Mercurial > repos > mahtabm > ensembl
view variant_effect_predictor/Bio/Tools/Run/StandAloneBlast.pm @ 1:09613ce8151e
Deleted selected files
author | mahtabm |
---|---|
date | Thu, 11 Apr 2013 02:49:21 -0400 |
parents | 1f6dce3d34e0 |
children |
line wrap: on
line source
# $Id: StandAloneBlast.pm,v 1.23.2.3 2003/03/29 20:18:51 jason Exp $ # # BioPerl module for Bio::Tools::StandAloneBlast # # Cared for by Peter Schattner # # Copyright Peter Schattner # # You may distribute this module under the same terms as perl itself # POD documentation - main docs before the code =head1 NAME Bio::Tools::Run::StandAloneBlast - Object for the local execution of the NCBI Blast program suite (blastall, blastpgp, bl2seq) =head1 SYNOPSIS Local-blast "factory object" creation and blast-parameter initialization: @params = ('database' => 'swissprot','outfile' => 'blast1.out', '_READMETHOD' => 'Blast'); $factory = Bio::Tools::Run::StandAloneBlast->new(@params); Blast a sequence against a database: $str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta' ); $input = $str->next_seq(); $input2 = $str->next_seq(); $blast_report = $factory->blastall($input); Run an iterated Blast (psiblast) of a sequence against a database: $factory->j(3); # 'j' is blast parameter for # of iterations $factory->outfile('psiblast1.out'); $factory = Bio::Tools::Run::StandAloneBlast->new(@params); $blast_report = $factory->blastpgp($input); Use blast to align 2 sequences against each other: $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out'); $factory->bl2seq($input, $input2); Various additional options and input formats are available. See the DESCRIPTION section for details. =head1 DESCRIPTION This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast: - a Bioperl object for running the NCBI standAlone BLAST package. Blast, itself, is a large & complex program - for more information regarding BLAST, please see the BLAST documentation which accompanies the BLAST distribution. BLAST is available from ftp://ncbi.nlm.nih.gov/blast/. (A source of confusion in documenting a BLAST interface is that the term "program" is used in - at least - three different ways in the BLAST documentation. In this DESCRIPTION, "program" will refer to the BLAST routine set by BLAST's C<-p> parameter that can be set to blastn, blastp, tblastx etc. We will use the term Blast "executable" to refer to the various different executable files that may be called - ie blastall, blastpgp or bl2seq. In addition, there are several BLAST capabilities (which are also referred to as "programs") and are implemented by using specific combinations of BLAST executables, programs and parameters. They will be referred by their specific names - eg PSIBLAST and PHIBLAST. ) StandAloneBlast has been tested so far only under Linux. I expect that it should also work under other Unix systems. However, since the module is implemented using (unix) system calls, modification may be necessary before StandAloneBlast would work under non-Unix operating systems (eg Windows, MacOS). Before running StandAloneBlast it is necessary: to install BLAST on your system, to edit set the environmental variable $BLASTDIR or your $PATH variable to point to the BLAST directory, and to ensure that users have execute privileges for the BLAST program. If the databases which will be searched by BLAST are located in the data subdirectory of the blast program directory (the default installation location), StandAloneBlast will find them; however, if the database files are located in any other location, environmental variable $BLASTDATADIR will need to be set to point to that directory. The use of the StandAloneBlast module is as follows: Initially, a local blast "factory object" is created. The constructor may be passed an optional array of (non-default) parameters to be used by the factory, eg: @params = ('program' => 'blastn', 'database' => 'ecoli.nt'); $factory = Bio::Tools::Run::StandAloneBlast->new(@params); Any parameters not explicitly