Mercurial > repos > peterjc > samtools_bam2fq
changeset 3:14ff32f355f0 draft
Uploaded v0.0.2, pair aware bam2fq with pre-sorting
| author | peterjc | 
|---|---|
| date | Tue, 04 Nov 2014 07:11:58 -0500 | 
| parents | 27135d7637b6 | 
| children | 8ac1057b1a7d | 
| files | test-data/sam_spec_padded.bam2fq_pairs.fastq test-data/sam_spec_padded.bam2fq_singles.fastq tools/samtools_bam2fq/README.rst tools/samtools_bam2fq/samtools_bam2fq.xml | 
| diffstat | 4 files changed, 73 insertions(+), 7 deletions(-) [+] | 
line wrap: on
 line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.bam2fq_pairs.fastq Tue Nov 04 07:11:58 2014 -0500 @@ -0,0 +1,4 @@ +>r001/1 +TTAGATAAAGGATACTG +>r001/2 +ATGCCGCTG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sam_spec_padded.bam2fq_singles.fastq Tue Nov 04 07:11:58 2014 -0500 @@ -0,0 +1,8 @@ +>r002 +AAAAGATAAGGATA +>r003 +AGCTAA +>r004 +ATAGCTTCAGC +>ref +AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
--- a/tools/samtools_bam2fq/README.rst Tue Nov 04 06:07:53 2014 -0500 +++ b/tools/samtools_bam2fq/README.rst Tue Nov 04 07:11:58 2014 -0500 @@ -49,6 +49,7 @@ Version Changes ------- ---------------------------------------------------------------------- v0.0.1 - Initial public release, tested with samtools v1.1. +v0.0.2 - Defaults to pair-aware mode which requires pre-sorting by read name. ======= ====================================================================== @@ -61,7 +62,7 @@ For making the "Galaxy Tool Shed" http://toolshed.g2.bx.psu.edu/ tarball use the following command from the Galaxy root folder:: - $ tar -czf samtools_bam2fq.tar.gz tools/samtools_bam2fq/README.rst tools/samtools_bam2fq/samtools_bam2fq.xml tools/samtools_bam2fq/tool_dependencies.xml test-data/sam_spec_padded.bam test-data/sam_spec_padded.sam test-data/sam_spec_padded.depad.bam test-data/sam_spec_padded.bam2fq.fastq test-data/sam_spec_padded.bam2fq_no_suf.fastq + $ tar -czf samtools_bam2fq.tar.gz tools/samtools_bam2fq/README.rst tools/samtools_bam2fq/samtools_bam2fq.xml tools/samtools_bam2fq/tool_dependencies.xml test-data/sam_spec_padded.bam test-data/sam_spec_padded.sam test-data/sam_spec_padded.depad.bam test-data/sam_spec_padded.bam2fq.fastq test-data/sam_spec_padded.bam2fq_no_suf.fastq test-data/sam_spec_padded.bam2fq_singles.fastq test-data/sam_spec_padded.bam2fq_pairs.fastq Check this worked:: @@ -74,6 +75,8 @@ test-data/sam_spec_padded.depad.bam test-data/sam_spec_padded.bam2fq.fastq test-data/sam_spec_padded.bam2fq_no_suf.fastq + test-data/sam_spec_padded.bam2fq_singles.fastq + test-data/sam_spec_padded.bam2fq_pairs.fastq Licence (MIT)
--- a/tools/samtools_bam2fq/samtools_bam2fq.xml Tue Nov 04 06:07:53 2014 -0500 +++ b/tools/samtools_bam2fq/samtools_bam2fq.xml Tue Nov 04 07:11:58 2014 -0500 @@ -1,22 +1,47 @@ -<tool id="samtools_bam2fq" name="Convert BAM to FASTQ" version="0.0.1"> +<tool id="samtools_bam2fq" name="Convert BAM to FASTQ" version="0.0.2"> <description>samtools bam2fq</description> <requirements> <requirement type="binary">samtools</requirement> <requirement type="package" version="1.1">samtools</requirement> </requirements> <version_command>samtools 2>&1 | grep -i "Version:"</version_command> - <command>samtools bam2fq $suffices $orig_qual "$input_bam" > "$out_fastq"</command> + <command> + #if $action_mode.mode == "pairs": + ## Sort by name for pair-aware output (should give nice interlaced FASTQ) + ## Galaxy has a tendancy to automatically apply co-ordindate sorting, + ## so just do this every time. If it was name sorted, pay an IO overhead. + ## Note requiring -T is samtools issue 295 + samtools sort -n -O bam -T TEMP_SORT "$input_bam" | samtools bam2fq -s "$singletons_fastq" - > "$pairs_fastq" + #else + ## Naive conversion using order in the input file + samtools bam2fq $suffices $orig_qual "$input_bam" > "$out_fastq" + #end if + </command> <inputs> - <!-- Unlike other bits of samtools, this seems to autodetect SAM vs BAM --> - <param name="input_bam" type="data" format="bam,sam" label="Input BAM file" /> + <!