[424.36123657 46.06418991]
[415.84774780 38.94970322]
[409.24157715 30.15123749]
[404.85882568 20.16009521]
[390.08892822 22.77733231]
[375.31903076 25.39456940]
[360.54913330 28.01180840]
[345.77923584 30.62904549]
[331.00930786 33.24628067]
[324.66851807 46.69739151]
[311.46685791 53.92097092]
[296.36654663 51.96292496]
[285.18539429 41.36631012]
[270.41549683 43.98354721]
[255.64559937 46.60078430]
[240.87568665 49.21802521]
[238.95297241 56.46737671]
[253.93037415 55.64429092]
[259.34143066 69.63430786]
[247.70822144 79.10365295]
[235.10752869 70.96608734]
[233.18479919 78.21543884]
[244.71621704 87.80849457]
[256.24761963 97.40154266]
[267.77902222 106.99459076]
[284.02386475 109.23905945]
[289.95101929 124.52960968]
[279.46316528 137.13662720]
[263.34930420 134.09109497]
[258.18597412 118.52600098]
[246.65457153 108.93295288]
[235.12315369 99.33989716]
[223.59175110 89.74684906]
[209.25015259 85.35155487]
[194.32379150 86.83603668]
[179.39743042 88.32051849]
[164.47106934 89.80500793]
[149.54470825 91.28948975]
[134.61834717 92.77397919]
[119.69197845 94.25846100]
[112.70944977 107.53416443]
[119.94377136 120.67435455]
[126.76836395 126.62311554]
[127.18272400 133.94242859]
[134.31663513 147.13740540]
[141.45056152 160.33238220]
[148.58447266 173.52734375]
[163.93939209 173.87649536]
[177.05422974 181.87004089]
[184.40113831 195.35775757]
[184.00386047 210.71150208]
[175.96923828 223.80122375]
[162.45857239 231.10581970]
[147.10614014 230.66041565]
[134.04167175 222.58480835]
[126.77945709 209.05130005]
[127.27298737 193.70034790]
[135.38949585 180.66125488]
[128.25558472 167.46629333]
[121.12166595 154.27131653]
[113.98775482 141.07635498]
[106.80358124 127.90867615]
[99.56925964 114.76848602]
[92.32728577 116.71883392]
[96.22798157 131.20277405]
[92.36414337 145.69659424]
[81.74404144 135.10346985]
[77.84334564 120.61952972]
[70.60137177 122.56987762]
[70.94448090 137.56594849]
[71.28758240 152.56202698]
[71.63069153 167.55810547]
[71.97379303 182.55418396]
[72.31690216 197.55024719]
[72.66000366 212.54632568]
[73.00311279 227.54240417]
[73.34621429 242.53848267]
[73.68932343 257.53454590]
[74.03242493 272.53063965]
[86.86750793 281.25073242]
[92.09406281 295.86111450]
[87.70237732 310.74374390]
[75.38114166 320.17596436]
[59.86812592 320.53088379]
] def
/pairs [
[3 406]
[4 405]
[5 404]
[6 403]
[7 402]
[8 401]
[9 400]
[10 399]
[11 398]
[12 397]
[13 396]
[14 237]
[15 236]
[16 235]
[17 234]
[18 68]
[19 67]
[20 66]
[21 65]
[23 53]
[24 52]
[25 51]
[26 50]
[27 49]
[28 48]
[29 46]
[30 45]
[31 44]
[32 43]
[33 42]
[34 41]
[35 40]
[55 63]
[56 62]
[72 89]
[73 88]
[74 87]
[75 86]
[76 85]
[77 84]
[91 228]
[92 227]
[93 226]
[94 225]
[95 224]
[96 223]
[98 198]
[99 197]
[100 196]
[101 114]
[102 113]
[103 112]
[104 111]
[105 110]
[115 187]
[116 186]
[117 185]
[118 184]
[119 138]
[120 137]
[121 136]
[122 135]
[123 134]
[124 133]
[125 132]
[126 131]
[141 179]
[142 178]
[143 177]
[144 176]
[145 175]
[146 174]
[147 173]
[152 169]
[153 168]
[154 167]
[155 166]
[157 165]
[158 164]
[159 163]
[200 219]
[201 218]
[202 217]
[203 216]
[204 215]
[205 214]
[206 213]
[207 212]
[238 367]
[239 366]
[240 365]
[241 364]
[242 363]
[243 362]
[244 361]
[252 343]
[253 342]
[254 341]
[255 340]
[259 336]
[260 335]
[261 334]
[262 333]
[263 332]
[264 331]
[270 300]
[271 299]
[272 298]
[273 297]
[274 296]
[275 295]
[276 294]
[280 289]
[301 320]
[302 319]
[303 318]
[304 317]
[305 316]
[306 315]
[307 314]
[308 313]
[349 360]
[350 359]
[351 358]
[352 357]
[368 390]
[369 389]
[371 388]
[372 387]
[373 386]
[374 385]
] def

init

% switch off outline pairs or bases by removing these lines
drawoutline
drawpairs
drawbases
% show it
showpage
end
%%EOF