set will remain as the defaults of the BLAST executable. Note each BLAST executable has somewhat different parameters and options. See the BLAST Documentation for a description or run the BLAST executable from the command line followed solely with a "-" to see a list of options and default values for that executable; eg E<gt>blastall -. BLAST parameters can be changed and/or examined at any time after the factory has been created. The program checks that any parameter/switch being set/read is valid. Except where specifically noted, StandAloneBlast uses the same single-letter, case-sensitive parameter names as the actual blast program. Currently no checks are included to verify that parameters are of the proper type (eg string or numeric) or that their values are within the proper range. As an example, to change the value of the Blast parameter 'e' ('e' is the parameter for expectation-value cutoff) $expectvalue = 0.01; $factory->e($expectvalue); Note that for improved script readibility one can modify the name of the BLAST parameters as desired as long as the initial letter (and case) of the parameter are preserved, eg $factory-E<gt>expectvalue($expectvalue); Unfortunately, some of the BLAST parameters are not the single letter one might expect (eg "iteration round" in blastpgp is 'j'). Again one can check by using (eg) > blastpgp - . Once the factory has been created and the appropriate parameters set, one can call one of the supported blast executables. The input sequence(s) to these executables may be fasta file(s) as described in the BLAST documentation. $inputfilename = 't/testquery.fa'; $blast_report = $factory->blastall($inputfilename); In addition, sequence input may be in the form of either a Bio::Seq object or or an array of Bio::Seq objects, eg $input = Bio::Seq->new(-id=>"test query",-seq=>"ACTACCCTTTAAATCAGTGGGGG"); $blast_report = $factory->blastall($input); For blastall and non-psiblast blastpgp runs, report object is either a BPlite.pm or Bio::SearchIO object, selected by the user with the parameter _READMETHOD. (The leading underscore is needed to distinguish this option from options which are passed to the BLAST executable.) The default parser is Bio::SearchIO::blast. For (multiple iteration) psiblast and bl2seq runs the report is automatically parsed by the BPpsilite.pm and BPbl2seq.pm parsers respectively, since neither Blast.pm nor BPlite can parse these reports. In any case, the "raw" blast report is also available. The filename is set by the in the 'outfile' parameter and has the default value of "blastreport.out". For psiblast execution in BLAST's "jumpstart" mode, the program must be passed (in addition to the query sequence itself) an alignment containing the query sequence (in the form of a SimpleAlign object) as well as a "mask" specifying at what residues position-specific scoring matrices (PSSMs) are to used and at what residues default scoring matrices (eg BLOSUM) are to be used. See psiblast documentation for more details. The mask itself is a string of 0's and 1's which is the same length as each sequence in the alignment and has a "1" at locations where (PSSMs) are to be used and a "0" at all other locations. So for example: $str = Bio::AlignIO->new(-file=> "cysprot.msf", '-format' => 'msf' ); $aln = $str->next_aln(); $len = $aln->length_aln(); $mask = '1' x $len; # simple case where PSSM's to be used at all residues $report = $factory->blastpgp("cysprot1.fa", $aln, $mask); For bl2seq execution, StandAloneBlast.pm can be combined with AlignIO.pm to directly produce a SimpleAlign object from the alignment of the two sequences produced by bl2seq as in: #Get 2 sequences $str = Bio::SeqIO->new(-file=>'t/amino.fa' , '-format' => 'Fasta', ); my $seq3 = $str->next_seq(); my $seq4 = $str->next_seq(); # Run bl2seq on them $factory = Bio::Tools::Run::StandAloneBlast->new('outfile' => 'bl2seq.out'); my $bl2seq_report = $factory->bl2seq($seq3, $seq4); # Use AlignIO.pm to create a SimpleAlign object from