Mercurial > repos > matthias > data_manager_bowtie2_index_builder
changeset 0:68fd790f3916 draft default tip
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/data_managers/data_manager_bowtie2_index_builder commit eb0405e83bae7b6f11446236044a6aed2fcaf4d6"
| author | matthias |
|---|---|
| date | Thu, 02 Apr 2020 13:16:53 +0000 |
| parents | |
| children | |
| files | data_manager/bowtie2_index_builder.py data_manager/bowtie2_index_builder.xml data_manager_conf.xml test-data/all_fasta.loc test-data/bowtie2_data_manager.json test-data/bowtie2_indices.loc test-data/phiX174.fasta test-data/tophat2_indices.loc tool-data/all_fasta.loc.sample tool-data/bowtie2_indices.loc.sample tool-data/tophat2_indices.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| diffstat | 13 files changed, 460 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/data_manager/bowtie2_index_builder.py Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,85 @@ +#!/usr/bin/env python +# Dan Blankenberg +from __future__ import print_function + +import optparse +import os +import subprocess +import sys +from json import dumps, loads + +DEFAULT_DATA_TABLE_NAMES = ["bowtie2_indexes"] + + +def get_id_name(params, dbkey, fasta_description=None): + # TODO: ensure sequence_id is unique and does not already appear in location file + sequence_id = params['param_dict']['sequence_id'] + if not sequence_id: + sequence_id = dbkey + + sequence_name = params['param_dict']['sequence_name'] + if not sequence_name: + sequence_name = fasta_description + if not sequence_name: + sequence_name = dbkey + return sequence_id, sequence_name + + +def build_bowtie2_index(data_manager_dict, fasta_filename, params, target_directory, dbkey, sequence_id, sequence_name, data_table_names=DEFAULT_DATA_TABLE_NAMES): + # TODO: allow multiple FASTA input files + fasta_base_name = os.path.split(fasta_filename)[-1] + sym_linked_fasta_filename = os.path.join(target_directory, fasta_base_name) + os.symlink(fasta_filename, sym_linked_fasta_filename) + args = ['bowtie2-build', sym_linked_fasta_filename, sequence_id] + threads = os.environ.get('GALAXY_SLOTS') + if threads: + args.extend(['--threads', threads]) + proc = subprocess.Popen(args=args, shell=False, cwd=target_directory) + return_code = proc.wait() + if return_code: + print("Error building index.", file=sys.stderr) + sys.exit(return_code) + data_table_entry = dict(value=sequence_id, dbkey=dbkey, name=sequence_name, path=sequence_id) + for data_table_name in data_table_names: + _add_data_table_entry(data_manager_dict, data_table_name, data_table_entry) + + +def _add_data_table_entry(data_manager_dict, data_table_name, data_table_entry): + data_manager_dict['data_tables'] = data_manager_dict.get('data_tables', {}) + data_manager_dict['data_tables'][data_table_name] = data_manager_dict['data_tables'].get(data_table_name, []) + data_manager_dict['data_tables'][data_table_name].append(data_table_entry) + return data_manager_dict + + +def main(): + parser = optparse.OptionParser() + parser.add_option('-f', '--fasta_filename', dest='fasta_filename', action='store', type="string", default=None, help='fasta_filename') + parser.add_option('-d', '--fasta_dbkey', dest='fasta_dbkey', action='store', type="string", default=None, help='fasta_dbkey') + parser.add_option('-t', '--fasta_description', dest='fasta_description', action='store', type="string", default=None, help='fasta_description') + parser.add_option('-n', '--data_table_name', dest='data_table_name', action='append', type="string", default=None, help='data_table_name') + (options, args) = parser.parse_args() + + filename = args[0] + + params = loads(open(filename).read()) + target_directory = params['output_data'][0]['extra_files_path'] + os.mkdir(target_directory) + data_manager_dict = {} + + dbkey = options.fasta_dbkey + + if dbkey in [None, '', '?']: + raise Exception('"%s" is not a valid dbkey. You must specify a valid dbkey.' % (dbkey)) + + sequence_id, sequence_name = get_id_name(params, dbkey=dbkey, fasta_description=options.fasta_description) + + # build the index + build_bowtie2_index(data_manager_dict, options.fasta_filename, params, target_directory, dbkey, sequence_id, sequence_name, data_table_names=options.data_table_name