diff variant_effect_predictor/Bio/Seq/PrimedSeq.pm @ 0:1f6dce3d34e0

Uploaded

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/variant_effect_predictor/Bio/Seq/PrimedSeq.pm	Thu Apr 11 02:01:53 2013 -0400
@@ -0,0 +1,480 @@
+# BioPerl module for Bio::PrimedSeq
+#
+# Cared for by Chad Matsalla <[e-mail]>
+#
+# Copyright Chad Matsalla
+#
+# You may distribute this module under the same terms as perl itself
+
+# POD documentation - main docs before the code
+
+=head1 Bio::Seq::PrimedSeq
+
+Bio::Seq::PrimedSeq - A representation of a sequence and two primers flanking a
+target region for amplification
+
+=head1 SYNOPSIS
+
+  # create a sequence
+  my $sequence = "ctagctagctagctagctagctagctagctgatcgtagctagctagct";
+  # create left and right primer seqfeatures
+  # unfortunately, I haven't created constructors for these yet.
+  my $left = Bio::SeqFeature::Primer();
+  my $right = Bio::SeqFeature::Primer();
+  # now create the PrimedSeq
+  $primedseq = new Bio::Seq::PrimedSeq(
+                                       -seq => $sequence,
+                                       -display_id => "chads_fantastic_sequence",
+                                       -LEFT_PRIMER => $left,
+                                       -RIGHT_PRIMER => $right,
+                                       -TARGET => '513,26'
+                                       -PRIMER_PRODUCT_SIZE_RANGE => '100-500'
+                                       -PRIMER_FILE_FLAG => '0'
+                                       -PRIMER_LIBERAL_BASE => '1'
+                                       -PRIMER_NUM_RETURN => '1'
+                                       -PRIMER_FIRST_BASE_INDEX => '1'
+                                       -PRIMER_EXPLAIN_FLAG => '1'
+                                       -PRIMER_PRODUCT_SIZE => '185'
+                                       );
+  # get the amplified region
+  my $amplified_sequence = $primed_seq->get_amplified_sequence();
+
+=head1 DESCRIPTION
+
+This module is a slightly glorified capsule containg a primed seqBuence. It was
+created to address the fact that a primer is more the a seqfeature and there
+need to be ways to represent the primer-sequence complex and the behaviors and
+attributes that are associated with the complex.
+
+=head1 FEEDBACK
+
+User feedback is an integral part of the evolution of this and other
+Bioperl modules. Send your comments and suggestions preferably to one
+of the Bioperl mailing lists.  Your participation is much appreciated.
+
+  [e-mail]          - General discussion
+  http://bio.perl.org/MailList.html             - About the mailing lists
+
+=head2 Reporting Bugs
+
+Report bugs to the Bioperl bug tracking system to help us keep track
+the bugs and their resolution.  Bug reports can be submitted via email
+or the web:
+
+  [e-mail]
+  http://bugzilla.bioperl.org/
+
+=head1 APPENDIX
+
+The rest of the documentation details each of the object
+methods. Internal methods are usually preceded with a _
+
+=cut
+
+
+# Let the code begin...
+
+
+package Bio::Seq::PrimedSeq;
+use vars qw(@ISA);
+use strict;
+
+use Bio::RangeI;
+
+@ISA = qw(Bio::Seq);
+
+
+=head2 new
+
+ Title   : new()
+ Usage   : $primed_sequence = new Bio::SeqFeature::Primer( -seq => $sequence,
+                                                            -left_primer => $left_primer,
+                                                            -right_primer => $right_primer);
+ Function: A constructor for an object representing a primed sequence 
+ Returns : A Bio::Seq::PrimedSeq object
+ Args    : 
+     -seq => a Bio::Seq object
+     -left_primer => a Bio::SeqFeature::Primer object
+     -right_primer => a Bio::SeqFeature::Primer object
+     Many other parameters can be included including all of the output
+     parameters from the primer3 program.
+Developer Notes: This is incomplete and doesn't work. As of ISMB2002 I am working on it.