the bl2seq report $str = Bio::AlignIO->new(-file=> 'bl2seq.out','-format' => 'bl2seq'); $aln = $str->next_aln(); For more examples of syntax and use of Blast.pm, the user is encouraged to run the scripts standaloneblast.pl in the bioperl /examples directory and StandAloneBlast.t in the bioperl /t directory. Note: There is a similar (but older) perl object interface offered by nhgri. The nhgri module only supports blastall and does not support blastpgp, psiblast, phiblast, bl2seq etc. This module can be found at http://genome.nhgri.nih.gov/blastall/. =head1 DEVELOPERS NOTES B<STILL TO BE WRITTEN> Note: This module is still under development. If you would like that a specific BLAST feature be added to this perl interface, let me know. =head1 FEEDBACK =head2 Mailing Lists User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated. bioperl-l@bioperl.org - General discussion http://bio.perl.org/MailList.html - About the mailing lists =head2 Reporting Bugs Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web: bioperl-bugs@bio.perl.org http://bio.perl.org/bioperl-bugs/ =head1 AUTHOR - Peter Schattner Email schattner@alum.mit.edu =head1 APPENDIX The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _ =cut package Bio::Tools::Run::StandAloneBlast; use vars qw($AUTOLOAD @ISA $PROGRAMDIR $DATADIR @BLASTALL_PARAMS @BLASTPGP_PARAMS @BL2SEQ_PARAMS @OTHER_PARAMS %OK_FIELD ); use strict; use Bio::Root::Root; use Bio::Root::IO; use Bio::Seq; use Bio::SeqIO; use Bio::Tools::BPbl2seq; use Bio::Tools::BPpsilite; use Bio::SearchIO; use Bio::Tools::Run::WrapperBase; use Bio::Factory::ApplicationFactoryI; BEGIN { @BLASTALL_PARAMS = qw( p d i e m o F G E X I q r v b f g Q D a O J M W z K L Y S T l U y Z); @BLASTPGP_PARAMS = qw(d i A f e m o y P F G E X N g S H a I h c j J Z O M v b C R W z K L Y p k T Q B l U); @BL2SEQ_PARAMS = qw(i j p g o d a G E X W M q r F e S T m); # Non BLAST parameters start with underscore to differentiate them # from BLAST parameters @OTHER_PARAMS = qw(_READMETHOD); # _READMETHOD = 'BPlite' (default) or 'Blast' # my @other_switches = qw(QUIET); # Authorize attribute fields foreach my $attr (@BLASTALL_PARAMS, @BLASTPGP_PARAMS, @BL2SEQ_PARAMS, @OTHER_PARAMS ) { $OK_FIELD{$attr}++; } # You will need to enable Blast to find the Blast program. This can be done # in (at least) two different ways: # 1. define an environmental variable blastDIR: # export BLASTDIR=/home/peter/blast or # 2. include a definition of an environmental variable BLASTDIR in every script that will # use StandAloneBlast.pm. # BEGIN {$ENV{BLASTDIR} = '/home/peter/blast/'; } $PROGRAMDIR = $ENV{'BLASTDIR'} || ''; # If local BLAST databases are not stored in the standard # /data directory, the variable BLASTDATADIR will need to be set explicitly $DATADIR = $ENV{'BLASTDATADIR'} || $ENV{'BLASTDB'} || ''; } @ISA = qw(Bio::Root::Root Bio::Tools::Run::WrapperBase Bio::Factory::ApplicationFactoryI); =head1 BLAST parameters Essentially all BLAST parameter can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional (I think.) For a complete listing of settable parameters, run the relevant executable BLAST program with the option "-" as in blastall - =head2 Blastall -p Program Name [String] Input should be one of "blastp", "blastn", "blastx", "tblastn", or "tblastx". -d Database [String] default = nr The database specified must first be formatted with formatdb. Multiple database names (bracketed by quotations) will be accepted. An example would be -d "nr est" -i Query File [File In] Set by StandAloneBlast.pm from script. default = stdin. The query should be in FASTA format. If multiple FASTA entries are in the input file, all queries will be searched. -e Expectation value (E) [Real] default = 10.0 -o BLAST report Output File [File Out] Optional, default = ./blastreport.out ; set by StandAloneBlast.pm -S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer] default = 3 =head2 Blastpgp (including Psiblast) -j is the maximum number of rounds (default 1; i.e., regular