or DEFAULT_DATA_TABLE_NAMES) + + # save info to json file + with open(filename, 'w') as json_out: + json_out.write(dumps(data_manager_dict, sort_keys=True)) + + +if __name__ == "__main__": + main()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/data_manager/bowtie2_index_builder.xml Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,40 @@ +<tool id="bowtie2_index_builder_data_manager" name="Bowtie2 index" tool_type="manage_data" version="@WRAPPER_VERSION@.1+galaxy1" profile="18.09"> + <description>builder</description> + <requirements> + <requirement type="package" version="@WRAPPER_VERSION@">bowtie2</requirement> + </requirements> + <macros> + <token name="@WRAPPER_VERSION@">2.3.5</token> + </macros> + <command detect_errors="exit_code"><![CDATA[ + python '$__tool_directory__/bowtie2_index_builder.py' + '${out_file}' + --fasta_filename '${all_fasta_source.fields.path}' + --fasta_dbkey '${all_fasta_source.fields.dbkey}' + --fasta_description '${all_fasta_source.fields.name}' + --data_table_name bowtie2_indexes ${tophat2} + ]]></command> + <inputs> + <param name="all_fasta_source" type="select" label="Source FASTA Sequence"> + <options from_data_table="all_fasta"/> + </param> + <param name="sequence_name" type="text" value="" label="Name of sequence" /> + <param name="sequence_id" type="text" value="" label="ID for sequence" /> + <param name="tophat2" type="boolean" truevalue="--data_table_name tophat2_indexes" falsevalue="" checked="True" label="Also make available for TopHat" help="Adds values to tophat2_indexes tool data table" /> + </inputs> + <outputs> + <data name="out_file" format="data_manager_json"/> + </outputs> + <tests> + <test> + <param name="all_fasta_source" value="phiX174"/> + <output name="out_file" value="bowtie2_data_manager.json"/> + </test> + </tests> + + <help> +.. class:: infomark + +**Notice:** If you leave name, description, or id blank, it will be generated automatically. + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/data_manager_conf.xml Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,35 @@ +<?xml version="1.0"?> +<data_managers> + + <data_manager tool_file="data_manager/bowtie2_index_builder.xml" id="bowtie2_index_builder" version="2.2.6"> + <data_table name="bowtie2_indexes"> + <output> + <column name="value" /> + <column name="dbkey" /> + <column name="name" /> + <column name="path" output_ref="out_file" > + <move type="directory" relativize_symlinks="True"> + <!-- <source>${path}</source>--> <!-- out_file.extra_files_path is used as base by default --> <!-- if no source, eg for type=directory, then refers to base --> + <target base="${GALAXY_DATA_MANAGER_DATA_PATH}">${dbkey}/bowtie2_index/${value}</target> + </move> + <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/${dbkey}/bowtie2_index/${value}/${path}</value_translation> + <value_translation type="function">abspath</value_translation> + </column> + </output> + </data_table> + + <data_table name="tophat2_indexes"> + <output> + <column name="value" /> + <column name="dbkey" /> + <column name="name" /> + <column name="path" output_ref="out_file" > + <!-- no move, always happens as part of bowtie2 and uses that path --> + <value_translation>${GALAXY_DATA_MANAGER_DATA_PATH}/${dbkey}/bowtie2_index/${value}/${path}</value_translation> + <value_translation type="function">abspath</value_translation> + </column> + </output> + </data_table> + </data_manager> + +</data_managers>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/all_fasta.loc Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,19 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_path> +# +#So, all_fasta.loc could look something like this: +# +#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa +# +#Your all_fasta.loc file should contain an entry for each individual +#fasta file. So there will be multiple fasta files for each build, +#such as with hg19 above. +# +phiX174 phiX174 phiX174 ${__HERE__}/phiX174.