-- Unlike samtools 0.1.x, samtools 1.1 will autodetect SAM vs BAM --> + <param name="input_bam" type="data" format="bam,sam" label="Input SAM/BAM file" /> <param name="suffices" type="boolean" label="Add /1 and /2 suffices to paired reads?" truevalue="" falsevalue="-n" checked="true" /> <param name="orig_qual" type="boolean" label="Use original qualities (OQ tags) if present?" truevalue="-O" falsevalue="" checked="false" /> - <!-- TODO - new option -s in samtools v1.1 --> + <!-- Using a condition here to allow different output files; default to paired mode --> + <conditional name="action_mode"> + <param name="mode" type="select" label="Mode of action"> + <option value="pairs" selected="true">Sort by name, then divide into paired and singletons (two FASTQ files)</option> + <option value="naive">No pre-sorting, all reads in a single FASTQ file</option> + </param> + </conditional> </inputs> <outputs> - <data name="out_fastq" format="fastqsanger" label="$input_bam.name (bam2fq)" /> + <data name="pairs_fastq" format="fastqsanger" label="$input_bam.name (bam2fq pairs)"> + <filter>(action_mode['mode'] == 'pairs')</filter> + </data> + <data name="singletons_fastq" format="fastqsanger" label="$input_bam.name (bam2fq singletons)"> + <filter>(action_mode['mode'] == 'pairs')</filter> + </data> + <data name="out_fastq" format="fastqsanger" label="$input_bam.name (bam2fq)"> + <filter>(action_mode['mode'] == 'naive')</filter> + </data> </outputs> <stdio> <!-- Assume anything other than zero is an error --> @@ -28,33 +53,59 @@ <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> <param name="suffices" value="true" /> <param name="orig_qual" value="false" /> + <param name="mode" value="naive" /> <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> </test> <test> <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> <param name="suffices" value="true" /> <param name="orig_qual" value="true" /> + <param name="mode" value="naive" /> <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> </test> <test> <param name="input_bam" value="sam_spec_padded.sam" ftype="sam" /> + <param name="mode" value="naive" /> <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> </test> <test> <param name="input_bam" value="sam_spec_padded.depad.bam" ftype="bam" /> + <param name="mode" value="naive" /> <output name="out_fastq" file="sam_spec_padded.bam2fq.fastq" ftype="fastqsanger" /> </test> <test> <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> <param name="suffices" value="false"/> + <param name="mode" value="naive" /> <output name="out_fastq" file="sam_spec_padded.bam2fq_no_suf.fastq" ftype="fastqsanger" /> </test> + <test> + <param name="input_bam" value="sam_spec_padded.bam" ftype="bam" /> + <param name="suffices" value="true" /> + <param name="orig_qual" value="false" /> + <param name="mode" value="pairs" /> + <output name="pairs_fastq" file="sam_spec_padded.bam2fq_pairs.fastq" ftype="fastqsanger" /> + <output name="singletons_fastq" file="sam_spec_padded.bam2fq_singles.fastq" ftype="fastqsanger" /> + </test> + <test> + <param name="input_bam" value="sam_spec_padded.sam" ftype="sam" /> + <param name="suffices" value="true" /> + <param name="orig_qual" value="false" /> + <param name="mode" value="pairs" /> + <output name="pairs_fastq" file="sam_spec_padded.bam2fq_pairs.fastq" ftype="fastqsanger" /> + <output name="singletons_fastq" file="sam_spec_padded.bam2fq_singles.fastq" ftype="fastqsanger" /> + </test> </tests> <help> **What it does** This tool runs the ``samtools bam2fq`` command in the SAMtools toolkit. +By default this will pre-sort your SAM/BAM file by read name and split your +reads into an interlaced FASTQ file for paired reads, and a separate FASTQ +file for singlton reads. A naive conversion is also offered which gives a +single FASTQ file with the reads ordered as in the input SAM/BAM file. + It is quite common to wish to remap high-throughput sequencing data. If you only have the mapped reads in SAM/BAM format, this tool can "unmap" them to recover FASTQ format reads to input into an alternative mapping tool.