BLAST) -h is the e-value threshold for including sequences in the score matrix model (default 0.001) -c is the "constant" used in the pseudocount formula specified in the paper (default 10) -B Multiple alignment file for PSI-BLAST "jump start mode" Optional -Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional =head2 Bl2seq -i First sequence [File In] -j Second sequence [File In] -p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String] default = blastp -o alignment output file [File Out] default = stdout -e Expectation value (E) [Real] default = 10.0 -S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer] default = 3 =cut sub new { my ($caller, @args) = @_; # chained new my $self = $caller->SUPER::new(@args); # to facilitiate tempfile cleanup my ($tfh,$tempfile) = $self->io->tempfile(); close($tfh); # we don't want the filehandle, just a temporary name $self->outfile($tempfile); $self->_READMETHOD('Blast'); while (@args) { my $attr = shift @args; my $value = shift @args; next if( $attr eq '-verbose'); # the workaround to deal with initializing $attr = 'p' if $attr =~ /^\s*program\s*$/; $self->$attr($value); } return $self; } sub AUTOLOAD { my $self = shift; my $attr = $AUTOLOAD; $attr =~ s/.*:://; my $attr_letter = substr($attr, 0, 1) ; # actual key is first letter of $attr unless first attribute # letter is underscore (as in _READMETHOD), the $attr is a BLAST # parameter and should be truncated to its first letter only $attr = ($attr_letter eq '_') ? $attr : $attr_letter; $self->throw("Unallowed parameter: $attr !") unless $OK_FIELD{$attr}; # $self->throw("Unallowed parameter: $attr !") unless $ok_field{$attr_letter}; $self->{$attr_letter} = shift if @_; return $self->{$attr_letter}; } =head1 Methods =head2 executable Title : executable Usage : my $exe = $blastfactory->executable('blastall'); Function: Finds the full path to the 'codeml' executable Returns : string representing the full path to the exe Args : [optional] name of executable to set path to [optional] boolean flag whether or not warn when exe is not found =cut sub executable { my ($self, $exename, $exe,$warn) = @_; $exename = 'blastall' unless defined $exename; if( defined $exe && -x $exe ) { $self->{'_pathtoexe'}->{$exename} = $exe; } unless( defined $self->{'_pathtoexe'}->{$exename} ) { my $f = $self->program_path($exename); $exe = $self->{'_pathtoexe'}->{$exename} = $f if(-e $f && -x $f ); # This is how I meant to split up these conditionals --jason # if exe is null we will execute this (handle the case where # PROGRAMDIR pointed to something invalid) unless( $exe ) { # we didn't find it in that last conditional if( ($exe = $self->io->exists_exe($exename)) && -x $exe ) { $self->{'_pathtoexe'}->{$exename} = $exe; } else { $self->warn("Cannot find executable for $exename") if $warn; $self->{'_pathtoexe'}->{$exename} = undef; } } } return $self->{'_pathtoexe'}->{$exename}; } =head2 program_path Title : program_path Usage : my $path = $factory->program_path(); Function: Builds path for executable Returns : string representing the full path to the exe Args : none =cut sub program_path { my ($self,$program_name) = @_; my @path; push @path, $self->program_dir if $self->program_dir; push @path, $program_name .($^O =~ /mswin/i ?'.exe':''); return Bio::Root::IO->catfile(@path); } =head2 program_dir Title : program_dir Usage : my $dir = $factory->program_dir(); Function: Abstract get method for dir of program. To be implemented by wrapper. Returns : string representing program directory Args : none =cut sub program_dir { $PROGRAMDIR; } sub program { my $self = shift; if( wantarray ) { return ($self->executable, $self->p()); } else { return $self->executable(@_); } } =head2 blastall Title : blastall Usage : $blast_report = $factory->blastall('t/testquery.fa'); or $input = Bio::Seq->new(-id=>"test query", -seq=>"ACTACCCTTTAAATCAGTGGGGG"); $blast_report = $factory->blastall($input); or $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects $blast_report = $factory->blastall(\@seq_array); Returns : Reference to a Blast object or BPlite object containing the blast report. Args : Name of a file or Bio::Seq object or an array of Bio::Seq object containing the query sequence(s). Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found. =cut sub blastall { my ($self,$input1) = @_; $self->io->_io_cleanup(); my $executable = 'blastall'; my $input2; # Create input file pointer my $infilename1 = $self->_setinput($executable, $input1); if (! $infilename1) {$self->throw(" $input1 ($infilename1) not Bio::Seq object or array of Bio::Seq objects or file name!");} $self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastall) my $blast_report = &_generic_local_blast($self, $executable, $input1, $input2); } =head2 blastpgp Title : blastpgp Usage : $blast_report = $factory-> blastpgp('t/testquery.fa'); or $input = Bio::Seq->new(-id=>"test query", -seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); $blast_report = $factory->blastpgp ($input); or $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects $blast_report = $factory-> blastpgp(\@seq_array); Returns : Reference to a Blast object or BPlite object containing the blast report. Args : Name of a file or Bio::Seq object. In psiblast jumpstart mode two additional arguments are required: a SimpleAlign object one of whose elements is the query and a "mask" to determine how BLAST should select scoring matrices see DESCRIPTION above for more details. Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found. Returns : Reference to either a BPlite.pm, Blast.pm or BPpsilite.pm object containing the blast report. =cut sub blastpgp { my $self = shift; my $executable = 'blastpgp'; my $input1 = shift; my $input2 = shift; my $mask = shift; # used by blastpgp's -B option to specify which residues are position aligned my ($infilename1, $infilename2 ) = $self->_setinput($executable, $input1, $input2, $mask); if (!$infilename1) {$self->throw(" $input1 not Bio::Seq object or array of Bio::Seq objects or file name!");} $self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastpgp) if ($input2) { unless ($infilename2) {$self->throw("$input2 not SimpleAlign Object in pre-aligned psiblast\n");} $self->B($infilename2); # set file name of partial alignment to inputfilename2 (-B param of blastpgp) } my $blast_report = &_generic_local_blast($self, $executable, $input1, $input2); } =head2 bl2seq Title : bl2seq Usage : $factory-> blastpgp('t/seq1.fa', 't/seq2.fa'); or $input1 = Bio::Seq->new(-id=>"test query1", -seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); $input2 = Bio::Seq->new(-id=>"test query2", -seq=>"ACTADDEMMMMMMMDEEQQQVVGG"); $blast_report = $factory->bl2seq ($input1, $input2); Returns : Reference to a BPbl2seq object containing the blast report. Args : Names of 2 files or 2 Bio::Seq objects containing the sequences to be aligned by bl2seq. Throws an exception if argument is not either a pair of strings (eg filenames) or references to Bio::Seq objects. If arguments are strings, throws exception if files corresponding to string names can not be found. =cut sub bl2seq { my $self = shift; my $executable = 'bl2seq'; my $input1 = shift; my $input2 = shift; # Create input file pointer my ($infilename1, $infilename2 ) = $self->_setinput($executable, $input1, $input2); if (!$infilename1){$self->throw(" $input1 not Seq Object or file name!");} if (!