view variant_effect_predictor/Bio/EnsEMBL/Utils/Sequence.pm @ 3:d30fa12e4cc5 default tip

Merge heads 2:a5976b2dce6f and 1:09613ce8151e which were created as a result of a recently fixed bug.

=head1 LICENSE

  Copyright (c) 1999-2012 The European Bioinformatics Institute and
  Genome Research Limited.  All rights reserved.

  This software is distributed under a modified Apache license.
  For license details, please see

    http://www.ensembl.org/info/about/code_licence.html

=head1 CONTACT

  Please email comments or questions to the public Ensembl
  developers list at <[e-mail]>.

  Questions may also be sent to the Ensembl help desk at
  <[e-mail]>.

=cut

=head1 NAME

Bio::EnsEMBL::Utils::Sequence - Utility functions for sequences

=head1 SYNOPSIS

  use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp expand);

  my $seq = 'ACTTTAAAGGCTATCCCAATATG';

  print "my sequence = $seq\n";

  reverse_comp( \$seq );

  print "my reverse comp = $seq\n";

  my $compressed_seq = '(AC)3';

  print "my expanded seq is = expand($compressed_seq)";

=head1 METHODS

=cut


package Bio::EnsEMBL::Utils::Sequence;

use strict;
use warnings;

use Exporter;

use vars qw(@ISA @EXPORT_OK);

@ISA = qw(Exporter);

@EXPORT_OK = qw(&reverse_comp &expand);


=head2 reverse_comp

  Arg [1]    : reference to a string $seqref
  Example    : use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);

               $seq = 'ACCTGAA';
               reverse_comp(\$seq);
               print $seq;

  Description: Does an in place reverse compliment of a passed in string
               reference.  The string is passed by reference
               rather than by value for memory efficiency.
  Returntype : none
  Exceptions : none
  Caller     : SequenceAdaptor, SliceAdaptor

=cut

sub reverse_comp {
  my $seqref = shift;

  $$seqref = reverse( $$seqref );
  $$seqref =~
    tr/acgtrymkswhbvdnxACGTRYMKSWHBVDNX/tgcayrkmswdvbhnxTGCAYRKMSWDVBHNX/;

  return;
}

=head2 expand

  Arg [1]    : reference to a string $seqref
  Example    : use Bio::EnsEMBL::Utils::Sequence qw(expand);

               $seq = '(AC)3';
               expand(\$seq);
               print $seq;
              

  Description: Expands a genomic sequence. The string is passed by reference
               rather than by value for memory efficiency.
  Returntype : none
  Exceptions : none
  Caller     : SequenceAdaptor, SliceAdaptor

=cut

sub expand {
  my $seq_ref = shift;
     $$seq_ref =~ s/(\w*)\((\w+)\)(\d+)/$1.$2 x $3/eg  if ($$seq_ref =~ /\(/);#expressions with parenthesis, expand the alleles			    
  return;
}


1;