Mercurial > repos > mahtabm > ensembl
view variant_effect_predictor/Bio/EnsEMBL/DBSQL/CompressedSequenceAdaptor.pm @ 3:d30fa12e4cc5 default tip
Merge heads 2:a5976b2dce6f and 1:09613ce8151e which were created as a result of a recently fixed bug.
author | devteam <devteam@galaxyproject.org> |
---|---|
date | Mon, 13 Jan 2014 10:38:30 -0500 |
parents | 1f6dce3d34e0 |
children |
line wrap: on
line source
=head1 LICENSE Copyright (c) 1999-2012 The European Bioinformatics Institute and Genome Research Limited. All rights reserved. This software is distributed under a modified Apache license. For license details, please see http://www.ensembl.org/info/about/code_licence.html =head1 CONTACT Please email comments or questions to the public Ensembl developers list at <dev@ensembl.org>. Questions may also be sent to the Ensembl help desk at <helpdesk@ensembl.org>. =cut =head1 NAME Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor - Facilitates DB storage and retrieval of compressed sequence =head1 SYNOPSIS $seq_adptr = $database_adaptor->get_SequenceAdaptor(); $dna = ${ $seq_adptr->fetch_by_Slice_start_end_strand( $slice, 1, 1000, -1 ) }; =head1 DESCRIPTION An adaptor for the retrieval of compressed DNA sequence from the EnsEMBL database =head1 METHODS =cut package Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor; use vars qw(@ISA); use strict; use Bio::EnsEMBL::DBSQL::SequenceAdaptor; @ISA = qw(Bio::EnsEMBL::DBSQL::SequenceAdaptor); sub _fetch_seq { my $self = shift; my $seq_region_id = shift; my $start = shift; my $len = shift; #calculate the offset and start in the compressed sequence my $comp_start = ($start-1 >> 2) + 1; my $comp_len = ($len >> 2) + 2; my ($bvector, $nline); my $sth = $self->prepare( "SELECT SUBSTRING( d.sequence, ?, ?), n_line FROM dnac d WHERE d.seq_region_id = ?"); $sth->bind_param(1,$comp_start,SQL_INTEGER); $sth->bind_param(2,$comp_len ,SQL_INTEGER); $sth->bind_param(3,$seq_region_id,SQL_INTEGER); $sth->execute(); $sth->bind_columns(\$bvector, \$nline); $sth->fetch(); $sth->finish(); #convert sequence from binary string to 0123 string my $bitlen = length($bvector) << 2; my $str = ''; for(my $i=0; $i < $bitlen; $i++) { $str .= vec($bvector, $i, 2); } #convert from 0123 to ACTG $str =~ tr/0123/ACTG/; $str = substr($str, ($start-1)%4, $len); #expand the nlines and place them back in the sequence my @nlines = split(/:/, $nline); foreach my $nl (@nlines) { my ($offset,$char,$nlen) = $nl =~ /(\d+)(\D)(\d+)/; #skip nlines entirely out of range next if(($offset+$nlen-1) < $start || $offset > ($start+$len-1)); #obtain relative offset into requested region $offset = $offset - $start + 1; #nlines that partially overlap requested region have to be shrunk if($offset < 1) { $nlen = $nlen - (1-$offset); $offset = 1; } if($offset + $nlen > $start+$len) { $nlen = $len - $offset + 1; } substr($str,$offset-1,$nlen) = $char x $nlen; } return \$str; } =head2 store Arg [1] : string $seq_region_id the id of the sequence region this dna will be associated with. Arg [2] : string reference $sequence the dna sequence to be stored in the database Example : $dbID = $seq_adaptor->store(12,\'ACTGGGTACCAAACAAACACAACA'); Description: stores a dna sequence in the databases dna table and returns the database identifier for the new record. Returntype : int Exceptions : none Caller : Bio::EnsEMBL::DBSQL::RawContigAdaptor::store Status : Stable =cut sub store { my ($self, $seq_region_id, $sequence) = @_; if(!$seq_region_id) { throw('seq_region_id is required'); } $sequence = uc($sequence); my $bvector = ''; #convert sequence to 0s,1s,2s and 3s $sequence =~ tr/ACTG/0123/; #nlines cover sequence which is not ACTG such as N #nline format is a set of colon delimited int, char, int triplets: #<offset><code><length> my($nline_char,$nline_len,$nline_off); my @nlines; my $len = length($sequence); for(my $i=0; $i < $len; $i++) { my $char = substr($sequence,$i,1); #quickly check if this character was an A,C,T or G (and was converted to # a 0,1,2,3) if($char =~ /[0-3]/) { vec($bvector, $i,2) = $char; if($nline_char) { #end of an nline push @nlines, "$nline_off$nline_char$nline_len"; $nline_char = undef; $nline_len = 0; $nline_off = 0; } } else { #this was not an ACTG if($nline_char) { if($nline_char eq $char) { #continuation of an nline $nline_len++; } else { #end of a previous nline and start of a new one push @nlines, "$nline_off$nline_char$nline_len"; $nline_char = $char; $nline_len = 1; $nline_off = $i+1; } } else { #start of a new nline $nline_char = $char; $nline_len = 1; $nline_off = $i+1; } $char = 0; #need to put numeric val into bitvector despite nline } vec($bvector, $i,2) = $char; } my $nline = join(':', @nlines); my $statement = $self->prepare( "INSERT INTO dnac(seq_region_id, sequence, n_line) VALUES(?,?,?)"); $statement->bind_param(1,$seq_region_id,SQL_INTEGER); $statement->bind_param(2,$bvector,SQL_BLOB); $statement->bind_param(3,$nline,SQL_LONGVARCHAR); $statement->execute(); $statement->finish(); return; } 1;