$infilename2){$self->throw("$input2 not Seq Object or file name!");} $self->i($infilename1); # set file name of first sequence to # be aligned to inputfilename1 # (-i param of bl2seq) $self->j($infilename2); # set file name of first sequence to # be aligned to inputfilename2 # (-j param of bl2seq) my $blast_report = &_generic_local_blast($self, $executable); } ################################################# =head2 _generic_local_blast Title : _generic_local_blast Usage : internal function not called directly Returns : Blast or BPlite object Args : Reference to calling object and name of BLAST executable =cut sub _generic_local_blast { my $self = shift; my $executable = shift; # Create parameter string to pass to Blast program my $param_string = $self->_setparams($executable); # run Blast my $blast_report = &_runblast($self, $executable, $param_string); } =head2 _runblast Title : _runblast Usage : Internal function, not to be called directly Function: makes actual system call to Blast program Example : Returns : Report object in the appropriate format (BPlite, BPpsilite, Blast, or BPbl2seq) Args : Reference to calling object, name of BLAST executable, and parameter string for executable =cut sub _runblast { my ($self,$executable,$param_string) = @_; my ($blast_obj,$exe); if( ! ($exe = $self->executable($executable)) ) { $self->warn("cannot find path to $executable"); return undef; } my $commandstring = $exe. $param_string; # next line for debugging $self->debug( "$commandstring \n"); my $status = system($commandstring); $self->throw("$executable call crashed: $? $commandstring\n") unless ($status==0) ; my $outfile = $self->o() ; # get outputfilename my $signif = $self->e() || 1e-5 ; # set significance cutoff to set expectation value or default value # (may want to make this value vary for different executables) # If running bl2seq or psiblast (blastpgp with multiple iterations), # the specific parsers for these programs must be used (ie BPbl2seq or # BPpsilite). Otherwise either the Blast parser or the BPlite # parsers can be selected. if ($executable =~ /bl2seq/i) { if( $self->verbose > 0 ) { open(OUT, $outfile) || $self->throw("cannot open $outfile"); while(<OUT>) { $self->debug($_)} close(OUT); } # Added program info so BPbl2seq can compute strand info $blast_obj = Bio::Tools::BPbl2seq->new(-file => $outfile, -REPORT_TYPE => $self->p ); # $blast_obj = Bio::Tools::BPbl2seq->new(-file => $outfile); } elsif ($executable =~ /blastpgp/i && defined $self->j() && $self->j() > 1) { print "using psilite parser\n"; $blast_obj = Bio::Tools::BPpsilite->new(-file => $outfile); } elsif ($self->_READMETHOD =~ /^Blast/i ) { $blast_obj = Bio::SearchIO->new(-file=>$outfile, -format => 'blast' ) ; } elsif ($self->_READMETHOD =~ /^BPlite/i ) { $blast_obj = Bio::Tools::BPlite->new(-file=>$outfile); } else { $self->warn("Unrecognized readmethod ".$self->_READMETHOD. " or executable $executable\n"); } return $blast_obj; } =head2 _setinput Title : _setinput Usage : Internal function, not to be called directly Function: Create input file(s) for Blast executable Example : Returns : name of file containing Blast data input Args : Seq object reference or input file name =cut sub _setinput { my ($self, $executable, $input1, $input2) = @_; my ($seq, $temp, $infilename1, $infilename2,$fh ) ; # If $input1 is not a reference it better be the name of a file with # the sequence/ alignment data... $self->io->_io_cleanup(); SWITCH: { unless (ref $input1) { $infilename1 = (-e $input1) ? $input1 : 0 ; last SWITCH; } # $input may be an array of BioSeq objects... if (ref($input1) =~ /ARRAY/i ) { ($fh,$infilename1) = $self->io->tempfile(); $temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta'); foreach $seq (@$input1) { unless ($seq->isa("Bio::PrimarySeqI")) {return 0;} $temp->write_seq($seq); } close $fh; $fh = undef; last SWITCH; } # $input may be a single BioSeq object... elsif ($input1->isa("Bio::PrimarySeqI")) { ($fh,$infilename1) = $self->io->tempfile(); # just in case $input1 is taken from an alignment and has spaces (ie # deletions) indicated within it, we have to remove them - otherwise # the BLAST programs will be unhappy my $seq_string = $input1->seq(); $seq_string =~ s/\W+//g; # get rid of spaces in sequence $input1->seq($seq_string); $temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta'); $temp->write_seq($input1); close $fh; undef $fh; # $temp->write_seq($input1); last SWITCH; } $infilename1 = 0; # Set error flag if you get here } # End SWITCH unless ($input2) { return $infilename1; } SWITCH2: { unless (ref $input2) { $infilename2 = (-e $input2) ? $input2 : 0 ; last SWITCH2; } if ($input2->isa("Bio::PrimarySeqI") && $executable eq 'bl2seq' ) { ($fh,$infilename2) = $self->io->tempfile(); $temp = Bio::SeqIO->new(-fh=> $fh, '-format' => 'Fasta'); $temp->write_seq($input2); close $fh; undef $fh; last SWITCH2; } # Option for using psiblast's pre-alignment "jumpstart" feature elsif ($input2->isa("Bio::SimpleAlign") && $executable eq 'blastpgp' ) { # a bit of a lie since it won't be a fasta file ($fh,$infilename2) = $self->io->tempfile(); # first we retrieve the "mask" that determines which residues should # by scored according to their position and which should be scored # using the non-position-specific matrices my @mask = split("", shift ); # get mask # then we have to convert all the residues in every sequence to upper # case at the positions that we want psiblast to use position specific # scoring foreach $seq ( $input2->each_seq() ) { my @seqstringlist = split("",$seq->seq()); for (my $i = 0; $i < scalar(@mask); $i++) { unless ( $seqstringlist[$i] =~ /[a-zA-Z]/ ) {next} $seqstringlist[$i] = $mask[$i] ? uc $seqstringlist[$i]: lc $seqstringlist[$i] ; } my $newseqstring = join("", @seqstringlist); $seq->seq($newseqstring); } # Now we need to write out the alignment to a file # in the "psi format" which psiblast is expecting $input2->map_chars('\.','-'); $temp = Bio::AlignIO->new(-fh=> $fh, '-format' => 'psi'); $temp->write_aln($input2); close $fh; undef $fh; last SWITCH2; } $infilename2 = 0; # Set error flag if you get here } # End SWITCH2 return ($infilename1, $infilename2); } =head2 _setparams Title : _setparams Usage : Internal function, not to be called directly Function: Create parameter inputs for Blast program Example : Returns : parameter string to be passed to Blast Args : Reference to calling object and name of BLAST executable =cut sub _setparams { my ($self,$executable) = @_; my ($attr, $value, @execparams); if ($executable eq 'blastall') {@execparams = @BLASTALL_PARAMS; } if ($executable eq 'blastpgp') {@execparams = @BLASTPGP_PARAMS; } if ($executable eq 'bl2seq') {@execparams = @BL2SEQ_PARAMS; } my $param_string = ""; for $attr ( @execparams ) { $value = $self->$attr(); next unless (defined $value); # Need to prepend datadirectory to database name if ($attr eq 'd' && ($executable ne 'bl2seq')) { # This is added so that you can specify a DB with a full path if (! (-e $value.".nin" || -e $value.".pin")){ $value = File::Spec->catdir($DATADIR,$value); } } # put params in format expected by Blast $attr = '-'. $attr ; $param_string .= " $attr $value "; } # if ($self->quiet()) { $param_string .= ' >/dev/null';} return $param_string; } =head1 Bio::Tools::Run::Wrapper methods =cut =head2 no_param_checks Title : no_param_checks Usage : $obj->no_param_checks($newval) Function: Boolean flag as to whether or not we should trust the sanity checks for parameter values Returns : value of no_param_checks Args : newvalue (optional) =cut =head2 save_tempfiles Title : save_tempfiles Usage : $obj->save_tempfiles($newval) Function: Returns : value of save_tempfiles Args : newvalue (optional) =cut =head2 outfile_name Title : outfile_name Usage : my $outfile = $tcoffee->outfile_name(); Function: Get/Set the name of the output file for this run (if you wanted to do something special) Returns : string Args : [optional] string to set value to =cut =head2 tempdir Title : tempdir Usage : my $tmpdir = $self->tempdir(); Function: Retrieve a temporary directory name (which is created) Returns : string which is the name of the temporary directory Args : none =cut =head2 cleanup Title : cleanup Usage : $tcoffee->cleanup(); Function: Will cleanup the tempdir directory after a PAML run Returns : none Args : none =cut =head2 io Title : io Usage : $obj->io($newval) Function: Gets a L<Bio::Root::IO> object Returns : L<Bio::Root::IO> Args : none =cut sub DESTROY { my $self= shift; unless ( $self->save_tempfiles ) { $self->cleanup(); } $self->SUPER::DESTROY(); } 1; __END__