Mercurial > repos > nate > data_manager_bowtie2_index_builder
changeset 0:6220ea344019 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/data_managers/data_manager_bowtie2_index_builder commit 5c5d8acf6955dc4f404998ac7929f13363ef2c41
| author | nate |
|---|---|
| date | Tue, 29 Jul 2025 17:13:06 +0000 |
| parents | |
| children | |
| files | data_manager/bowtie2_index_builder.xml data_manager_conf.xml test-data/all_fasta.loc test-data/bowtie2_data_manager.1.json test-data/bowtie2_data_manager.2.json test-data/bowtie2_indices.loc test-data/phiX174.fasta test-data/tophat2_indices.loc tool-data/all_fasta.loc.sample tool-data/bowtie2_indices.loc.sample tool-data/tophat2_indices.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| diffstat | 13 files changed, 443 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/data_manager/bowtie2_index_builder.xml Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,79 @@ +<tool id="bowtie2_index_builder_data_manager" name="Bowtie2 index" tool_type="manage_data" version="@WRAPPER_VERSION@+galaxy@VERSION_SUFFIX@" profile="23.0"> + <description>builder</description> + <macros> + <token name="@WRAPPER_VERSION@">2.5.4</token> + <token name="@VERSION_SUFFIX@">1</token> + </macros> + <requirements> + <requirement type="package" version="@WRAPPER_VERSION@">bowtie2</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + #set $value = $sequence_id or $all_fasta_source.fields.dbkey + #set $fasta_file_name = str($all_fasta_source.fields.path).split('/')[-1] + mkdir -p '${out_file.extra_files_path}' && + ln -s '${all_fasta_source.fields.path}' '${out_file.extra_files_path}/${fasta_file_name}' && + cd '${out_file.extra_files_path}' && + bowtie2-build --threads \${GALAXY_SLOTS:-1} '${out_file.extra_files_path}/${fasta_file_name}' '${value}' && + rm '${out_file.extra_files_path}/${fasta_file_name}' && + cp '$dmjson' '$out_file' + ]]></command> + <configfiles> + <configfile name="dmjson"><![CDATA[#slurp +#set $fasta_file_name = str($all_fasta_source.fields.path).split('/')[-1] +#set $value = $sequence_id or $all_fasta_source.fields.dbkey +#set $name = $sequence_name or $all_fasta_source.fields.name +{ + "data_tables":{ + "bowtie2_indexes":[ + { + "value": "${value}", + "dbkey": "${all_fasta_source.fields.dbkey}", + "name": "${name}", + "path": "${value}" + } +#if $tophat2: + ], + "tophat2_indexes":[ + { + "value": "${value}", + "dbkey": "${all_fasta_source.fields.dbkey}", + "name": "${name}", + "path": "${value}" + } +#end if + ] + } +} +]]></configfile> + </configfiles> + <inputs> + <param name="all_fasta_source" type="select" label="Source FASTA Sequence"> + <options from_data_table="all_fasta"/> + </param> + <param name="sequence_name" type="text" value="" label="Name of sequence" /> + <param name="sequence_id" type="text" value="" label="ID for sequence" /> + <param name="tophat2" type="boolean" checked="True" label="Also make available for TopHat" help="Adds values to tophat2_indexes tool data table" /> + </inputs> + <outputs> + <data name="out_file" format="data_manager_json"/> + </outputs> + <tests> + <test> + <param name="all_fasta_source" value="phiX174"/> + <output name="out_file" value="bowtie2_data_manager.1.json"/> + </test> + <test> + <param name="all_fasta_source" value="phiX174"/> + <param name="sequence_name" value="Galeocerdo cuvier"/> + <param name="sequence_id" value="tigHai1"/> + <param name="tophat2" value="False"/> + <output name="out_file" file="bowtie2_data_manager.2.json"/> + </test> + </tests> + + <help> +.. class:: infomark + +**Notice:** If you leave name, description, or id blank, it will be generated automatically. + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/data_manager_conf.xml Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,33 @@ +<?xml version="1.0"?> +<data_managers> + <data_manager tool_file="data_manager/bowtie2_index_builder.xml" id="bowtie2_index_builder"> + <data_table name="bowtie2_indexes"> + <output> + <column name="value" /> + <column name="dbkey" /> + <column name="name" /> + <column name="path" output_ref="out_file" > + <move type="directory" relativize_symlinks="True"> + <!-- <source>${path}</source>--> <!-- out_file.extra_files_path is used as base by default --> <!