+
+
+=cut
+
+sub new {
+     my($class,@args) = @_;
+     my %arguments = @args;
+     my $self = $class->SUPER::new(@args);
+          # these are the absolute minimum components required to make
+          # a primedseq
+     my $newkey;
+     foreach my $key (sort keys %arguments) {
+          ($newkey = $key) =~ s/-//;
+          $self->{$newkey} = $arguments{$key};
+          push @{$self->{arguments}},$newkey;
+     }
+          # and now the insurance- make sure that things are ok
+     if (!$self->{target_sequence} || !$self->{left_primer} || !$self->{right_primer} ) {
+          $self->throw("You must provide a target_sequence, left_primer, and right_primer to create this object.");
+     }
+     if (ref($self->{target_sequence}) ne "Bio::Seq") {
+          $self->throw("The target_sequence must be a Bio::Seq to create this object.");
+     }
+     if (ref($self->{left_primer}) ne "Bio::SeqFeature::Primer" || ref($self->{right_primer}) ne "Bio::SeqFeature::Primer") {
+          $self->throw("You must provide a left_primer and right_primer, both as Bio::SeqFeature::Primer to create this object.");
+     }
+     return $self;
+}
+
+
+=head2 get_left_primer
+
+ Title   : get_left_primer();
+ Usage   : $left_primer = $primedseq->get_left_primer();
+ Function: A getter for the left primer in thie PrimedSeq object.
+ Returns : A Bio::SeqFeature::Primer object
+ Args    : None.
+
+=cut
+
+sub get_left_primer() {
+     my $self = shift;
+
+
+
+
+}
+
+
+
+
+
+
+
+
+
+
+
+
+=head2 Bio::RangeI methods
+
+List of interfaces inherited from Bio::RangeI (see L<Bio::RangeI>
+for details).
+
+=head2 start
+
+ Title   : start
+ Usage   : $start = $feat->start
+ Function: Returns the start coordinate of the feature
+ Returns : integer
+ Args    : none
+Developer Notes:
+          This is entirely dependent on the sequence to which this primer is attached!
+          I think that there could be trouble if one takes this primer from sequence 1
+          and naively place it on sequence 2 without updating this
+          ** This is incomplete at this time.
+=cut
+
+sub start() {
+     my $self = shift;
+
+
+}
+
+
+
+
+=head2 end
+
+ Title   : end
+ Usage   : $end = $feat->end
+ Function: Returns the end coordinate of the feature
+ Returns : integer
+ Args    : none
+Developer Notes:
+          ** This is incomplete at this time.
+=cut
+
+sub end() {
+     my $self = shift;
+
+
+}
+
+=head2 strand
+
+ Title   : strand
+ Usage   : $strand = $feat->strand()
+ Function: Returns strand information, being 1,-1 or 0
+ Returns : -1,1 or 0
+ Args    : none
+Developer Notes:
+          ** This is incomplete at this time.
+
+
+=cut
+
+sub strand() {
+     my $self = shift;
+}
+
+
+=head2 SeqFeatureI specific methods
+
+New method interfaces.
+
+=head2 sub_SeqFeature
+
+ Title   : sub_SeqFeature
+ Usage   : @feats = $feat->sub_SeqFeature();
+ Function: Returns an array of sub Sequence Features
+ Returns : An array
+ Args    : none
+
+=cut
+
+sub sub_SeqFeature{
+   my ($self,@args) = @_;
+
+   $self->throw_not_implemented();
+}
+
+=head2 display_id
+
+ Title   : display_id
+ Usage   : $name = $feat->display_id()
+ Function: Returns the human-readable ID of the
+           feature for displays.
+ Returns : a string
+ Args    : none
+
+=cut
+
+sub display_id { 
+  my ($self,@args) = @_;
+  $self->throw_not_implemented();
+}
+
+=head2 primary_tag
+
+ Title   : primary_tag
+ Usage   : $tag = $feat->primary_tag()
+ Function: Returns the primary tag for a feature,
+           eg 'exon'
+ Returns : a string 
+ Args    : none
+
+
+=cut
+
+sub primary_tag{
+   my ($self,@args) = @_;
+
+   $self->throw_not_implemented();
+
+}
+
+=head2 source_tag
+
+ Title   : source_tag
+ Usage   : $tag = $feat->source_tag()
+ Function: Returns the source tag for a feature,
+           eg, 'genscan' 
+ Returns : a string 
+ Args    : none
+
+
+=cut
+
+sub source_tag{
+   my ($self,@args) = @_;
+
+   $self->throw_not_implemented();
+}
+
+=head2 has_tag
+
+ Title   : has_tag
+ Usage   : $tag_exists = $self->has_tag('some_tag')
+ Function: 
+ Returns : TRUE if the specified tag exists, and FALSE otherwise
+ Args    :
+
+
+=cut
+
+sub has_tag{
+   my ($self,@args) = @_;
+
+   $self->throw_not_implemented();
+
+}
+
+=head2 each_tag_value
+
+ Title   : each_tag_value
+ Usage   : @values = $self->each_tag_value('some_tag')
+ Function: 
+ Returns : An array comprising the values of the specified tag.
