Mercurial > repos > matthias > dada2_makesequencetable
comparison dada2_makeSequenceTable.xml @ 3:c3834c230b0a draft
planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/topic/dada2/tools/dada2 commit 5b1603bbcd3f139cad5c876be83fcb39697b5613-dirty
author | matthias |
---|---|
date | Mon, 29 Apr 2019 09:00:48 -0400 |
parents | d2e7c5f8a9f7 |
children | ec4a183cc713 |
comparison
equal
deleted
inserted
replaced
2:d2e7c5f8a9f7 | 3:c3834c230b0a |
---|---|
18 #end if | 18 #end if |
19 | 19 |
20 samples <- list() | 20 samples <- list() |
21 #for $s in $samples: | 21 #for $s in $samples: |
22 #if $len($samples) == 1 | 22 #if $len($samples) == 1 |
23 samples <- $read_data($s) | 23 samples <- readRDS('$s') |
24 #else | 24 #else |
25 samples[["$s.element_identifier"]] <- $read_data($s) | 25 samples[["$s.element_identifier"]] <- readRDS('$s') |
26 #end if | 26 #end if |
27 #end for | 27 #end for |
28 ## make sequence table | 28 ## make sequence table |
29 seqtab <- makeSequenceTable(samples, orderBy = "$orderby") | 29 seqtab <- makeSequenceTable(samples, orderBy = "$orderBy") |
30 | 30 |
31 | 31 |
32 reads.per.seqlen <- tapply(colSums(seqtab), factor(nchar(getSequences(seqtab))), sum) | 32 reads.per.seqlen <- tapply(colSums(seqtab), factor(nchar(getSequences(seqtab))), sum) |
33 df <- data.frame(length=as.numeric(names(reads.per.seqlen)), count=reads.per.seqlen) | 33 df <- data.frame(length=as.numeric(names(reads.per.seqlen)), count=reads.per.seqlen) |
34 | 34 |
35 #if $plot == "yes" | 35 #if $plot == "yes" |
36 pdf( '$plot_output' ) | 36 pdf( '$plot_output' ) |
37 ggplot(data=df, aes(x=length, y=count)) + | 37 ggplot(data=df, aes(x=length, y=count)) + |
38 geom_col() + | 38 geom_col() + |
39 #if $filter_cond.filter_select != "no" | 39 #if $filter_cond.filter_select != "no" |
40 geom_vline( xintercept=c($filter_cond.min-0.5, $filter_cond.max+0.5) ) + | 40 geom_vline( xintercept=c($filter_cond.min-0.5, $filter_cond.max+0.5) ) + |
41 #end if | 41 #end if |
42 theme_bw() | 42 theme_bw() |
43 bequiet <- dev.off() | 43 bequiet <- dev.off() |
44 #end if | 44 #end if |
45 | 45 |
51 write.table(seqtab, "$stable", quote=F, sep="\t", row.names = T, col.names = NA) | 51 write.table(seqtab, "$stable", quote=F, sep="\t", row.names = T, col.names = NA) |
52 ]]></configfile> | 52 ]]></configfile> |
53 </configfiles> | 53 </configfiles> |
54 <inputs> | 54 <inputs> |
55 <param name="samples" type="data" multiple="true" format="@DADA_UNIQUES@" label="samples" /> | 55 <param name="samples" type="data" multiple="true" format="@DADA_UNIQUES@" label="samples" /> |
56 <param name="orderby" type="select" label="Column order"> | 56 <param argument="orderBy" type="select" label="Column order"> |
57 <option value="abundance">abundance</option> | 57 <option value="abundance">abundance</option> |
58 <option value="nsamples">nsamples</option> | 58 <option value="nsamples">nsamples</option> |
59 </param> | 59 </param> |
60 <conditional name="filter_cond"> | 60 <conditional name="filter_cond"> |
61 <param name="filter_select" type="select" label="Filter method"> | 61 <param name="filter_select" type="select" label="Length filter method"> |
62 <option value="no">No filter</option> | 62 <option value="no">No filter</option> |
63 <option value="minmax">Specify minimum and maximum sequence lengths</option> | 63 <option value="minmax">Specify minimum and maximum sequence lengths</option> |
64 </param> | 64 </param> |
65 <when value="no"/> | 65 <when value="no"/> |
66 <when value="minmax"> | 66 <when value="minmax"> |