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2_data_manager.json Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,1 @@ +{"data_tables": {"bowtie2_indexes": [{"dbkey": "phiX174", "name": "phiX174", "path": "phiX174", "value": "phiX174"}], "tophat2_indexes": [{"dbkey": "phiX174", "name": "phiX174", "path": "phiX174", "value": "phiX174"}]}} \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bowtie2_indices.loc Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,37 @@ +# bowtie2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX174.fasta Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tophat2_indices.loc Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,37 @@ +# tophat2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/all_fasta.loc.sample Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,18 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_path> +# +#So, all_fasta.loc could look something like this: +# +#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa +# +#Your all_fasta.loc file should contain an entry for each individual +#fasta file. So there will be multiple fasta files for each build, +#such as with hg19 above. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/bowtie2_indices.loc.sample Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,37 @@ +# bowtie2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/tophat2_indices.loc.sample Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,37 @@ +# tophat2_indices.loc.sample +# This is a *.loc.sample file distributed with Galaxy that enables tools +# to use a directory of indexed data files. This one is for Bowtie2 and Tophat2. +# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup +# First create these data files and save them in your own data directory structure. +# Then, create a bowtie_indices.loc file to use those indexes with tools. +# Copy this file, save it with the same name (minus the .sample), +# follow the format examples, and store the result in this directory. +# The file should include an one line entry for each index set. +# The path points to the "basename" for the set, not a specific file. +# It has four text columns seperated by TABS. +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +# So, for example, if you had hg18 indexes stored in: +# +# /depot/data2/galaxy/hg19/bowtie2/ +# +# containing hg19 genome and hg19.*.bt2 files, such as: +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.fa +# -rw-rw-r-- 1 james james 914M Feb 10 18:56 hg19canon.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 18:56 hg19canon.2.bt2 +# -rw-rw-r-- 1 james james 3.3K Feb 10 16:54 hg19canon.3.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 16:54 hg19canon.4.bt2 +# -rw-rw-r-- 1 james james 914M Feb 10 20:45 hg19canon.rev.1.bt2 +# -rw-rw-r-- 1 james james 683M Feb 10 20:45 hg19canon.rev.2.bt2 +# +# then the bowtie2_indices.loc entry could look like this: +# +#hg19 hg19 Human (hg19) /depot/data2/galaxy/hg19/bowtie2/hg19canon +# +#More examples: +# +#mm10 mm10 Mouse (mm10) /depot/data2/galaxy/mm10/bowtie2/mm10 +#dm3 dm3 D. melanogaster (dm3) /depot/data2/galaxy/mm10/bowtie2/dm3 +# +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,18 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Locations of all fasta files under genome directory --> + <table name="all_fasta" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/all_fasta.loc" /> + </table> + <!-- Locations of indexes in the Bowtie2 mapper format --> + <table name="bowtie2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/bowtie2_indices.loc" /> + </table> + <!-- Locations of indexes in the Bowtie2 mapper format for TopHat2 to use --> + <table name="tophat2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/tophat2_indices.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Thu Apr 02 13:16:53 2020 +0000 @@ -0,0 +1,17 @@ +<tables> + <!-- Locations of indexes in the Bowtie2 mapper format --> + <table name="bowtie2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/bowtie2_indices.loc" /> + </table> + <!-- Locations of indexes in the Bowtie2 mapper format for TopHat2 to use --> + <table name="tophat2_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/tophat2_indices.loc" /> + </table> + <!-- Locations of all fasta files under genome directory --> + <table name="all_fasta" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/all_fasta.loc" /> + </table> +</tables>