+ Args    :
+
+
+=cut
+
+sub each_tag_value {
+   my ($self,@args) = @_;
+
+   $self->throw_not_implemented();
+}
+
+=head2 all_tags
+
+ Title   : all_tags
+ Usage   : @tags = $feat->all_tags()
+ Function: gives all tags for this feature
+ Returns : an array of strings
+ Args    : none
+
+
+=cut
+
+sub all_tags{
+   my ($self,@args) = @_;
+
+   $self->throw_not_implemented();
+}
+
+=head2 gff_string
+
+ Title   : gff_string
+ Usage   : $str = $feat->gff_string;
+           $str = $feat->gff_string($gff_formatter);
+ Function: Provides the feature information in GFF format.
+
+           The implementation provided here returns GFF2 by default. If you
+           want a different version, supply an object implementing a method
+           gff_string() accepting a SeqFeatureI object as argument. E.g., to
+           obtain GFF1 format, do the following:
+
+                my $gffio = Bio::Tools::GFF->new(-gff_version => 1);
+                $gff1str = $feat->gff_string($gff1io);
+
+ Returns : A string
+ Args    : Optionally, an object implementing gff_string().
+
+
+=cut
+
+sub gff_string{
+   my ($self,$formatter) = @_;
+
+   $formatter = $self->_static_gff_formatter unless $formatter;
+   return $formatter->gff_string($self);
+}
+
+my $static_gff_formatter = undef;
+
+=head2 _static_gff_formatter
+
+ Title   : _static_gff_formatter
+ Usage   :
+ Function:
+ Example :
+ Returns : 
+ Args    :
+
+
+=cut
+
+sub _static_gff_formatter{
+   my ($self,@args) = @_;
+
+   if( !defined $static_gff_formatter ) {
+       $static_gff_formatter = Bio::Tools::GFF->new('-gff_version' => 2);
+   }
+   return $static_gff_formatter;
+}
+
+
+
+=head1 RangeI methods
+
+These methods are inherited from RangeI and can be used
+directly from a SeqFeatureI interface. Remember that a 
+SeqFeature is-a RangeI, and so wherever you see RangeI you
+can use a feature ($r in the below documentation).
+
+=head2 overlaps
+
+  Title   : overlaps
+  Usage   : if($feat->overlaps($r)) { do stuff }
+            if($feat->overlaps(200)) { do stuff }
+  Function: tests if $feat overlaps $r
+  Args    : a RangeI to test for overlap with, or a point
+  Returns : true if the Range overlaps with the feature, false otherwise
+
+
+=head2 contains
+
+  Title   : contains
+  Usage   : if($feat->contains($r) { do stuff }
+  Function: tests whether $feat totally contains $r
+  Args    : a RangeI to test for being contained
+  Returns : true if the argument is totaly contained within this range
+
+
+=head2 equals
+
+  Title   : equals
+  Usage   : if($feat->equals($r))
+  Function: test whether $feat has the same start, end, strand as $r
+  Args    : a RangeI to test for equality
+  Returns : true if they are describing the same range
+
+
+=head1 Geometrical methods
+
+These methods do things to the geometry of ranges, and return
+triplets (start, stop, strand) from which new ranges could be built.
+
+=head2 intersection
+
+  Title   : intersection
+  Usage   : ($start, $stop, $strand) = $feat->intersection($r)
+  Function: gives the range that is contained by both ranges
+  Args    : a RangeI to compare this one to
+  Returns : nothing if they do not overlap, or the range that they do overlap
+
+=head2 union
+
+  Title   : union
+  Usage   : ($start, $stop, $strand) = $feat->union($r);
+          : ($start, $stop, $strand) = Bio::RangeI->union(@ranges);
+  Function: finds the minimal range that contains all of the ranges
+  Args    : a range or list of ranges to find the union of
+  Returns : the range containing all of the ranges
+
+=cut
+
+=head2 location
+
+ Title   : location
+ Usage   : my $location = $seqfeature->location()
+ Function: returns a location object suitable for identifying location 
+	   of feature on sequence or parent feature  
+ Returns : Bio::LocationI object
+ Args    : none
+
+
+=cut
+
+sub location {
+   my ($self) = @_;
+
+   $self->throw_not_implemented();
+}
+
+
+1;