-- if no source, eg for type=directory, then refers to base --> + <target base="${GALAXY_DATA_MANAGER_DATA_PATH}">genomes/${dbkey}/bowtie_index/v2/${value}</target> + </move> + <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/genomes/${dbkey}/bowtie_index/v2/${value}/${value}</value_translation> + <value_translation type="function">abspath</value_translation> + </column> + </output> + </data_table> + + <data_table name="tophat2_indexes"> + <output> + <column name="value" /> + <column name="dbkey" /> + <column name="name" /> + <column name="path" output_ref="out_file" > + <!-- no move, always happens as part of bowtie2 and uses that path --> + <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/genomes/${dbkey}/bowtie_index/v2/${value}/${value}</value_translation> + <value_translation type="function">abspath</value_translation> + </column> + </output> + </data_table> + </data_manager> +</data_managers>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/all_fasta.loc Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,19 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_path> +# +#So, all_fasta.loc could look something like this: +# +#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa +# +#Your all_fasta.loc file should contain an entry for each individual +#fasta file. So there will be multiple fasta files for each build, +#such as with hg19 above. +# +phiX174 phiX174 phiX 174 ${__HERE__}/phiX174.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2_data_manager.1.json Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,20 @@ +{ + "data_tables":{ + "bowtie2_indexes":[ + { + "value": "phiX174", + "dbkey": "phiX174", + "name": "phiX 174", + "path": "phiX174.fasta" + } + ], + "tophat2_indexes":[ + { + "value": "phiX174", + "dbkey": "phiX174", + "name": "phiX 174", + "path": "phiX174.fasta" + } + ] + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2_data_manager.2.json Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,12 @@ +{ + "data_tables":{ + "bowtie2_indexes":[ + { + "value": "tigHai1", + "dbkey": "phiX174", + "name": "Galeocerdo cuvier", + "path": "phiX174.fasta" + } + ] + } +}
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2_indices.loc Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,37 @@ +# bowtie2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX174.fasta Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat2_indices.loc Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,37 @@ +# tophat2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/all_fasta.loc.sample Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,18 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_path> +# +#So, all_fasta.loc could look something like this: +# +#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa +# +#Your all_fasta.loc file should contain an entry for each individual +#fasta file. So there will be multiple fasta files for each build, +#such as with hg19 above. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/bowtie2_indices.loc.sample Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,37 @@ +# bowtie2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/tophat2_indices.loc.sample Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,37 @@ +# tophat2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,18 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Locations of all fasta files under genome directory --> + <table name="all_fasta" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/all_fasta.loc" /> + </table> + <!-- Locations of indexes in the Bowtie2 mapper format --> + <table name="bowtie2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/bowtie2_indices.loc" /> + </table> + <!-- Locations of indexes in the Bowtie2 mapper format for TopHat2 to use --> + <table name="tophat2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/tophat2_indices.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Tue Jul 29 17:13:06 2025 +0000 @@ -0,0 +1,17 @@ +<tables> + <!-- Locations of indexes in the Bowtie2 mapper format --> + <table name="bowtie2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/bowtie2_indices.loc" /> + </table> + <!-- Locations of indexes in the Bowtie2 mapper format for TopHat2 to use --> + <table name="tophat2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/tophat2_indices.loc" /> + </table> + <!-- Locations of all fasta files under genome directory --> + <table name="all_fasta" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/all_fasta.loc" /> + </table> +</tables>