74 <data name="stable" format="dada2_sequencetable" label="${tool.name} on ${on_string}"/> | 74 <data name="stable" format="dada2_sequencetable" label="${tool.name} on ${on_string}"/> |
75 <data name="plot_output" format="pdf" label="${tool.name} on ${on_string}: sequence length distribution"> | 75 <data name="plot_output" format="pdf" label="${tool.name} on ${on_string}: sequence length distribution"> |
76 <filter>plot</filter> | 76 <filter>plot</filter> |
77 </data> | 77 </data> |
78 </outputs> | 78 </outputs> |
79 <tests> | |
80 <test> | |
81 <param name="samples" ftype="dada2_mergepairs" value="mergePairs_F3D0.Rdata"/> | |
82 <output name="stable" value="makeSequenceTable_F3D0.tab" ftype="dada2_sequencetable" /> | |
83 </test> | |
84 </tests> | |
85 <help><![CDATA[ | |
86 Description | |
87 ........... | |
79 | 88 |
80 <help><![CDATA[ | 89 This function constructs a sequence table -- more precisely an amplicon sequence variant table (ASV) table -- a higher-resolution version of the OTU table produced by traditional methods. |
81 This function constructs a sequence table (analogous to an OTU table) from the provided list of | |
82 samples. | |
83 | 90 |
84 Custom Reference data sets | 91 The sequence table is a matrix with rows corresponding to (and named by) the samples, and columns corresponding to (and named by) the sequence variants. |
85 -------------------------- | |
86 | 92 |
87 For ** taxonomy assignment ** the following is needed: | 93 Usage |
94 ..... | |
88 | 95 |
89 - a reference fasta data base | 96 **Input**: The result of derepFastq, dada, or mergePairs. |
90 - a comma separated list of taxonomic ranks present in the reference data base | |
91 | 97 |
92 The reference fasta data base for taxonomic assignment (fasta or compressed fasta) needs to encode the taxonomy corresponding to each sequence in the fasta header lines in the following fashion (note, the second sequence is not assigned down to level 6): | 98 **Output**: A data set of type dada2_sequencetable, i.e. a tabular with a row for each sample, and a column for each unique sequence across all the samples. The columns are named by the sequence. |
93 | 99 |
94 :: | 100 Details |
101 ....... | |
95 | 102 |
96 >Level1;Level2;Level3;Level4;Level5;Level6; | 103 Sequences that are much longer or shorter than expected may be the result of non-specific priming. You can remove non-target-length by applying a length filter. This is analogous to “cutting a band” in-silico to get amplicons of the targeted length. |
97 ACCTAGAAAGTCGTAGATCGAAGTTGAAGCATCGCCCGATGATCGTCTGAAGCTGTAGCATGAGTCGATTTTCACATTCAGGGATACCATAGGATAC | |
98 >Level1;Level2;Level3;Level4;Level5; | |
99 CGCTAGAAAGTCGTAGAAGGCTCGGAGGTTTGAAGCATCGCCCGATGGGATCTCGTTGCTGTAGCATGAGTACGGACATTCAGGGATCATAGGATAC | |
100 | 104 |
101 The list of required taxonomic ranks could be for instance: "Kingdom,Phylum,Class,Order,Family,Genus" | 105 @HELP_OVERVIEW@ |
102 | |
103 The reference data base for ** species assignment ** is a fasta file (or compressed fasta file), with the id line formatted as follows: | |
104 | |
105 :: | |
106 | |
107 >ID Genus species | |
108 ACCTAGAAAGTCGTAGATCGAAGTTGAAGCATCGCCCGATGATCGTCTGAAGCTGTAGCATGAGTCGATTTTCACATTCAGGGATACCATAGGATAC | |
109 >ID Genus species | |
110 CGCTAGAAAGTCGTAGAAGGCTCGGAGGTTTGAAGCATCGCCCGATGGGATCTCGTTGCTGTAGCATGAGTACGGACATTCAGGGATCATAGGATAC | |
111 ]]></help> | 106 ]]></help> |
112 <expand macro="citations"/> | 107 <expand macro="citations"/> |
113 </tool> | 108 </tool> |